Aroma-enhancing composite yeast agent for fermenting fruit wine and application of aroma-enhancing composite yeast agent

Abstract

The invention relates to an aroma-enhancing composite yeast agent for fermenting fruit wine and application of the aroma-enhancing composite yeast agent, and belongs to the field of microbial strain screening and application thereof. The composite yeast agent provided by the invention comprises saccharomyces cerevisiae G1 and Wickerhamomyces anomalus GZJ2, and can be applied to fermentation preparation of alcohol or fruit wine; the composite yeast agent provided by the invention is used for fermenting passion fruits to brew the passion fruit wine, the obtained passion fruit wine is stronger in fragrance and higher in total ester content, and the flavor and the quality are remarkably improved.

Description

Technical Field

[0001] The invention relates to a flavor-enhancing composite yeast agent for fermenting fruit wine and application thereof, belonging to the technical field of microbial strain screening and application. Background Art

[0002] Passion fruit is the fruit with the richest vitamin content among the fruits currently sold on the market. There are many substances in the passion fruit pulp, including a large amount of protein, carotene, fat, sugar, various vitamins and a variety of trace elements required by the human body, as well as SOD effective enzymes, super fiber, phenols and other nutrients. Since the pulp is rich in vitamins and proteins, proper intake of passion fruit can improve the body's immunity and help the body detoxify and beautify.

[0003] At present, passion fruit is mainly sold as fresh fruit on the market, and there are also passion fruit preserves, passion fruit juice and other products. In recent years, fruit wine, fruit vinegar and other products produced by fruit fermentation have been popular among consumers. Fruit wine brewing uses fruit as raw materials and produces fruit wine through the physiological metabolism of yeast strains. Therefore, the quality of the fruit wine is directly affected by the performance of the strain. At present, in the brewing of passion fruit wine, commercial strains such as wine brewing yeast are often used to brew passion fruit wine. There is no yeast strain specifically suitable for the brewing of passion fruit wine, which cannot fully show the flavor of passion fruit wine. Summary of the invention

[0004] In view of some deficiencies in the prior art, the present invention provides a flavor-enhancing composite yeast agent for fermenting fruit wine and its application. The composite yeast agent of the present invention can be used to brew passion fruit wine. Compared with passion fruit wine brewed by Saccharomyces cerevisiae G1 alone or passion fruit wine brewed by Angel Yeast, the passion fruit wine brewed by the composite yeast agent of the present invention has a higher total ester content and a suitable alcohol content.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The invention firstly provides a composite yeast agent, which comprises two strains of saccharomyces cerevisiae and anomalous wickham yeast; the saccharomyces cerevisiae is classified and named as saccharomyces cerevisiae G1, and its preservation number is CCTCC NO: M2024815; the anomalous wickham yeast is classified and named as anomalous wickham yeast GZJ2 (Wickerhamomyces anomalus GZJ2), and its preservation number is CCTCC NO: M2023857.

[0007] Among them, the brewer's yeast G1 was deposited in the Wuhan Type Culture Collection Center of China, the preservation date was April 30, 2024, and the preservation address was Wuhan University, Wuhan, China; the abnormal Wickham yeast GZJ2 was deposited in the Wuhan Type Culture Collection Center of China, the preservation date was May 29, 2023, and the preservation address was Wuhan University, Wuhan, China.

[0008] Furthermore, the ratio of the amount of Saccharomyces cerevisiae to the abnormal Wickham yeast in the composite yeast agent is 1-6:6-1 based on the number of live bacteria. Preferably, the ratio of the amount of Saccharomyces cerevisiae to the abnormal Wickham yeast in the composite yeast agent is 1:5 based on the number of live bacteria.

[0009] The cerevisiae yeast G1 is an ester-producing yeast, and the abnormal wickham yeast GZJ2 is an aroma-enhancing yeast.

[0010] The invention also provides application of the composite yeast agent in fruit wine brewing.

[0011] Furthermore, the fruit wine is passion fruit wine.

[0012] The present invention also provides a method for preparing passion fruit wine, which comprises: using the composite yeast agent to ferment passion fruit to prepare the passion fruit wine.

[0013] Furthermore, the method comprises the following steps:

[0014] Wash the passion fruit, cut it open and collect the passion fruit pulp and seeds (or passion fruit pulp); add appropriate amount of water and enzyme to the passion fruit pulp, stir well and perform enzymolysis; filter to remove the pulp and seeds in the pulp after enzymolysis; adjust the pH value and sugar content after removing the pulp and seeds; add potassium metabisulfite, inoculate with a composite yeast agent for fermentation; filter the fermentation product, centrifuge it, take the supernatant and sterilize it to obtain passion fruit wine.

[0015] The volume ratio of the passion fruit pulp to water is 3:1, the dosage ratio of the enzyme to the passion fruit pulp is 0.4 g:200 mL, the enzyme is a mixture of cellulase and pectinase, and the mass ratio of the cellulase to pectinase is 1:5.

[0016] The enzymolysis was carried out in a 40° C. water bath for 2 h, with stirring every 15 min.

[0017] The pH value is adjusted with baking soda, and the sugar content is adjusted with white granulated sugar.

[0018] Furthermore, the pH value is adjusted to 3.5 with baking soda, and the sugar content is adjusted to 21.8°Bx with white sugar.

[0019] The amount of potassium pyrosulfite added is such that the sulfur dioxide concentration is 150 mg / L after adding potassium pyrosulfite.

[0020] The inoculation amount of the composite yeast agent is 1-5%, preferably, the inoculation amount of the composite yeast agent is 2%.

[0021] The fermentation condition is fermentation at a constant temperature of 15-30° C. for 5-10 days. Preferably, the fermentation condition is fermentation at a constant temperature of 18° C. for 6 days.

[0022] The filtration is performed using a 200-mesh filter; the centrifugation is performed at 8000 r / min and 4° C. for 15 min.

[0023] The sterilization and disinfection is carried out by utilizing SO2.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] (1) The present invention provides a composite yeast agent, which comprises an ester-producing Saccharomyces cerevisiae G1 and an aroma-enhancing abnormal Wickham yeast GZJ, wherein the ratio of the number of live bacteria of Saccharomyces cerevisiae G1 to the abnormal Wickham yeast GZJ2 is 1-6:6-1. The composite yeast agent prepared by the present invention can be applied to alcohol brewing or fruit wine brewing, especially to brewing passion fruit wine, thereby solving the technical problem of the current lack of composite agents for brewing passion fruit wine, and further achieving the technical advantages of the passion fruit wine brewed using the composite agent of the present invention having a stable alcohol content and a stronger aroma.

[0026] (2) The present invention also uses the composite yeast agent to brew passion fruit wine, and the ratio of the number of live bacteria of Saccharomyces cerevisiae G1 to abnormal Wickham yeast GZJ2 in the composite yeast agent is set to 1-6:6-1, and under the condition that the ratio of the number of live bacteria of Saccharomyces cerevisiae G1 to abnormal Wickham yeast GZJ2 is 1:5, the alcohol content of the brewed passion fruit wine is more stable, and the advantages of abnormal Wickham yeast GZJ2 in producing esters and aroma can be fully utilized. The present invention is verified by the embodiment that the total ester content of the passion fruit wine brewed by the method of the present invention can reach 3.52g / L, which is much greater than the passion fruit wine fermented by Saccharomyces cerevisiae G1 alone, or the passion fruit wine brewed by Angel Yeast, and the aroma is stronger. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a comparison chart of the ester production capacity of Saccharomyces cerevisiae G1 and Angel Yeast.

[0028] Figure 2 This is the colony morphology of Saccharomyces cerevisiae G1 on YPD solid culture medium; in the figure, A is the front colony image, and B is the side colony image.

[0029] Figure 3 This is the colony morphology of Saccharomyces cerevisiae G1 on WL medium; in the figure, A is the front colony image, and B is the side colony image.

[0030] Figure 4 is the phylogenetic tree of Saccharomyces cerevisiae G1.

[0031] Figure 5 This is a comparison chart of the alcohol production capacity of Saccharomyces cerevisiae G1 and Angel Yeast.

[0032] Figure 6 This is a comparison chart of the acid production capacity of Saccharomyces cerevisiae G1 and Angel Yeast.

[0033] Figure 7 This is a comparison chart of the gas production capacity of Saccharomyces cerevisiae G1 and Angel Yeast.

[0034] Figure 8 This is a comparison chart of the acid resistance of Saccharomyces cerevisiae G1 and Angel Yeast.

[0035] Fig. 9 This is a comparison chart of the SO2 tolerance of Saccharomyces cerevisiae G1 and Angel Yeast.

[0036] Fig.10 This is a comparison chart of the alcohol tolerance of Saccharomyces cerevisiae G1 and Angel Yeast.

[0037] Fig.11 is the growth curve of Saccharomyces cerevisiae G1.

[0038] Fig.12 This is a graph showing the changes in total esters and alcohol content of fruit wine during different fermentation days.

[0039] Fig.13 This is a graph showing the changes in total esters and alcohol content of fruit wine at different inoculation rates of composite yeast agents.

[0040] Fig.14 This is a graph showing the changes in total ester and alcohol content of fruit wine under different ratios of live bacterial cell numbers of G1:GZJ in the composite yeast agent.

[0041] Fig.15 This is a graph showing the changes in total esters and alcohol content of fruit wine under different fermentation temperature conditions.

[0042] Fig.16 This is a comparison chart of the total acid content of passion fruit wine brewed with four groups of bacteria or bacterial agents.

[0043] Fig.17 This is a comparison chart of the total ester content of passion fruit wine brewed with four groups of bacteria or bacterial agents.

[0044] Fig.18 This is a comparison chart of the alcohol content of passion fruit wine brewed with 4 groups of bacteria or bacterial agents.

[0045] Fig.19 This is a comparison chart of the sensory evaluation of passion fruit wine brewed with 4 groups of bacteria or bacterial agents. DETAILED DESCRIPTION

[0046] The present invention is further explained below in conjunction with the examples, which are only used to illustrate the present invention and are not used to limit the scope of the present invention. For those skilled in the art, any modifications made without departing from the content, spirit and scope of the present invention are within the scope of protection of the present invention. The experimental methods in the examples where specific conditions are not indicated are all in accordance with conventional conditions; the reagents and biological materials, unless otherwise specified, can be obtained from commercial sources.

[0047] The culture medium used in the examples is:

[0048] YPD medium: 10 g / L yeast powder, 20 g / L peptone, 20 g / L glucose, fixed to volume with distilled water. For solid medium, add 20 g / L agar.

[0049] WL medium: purchased from Beijing Solebow Technology Co., Ltd.

[0050] TTC upper culture medium: TTC (triphenyltetrazolium hydrochloride) 0.5 g / L, glucose 5 g / L, agar 15 g / L, distilled water to volume.

[0051] TTC lower layer culture medium: glucose 10g / L, peptone 2g / L, yeast powder 1.5g / L, dipotassium hydrogen phosphate 1g / L, MgSO4·7H2O 4g / L, agar 20g / L, distilled water to volume.

[0052] The separation, purification, identification, preservation and physiological and biochemical characteristics of the abnormal Wickham yeast GZJ2 involved in the present invention are disclosed in the patent with publication number CN116904330A.

[0053] Example 1: Isolation, purification, identification and preservation of Saccharomyces cerevisiae G1

[0054] The separation and purification method of Saccharomyces cerevisiae G1 is as follows:

[0055] Separation and purification: Take the passion fruit peel and wash it with sterile physiological saline to obtain a washing solution, dilute it 10 times in a gradient to obtain dilutions of different concentrations, select dilutions of different concentrations and evenly apply them on the solid culture medium, and make 3 parallels for each dilution gradient. Place the coated culture medium plate in a 30°C constant temperature incubator for 48 hours and observe the colony state; select a single colony with a spherical, milky white, opaque colony on the plate coated with the dilution with a dilution of 10-6, and streak it separately, perform multiple streaking purification on the YPD solid culture medium until the bacterial morphology is consistent, and store the purified strain in a 4° refrigerator for standby use.

[0056] Rescreening of yeasts with strong ester production ability:

[0057] The strains screened above and commercial Angel Yeast were inoculated into the processed passion fruit pulp at a 2% inoculation rate, and fermented at a constant temperature of 30°C for 10 days. The results were determined by referring to the indicator method in GB / T10345-2022 "Analysis Method for Liquor". Figure 1 As shown, taking the commercially available Angel yeast as a control, the present invention further screened out a yeast with significantly higher ester production ability than Angel yeast. The ester production of the yeast screened by the present invention was 0.35 g / L higher than that of Angel yeast. The wine body fermented by commercial Angel yeast was 1.94 g / L, and the wine body fermented by the yeast of the present invention was 2.29 g / L, and the ester production was increased by 18%.

[0058] Among them, the processing method of passion fruit pulp is:

[0059] Select passion fruits with fresh and ripe stalks, wash them, cut them open and collect the pulp and seeds inside to make passion fruit pulp. Add an appropriate amount of water (the volume ratio of pulp to water is 3:1) to the processed passion fruit pulp, add 0.2% enzyme (mass volume percentage, the ratio of enzyme to passion fruit pulp is: 0.4g:200mL, the enzyme is a mixture of cellulase and pectinase, the mass ratio of the two is 1:5, dissolved in a small amount of water and added), and stir evenly. Enzymolysis in a 40℃ water bath for 2h, stirring every 15min. Filter the passion fruit after the water bath with a 400-mesh filter to remove the pulp and seeds of the passion fruit. Use baking soda to adjust the pH value of the passion fruit pulp to 3.5, and use white sugar to adjust its sugar content to 21.8°Bx. Potassium pyrosulfite is added to the pulp after adjusting the sugar and acidity (the amount of potassium pyrosulfite added is such that the sulfur dioxide concentration is 150 mg / L after adding potassium pyrosulfite) to obtain treated passion fruit pulp.

[0060] Furthermore, the screened yeasts were identified by morphology and molecular biology.

[0061] Morphological identification:

[0062] (1) Colony morphology under YPD medium:

[0063] The purified Saccharomyces cerevisiae G1 strain was inoculated on YPD solid medium, and its colony morphology was observed after 48 hours. Figure 2 This is the colony morphology diagram under YPD solid culture medium; Figure 2 As shown, the colonies are milky white, spherical, opaque, with a bulge in the center, a smooth surface, regular edges and are easy to pick up.

[0064] (2) Colony morphology under WL medium:

[0065] The purified Saccharomyces cerevisiae G1 strain was inoculated on WL solid medium, and its colony morphology was observed after 3-5 days. Figure 3 This is the colony morphology under WL medium. Figure 3 As shown, the colonies are green, spherical, smooth in surface, with regular edges and a bulge in the center, and the color gradually fades to milky white from the center to the edge.

[0066] Molecular Biology Identification:

[0067] (1) Bacterial Activation

[0068] The isolated and purified yeast strain was inoculated into YPD solid medium and cultured in a constant temperature incubator at 30°C for 48 h.

[0069] (2) PCR amplification

[0070] Colony PCR was performed on the yeast strain cultured in step (1). The primers used for yeast strain identification in this example are yeast 26S rDNA gene D1 / D2 region sequence amplification primers, and their sequences are:

[0071] ①Forward primer NL1: 5′-GCATATCAATAAGCGGAGGAAAAG-3′;

[0072] ②Reverse primer NL4: 5′-GGTCCGTGTTTCAAGACGG-3′.

[0073] The PCR reaction system is as follows: DNA template is a small amount of bacteria picked up by the tip of the gun (20 μL of the tip), 0.8 μL of forward primer, 0.8 μL of reverse primer, Premix Taq TM 15 μL of ddH2O to make up to 30 μL of total system.

[0074] The PCR amplification program was as follows: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 35 s, for a total of 34 cycles, and finally extension at 72°C for 7 min.

[0075] Agarose gel electrophoresis: The PCR amplification product was verified by 1% agarose gel electrophoresis, and the yeast band was found to be located at about 600 bp.

[0076] (3) Sequence analysis and phylogenetic tree construction

[0077] The qualified PCR amplification products verified by agarose gel electrophoresis in step (2) were sent to Shanghai Jie Li Biotechnology Co., Ltd. for sequencing. The sequencing results were compared and analyzed by the BLAST program in NCBI, and the similarity with the 26S rDNA D1 / D2 region sequences of other reported Saccharomyces cerevisiae strains was more than 99%; in order to further show the relationship between the sequenced strains and the known Saccharomyces cerevisiae, the phylogenetic tree was constructed using MEGA 11 biological software, as shown in Figure 1. Figure 4 As shown, the bacteria was identified as Saccharomyces cerevisiae G1.

[0078] The 26S sequence of Saccharomyces cerevisiae G1 is shown in SEQ.ID.No:1:

[0079] caagacgggc ggcatataac cattatgcca gcatccttga cttacgtcgc agtcctcagtcccagctggc agtattccca caggct

[0080] ataa tacttaccga ggcaagctac attcctatgg atttatcctg ccaccaaaactgatgctggc ccagtgaaat gcgagattcc cc

[0081] tacccaca aggagcagag ggcacaaaac accatgtctg atcaaatgcc cttccctttcaacaatttca cgtacttttt cactctcttt

[0082] tcaaagttct tttcatcttt ccatcactgt acttgttcgc tatcggtctc tcgccaatatttagctttag atggaattta ccacccactt ag

[0083] agctgcattcccaaacaa ctcgactctt cgaaggcact ttacaaagaa ccgcactcctcgccacacgg gattctcacc ctctatgac

[0084] g tcctgttcca aggaacatag acaaggaacg gccccaaagt tgccctctcc aaattacaactcgggcaccg aaggtaccag at

[0085] ttcaaatt tgagcttttg ccgcttcact cgccgttat aaggcaatcc cggttggtttcttttcctcc gaa

[0086] The strain was sent to the China Center for Type Culture Collection for preservation on April 30, 2024, with the address: Wuhan University, Wuhan, China, and the preservation number is: CCTCC NO:M 2024815.

[0087] Bacteria preservation:

[0088] Storage on plates or slants: Inoculate the isolated Saccharomyces cerevisiae G1 onto YPD plates or slants, culture in a 30°C constant temperature incubator for 48 hours, and then store in a 4°C refrigerator for short-term use.

[0089] Glycerol storage: The isolated Saccharomyces cerevisiae G1 was inoculated onto a YPD plate, cultured at 30°C for 48 h, and then inoculated into YPD liquid culture medium and cultured for 18-20 h. The liquid culture medium was evenly mixed with sterile 30% glycerol in a ratio of 1:1 and stored in a -80°C refrigerator.

[0090] Example 2: Physiological and biochemical characteristics of Saccharomyces cerevisiae G1

[0091] In this example, the wine, ester, acid and gas production capabilities of Saccharomyces cerevisiae G1 in the process of preparing passion fruit wine were investigated, and the acid resistance, SO2 resistance, alcohol resistance, bacterial growth curve and bacterial toxicity of Saccharomyces cerevisiae G1 were investigated. The relevant methods and results are as follows:

[0092] (1) Alcohol production capacity

[0093] The screened strains and commercial Angel Yeast were inoculated into the processed passion fruit pulp at a 2% inoculation rate, and fermented at a constant temperature of 30℃ for 10 days. The alcohol content was measured using a refractometer. The commercial strain Angel Yeast was used as a control, and each group was measured in parallel for 3 times. Figure 5 As shown, with the commercially available Angel yeast as the control, the alcohol production performance of Saccharomyces cerevisiae G1 is as stable as that of Angel yeast, and the alcohol content is around 9.8°.

[0094] Among them, the processing method of passion fruit pulp is:

[0095] Select passion fruits with fresh and ripe stalks, wash them, cut them open and collect the pulp and seeds inside to make passion fruit pulp. Add an appropriate amount of water (the volume ratio of pulp to water is 3:1) to the processed passion fruit pulp, add 0.2% enzyme (that is, the ratio of enzyme to passion fruit pulp is 0.4g:200mL, where the enzyme is a mixture of cellulase and pectinase, the mass ratio of the two is 1:5, dissolved in a small amount of water and added), and stir evenly. Hydrolyze in a 40℃ water bath for 2h, stirring every 15min. Filter the passion fruit after the water bath with a 400-mesh filter to remove the pulp and seeds of the passion fruit. Use baking soda to adjust the pH value of the passion fruit pulp to 3.5, and use white sugar to adjust its sugar content to 21.8°Bx. Potassium pyrosulfite is added to the pulp after adjusting the sugar and acidity (the amount of potassium pyrosulfite added is such that the sulfur dioxide concentration is 150 mg / L after adding potassium pyrosulfite) to obtain treated passion fruit pulp.

[0096] (2) Acid production capacity

[0097] The selected strains and commercial Angel Yeast were inoculated into the processed passion fruit pulp at a 2% inoculation rate, and fermented at a constant temperature of 30°C for 10 days. The total acid determination direct titration method in accordance with GB / T15038-2006 "General Analytical Methods for Grape and Fruit Wine" was used for detection. Figure 6 As shown, with the commercially available Angel yeast as the control, the acid production ability of the brewing yeast G1 of the present invention is significantly weaker than that of Angel yeast. The total acidity of the fruit wine fermented by Angel yeast is 23.92 g / L, and the total acidity of the wine fermented by the brewing yeast G1 of the present invention is 22.28 g / L. The acidity of the passion fruit wine prepared by the brewing yeast G1 of the present invention is more suitable.

[0098] (3) Gas production capacity

[0099] The Duroc tube fermentation method was selected to determine the gas production ability of yeast. The gas production ability of yeast can characterize the growth rate of the strain. Referring to the method of Xie Xinyu et al. (Xie Xinyu et al., Research on Screening of Strawberry Wine Strawberry Strain and Sequential Mixed Fermentation Technology. Fuyang Normal University, 2024. DOI: 10.27846 / d.cnki.gfysf.2022.000288.), a single activated strain (activated and cultured in a constant temperature incubator at 30°C for 48 hours) was picked, and cultured in YPD liquid culture medium at 30°C for 24 hours. The seed liquid was inoculated into a test tube containing YPD liquid culture medium at an inoculation rate of 2% (V / V). An inverted Duroc tube without bubbles was placed at the bottom of the test tube, and cultured at a constant temperature of 30°C. The start time of gas production of the yeast strain and the full time of the Duroc tube were observed, and 3 groups of replicates were set up for each group. The height of the gas produced in the Duroc tube was recorded every 1 hour, and yeast with excellent gas production ability was screened according to the start time of gas production and the full time of the Duroc tube. The results are as follows Figure 7As shown, taking the commercially available Angel yeast as the control, the duocupancy tube fermentation started at 4.5 hours and the duocupancy tube was full at 10 hours, while the strain G1 screened by the present invention started at 5.5 hours and the duocupancy tube was full at 11 hours, which proved that the gas production ability of the brewer's yeast G1 of the present invention is stronger than that of the commercially available Angel yeast.

[0100] (4) Acid resistance

[0101] After sterilizing the glass bottles filled with YPD liquid culture medium, citric acid was added, and the concentration of citric acid in the culture medium was adjusted to 15g / L, 18g / L, 21g / L, 24g / L, and 27g / L, respectively. The activated yeast (activated and cultured in a constant temperature incubator at 30°C for 48h) was inoculated into the glass bottles at a 2% (V / V) inoculation rate. Three replicates were set up for each group. After constant temperature culture at 30°C for 10h, the absorbance was measured at a wavelength of 600nm using an enzyme marker. The results are as follows Figure 8 As shown, with commercial Angel yeast as the control, the acid resistance of strain G1 is as stable as that of commercial Angel yeast.

[0102] (5) SO2 resistance

[0103] Potassium pyrosulfite was added to a sterilized glass bottle containing YPD liquid culture medium, so that the SO2 concentration in the culture medium was adjusted to 100 mg / L, 150 mg / L, 200 mg / L, 250 mg / L, and 300 mg / L. The activated yeast was inoculated into the glass bottle at a 2% (V / V) inoculation rate. Three replicates were set up for each group. After constant temperature cultivation at 30°C for 10 hours, the absorbance was measured at a wavelength of 600 nm using an ELISA reader. The results are as follows: Fig. 9 As shown, taking the commercially available Angel Yeast as the control, when the SO2 concentration is 0-250 mg / L, the growth state of the brewer's yeast G1 of the present invention is more stable.

[0104] (6) Alcohol resistance

[0105] Anhydrous ethanol was added to the sterilized glass bottles containing YPD liquid medium, so that the volume fraction of ethanol in the medium was 8%, 10%, 12%, 14%, and 16%, respectively. The activated yeast was inoculated into the glass bottles at a 2% (V / V) inoculation rate, and 3 replicates were set up for each group. After constant temperature culture at 30°C for 10 hours, the absorbance was measured at a wavelength of 600nm using an enzyme marker. The results are shown in Figure 2. Fig.10 As shown, with commercial Angel Yeast as a control, when the alcohol concentration is 0-16%, the alcohol resistance of the Saccharomyces cerevisiae G1 of the present invention is as stable as that of the commercial Angel Yeast.

[0106] (7) Growth curve

[0107] The growth curve is a standard curve that describes the delay phase, logarithmic phase and stable phase under certain culture conditions, which can provide a theoretical basis for subsequent experiments. The specific steps of the growth curve determination are: take a single colony from the solid culture medium stored at 4°C and streak it on the YPD solid culture medium, place it in a 30°C constant temperature incubator for activation and culture for 48 hours, then pick a single yeast colony from the activated solid culture medium and inoculate it into the YPD liquid culture medium, and culture it at 30°C for 24 hours as the seed liquid. Use YPD liquid culture medium as the fermentation medium, inoculate it at a 1% inoculation rate, and culture it at a constant temperature of 30°C. From the beginning of inoculation, take 200uL from the fermentation liquid every 2 hours, use the blank culture medium as the control, and measure its absorbance at 600nm.

[0108] The growth curve of the above-mentioned Saccharomyces cerevisiae G1 was plotted with the absorbance value as the ordinate and the culture time as the abscissa. Fig.11 As shown in the figure, the growth of yeast showed typical microbial growth characteristics. It was in the growth lag phase from 0 to 4 hours, and entered the logarithmic growth phase after 4 hours. The OD value of Saccharomyces cerevisiae G1 was the largest at the 14th hour. At this time, the bacterial concentration was the highest and the activity was the strongest. After that, it gradually entered the stable growth phase. When brewing passion fruit wine subsequently, Saccharomyces cerevisiae G1 was selected to be cultured to the 14th hour and the bacterial cells were collected.

[0109] (8) Acute toxicity test of Saccharomyces cerevisiae G1

[0110] The culture medium of Saccharomyces cerevisiae G1 was collected and centrifuged at 4°C and 8000 rpm for 15 min. The collected bacteria were washed and centrifuged twice and then sent to Qingdao Kechuang Quality Inspection Co., Ltd. for acute toxicity test.

[0111] The test adopted the limit method, and the bacteria were prepared as the test substance by adding pure water. The test animals were 20 KM mice, half of which were male and half were female (the females had not mated and were not pregnant). They were given a single oral gavage at a dose of 10,000 mg / kg·bw, and the gavage volume was 20 mL / kg·bw. The animals were required to fast before the test. The KM mice fasted for 4 hours and had free access to water. They continued to fast for 1 hour after being given the test substance of brewer's yeast G1. After 14 days of observation, the KM mice did not show any abnormal symptoms or death within 14 days of being given the test substance. The changes in body weight are shown in Table 1. After the end of the test observation, all animals were killed and a gross anatomical examination was performed, and no abnormalities were found. The test results proved that the animals did not produce toxic reactions, no signs of poisoning were observed, and no deaths occurred.

[0112] Table 1. Body weight changes of animals in acute oral toxicity test

[0113]

[0114] No mice died in the 14-day acute oral toxicity test, indicating that the acute oral toxicity LD50 of Saccharomyces cerevisiae G1 to KM mice 50 ≥10000mg / kg, according to GB15193.3-2014 National Food Safety Standard Acute Oral Toxicity Test, when LD 50 When the concentration is ≥5000 mg / kg, the test substance is practically non-toxic, which indicates that the toxicity level of Saccharomyces cerevisiae G1 is practically non-toxic.

[0115] Example 3: Preparation of composite yeast agent

[0116] (1) Bacteria activation and seed liquid culture

[0117] Single colonies of Saccharomyces cerevisiae G1 and abnormal Wickham yeast GZJ2 were taken from the solid culture medium stored at 4°C, streaked on YPD solid culture medium, placed in a 30°C constant temperature incubator for activation culture for 48 hours, and then single yeast colonies were picked from the activated solid culture medium and inoculated into YPD liquid culture medium, and cultured at 30°C for 24 hours as seed solution.

[0118] (2) Bacterial amplification and collection

[0119] The seed solution obtained in step (1) is inoculated into YPD liquid medium at an inoculum amount of 1% (V / V), and cultured at 30°C until the late logarithmic period (wherein the culture time of Saccharomyces cerevisiae G1 is 14 hours, and the culture time of abnormal Wickham yeast GZJ2 is 24 hours) to obtain a fermentation liquid. The fermentation liquid cultured to the late logarithmic period is transferred to a sterile centrifuge tube under a sterile state, centrifuged at 4000r / min for 15 minutes, the supernatant is discarded, and the precipitate obtained by centrifugation of each 100mL of fermentation liquid is resuspended with 2mL of sterile physiological saline to obtain a bacterial suspension.

[0120] The viable bacteria count of the obtained bacterial suspension was as follows: 1×10 8 cfu / mL, abnormal Wickham yeast GZJ2 is 1×10 8 cfu / mL.

[0121] (3) Preparation of compound yeast agent

[0122] The two bacterial suspensions obtained in step (2) are mixed according to the ratio of the number of live bacterial cells of Saccharomyces cerevisiae to that of abnormal Wickham yeast of 1-6:6-1 to obtain a composite yeast agent for subsequent production of passion fruit wine.

[0123] Embodiment 4: the optimization of passion fruit wine fermentation process

[0124] (1) Fermentation time

[0125] The inoculation amount of the composite yeast agent in passion fruit wine was set to 3%, the ratio of the number of live bacteria of G1:GZJ in the composite yeast agent was 1:1, the fermentation temperature was 30℃, and the fermentation days were 5-10 days. The optimal fermentation days were determined by measuring the changes in total ester and alcohol content of the wine during different fermentation times.

[0126] from Fig.12 It can be seen that with the increase of fermentation time, the alcohol content and total ester of the fruit wine show a trend of increasing first and then decreasing. It can be seen from the figure that at the 6th day of fermentation time, the passion fruit wine completed the fermentation, and the alcohol content and total ester of the fruit wine reached the maximum values ​​of 8.25%vol and 2.42g / L respectively. However, with the extension of fermentation time, the total ester content in the fruit wine is gradually decreasing. This may be due to the increase in the fermentation temperature of the passion fruit wine, which accelerates the flow of small molecules in the fermentation tank and accelerates the volatilization of ester substances such as ethyl acetate in the wine. It is also possible that there are a large number of acidic substances such as citric acid after the fermentation of passion fruit wine is completed, which makes the ester substances hydrolyze under the action of acid to form corresponding ester salts or ester salt intermediates, and then further hydrolyze to form carboxylic acids and alcohol substances, so that the total ester content in the wine decreases. Considering the above, the present invention selects the case where the fermentation days are 6d for subsequent experimental research.

[0127] (2) Inoculation volume

[0128] The inoculation amount of the composite yeast agent in passion fruit wine was set at 1-5%, the ratio of the number of live bacteria of G1:GZJ in the composite yeast agent was 1:1, the fermentation temperature was 30℃, and the fermentation days were 6 days. The optimal fermentation inoculation amount was determined by measuring the changes in total ester and alcohol content of the wine during different fermentation times.

[0129] from Fig.13It can be seen that when the inoculation amount of the composite yeast agent is 1% to 2%, the alcohol content and total ester increase with the increase of the yeast inoculation amount; when the inoculation amount is 2.0g / L, the alcohol content and total ester content are the largest, which are 9.96%vol and 2.14g / L respectively; when the inoculation amount is greater than 2%, the alcohol content does not change much, and the larger the inoculation amount, the higher the decomposition rate of the sugar in the fermented yeast liquid by the yeast in the composite yeast agent; however, as the inoculation amount increases, the amount of brewer's yeast in the composite yeast agent also increases, and brewer's yeast G1 enters the growth stable period in 14 hours, while the non-brewer's yeast in the composite yeast agent can enter the stable period after 24 hours, and the nutrients in the fermentation tank are limited, and the non-brewer's yeast is allocated relatively less nutrients, and the ethanol produced by the metabolic fermentation of brewer's yeast also has a certain inhibitory effect on the growth of non-brewer's yeast GZJ2, so it is difficult to exert its own performance of producing fragrance and esters, so the production of total esters will be reduced. Considering the total ester and alcohol content of the wine body, the inoculation amount of 2% is selected in the present invention for subsequent experiments.

[0130] (3) Ratio of live bacterial counts of G1:GZJ in compound yeast inoculants

[0131] The inoculation amount of the composite yeast agent in passion fruit wine was set to 2%, the live bacteria count ratio of G1:GZJ in the composite yeast agent was 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 2:1, 3:1, 4:1, 5:1, and 6:1, the fermentation temperature was 30℃, and the fermentation days were 6 days. The optimal live bacteria count ratio of G1:GZJ in the composite yeast agent was determined by measuring the changes in total ester and alcohol content of the fruit wine under different live bacteria count ratios of G1:GZJ in the composite yeast agent.

[0132] Depend on Fig.14It can be seen that with the change of the live bacterial cell count ratio of G1:GZJ in the composite yeast agent, the size of the total esters also changes. This is because as the proportion of non-brewers' yeast GZJ increases, its colony count in the passion fruit fermentation broth also increases, making it a dominant bacteria and able to better produce esters and other substances. However, as its proportion increases, it also has a certain impact on the alcohol content of the fruit wine. When the live bacterial cell count ratio of G1:GZJ in the composite yeast agent is 1:5, the alcohol content and total esters of the passion fruit wine reach their maximum values ​​of 9.18%vol and 2.17g / L, respectively. As the proportion of the number of live yeast cells of Saccharomyces cerevisiae G1 increases, the alcohol content of the fruit wine does not change much, but the total ester content tends to decrease. This is also because the growth rate of Saccharomyces cerevisiae G1 itself is greater than that of non-Saccharomyces cerevisiae GZJ2, so the increase in the proportion of the number of live yeast cells of Saccharomyces cerevisiae G1 makes Saccharomyces cerevisiae G1 a dominant strain, and the nutrients in the fermentation tank are certain, so the strain GZJ cannot give full play to its advantages in producing esters and aromas. Considering the total ester and alcohol content of the wine, the present invention selects the case where the ratio of the number of live bacteria of G1:GZJ in the composite yeast agent is 1:5 to continue the subsequent experiments.

[0133] (4) Fermentation temperature

[0134] The inoculation amount of the composite yeast inoculant in passion fruit wine was set to 2%, the ratio of the number of live bacteria of G1:GZJ in the composite yeast inoculant was 1:5, the fermentation temperature was 15-30℃, and the fermentation days were 6 days. The optimal fermentation temperature was determined by measuring the changes in total ester and alcohol content of the wine under different fermentation temperature conditions.

[0135] Depend on Fig.15 It can be seen that the alcohol content increases with the increase of fermentation temperature in the range of 15-27℃. When the fermentation temperature is 15℃, the total ester content is the highest at 3.52g / L, and the alcohol content is 8.06%vol. When the fermentation temperature is higher than 15℃, the alcohol content increases, but the total ester content decreases. When the fermentation temperature is low, the acyltransferase activity of yeast is stronger, which is more conducive to the accumulation of ester substances. However, low temperature slows down the fermentation of yeast, which slows down the rate at which brewer's yeast converts sugar in the fermentation tank into alcohol. When the fermentation temperature is too high, the movement of small molecules in the fermentation tank accelerates, which is not conducive to the retention of aroma substances. And the primary and secondary flavor substances retained by low-temperature fermentation are higher than those fermented at normal temperature. Based on the changes in total esters and alcohol content after fermentation, 18℃ was selected as the optimal fermentation temperature for brewing passion fruit wine.

[0136] (5) Optimal fermentation process

[0137] The optimal conditions for brewing passion fruit wine with the composite yeast agent of the present invention were obtained through the step-by-step method: the inoculation amount of the composite yeast agent was 2%, the ratio of the number of live bacteria of G1:GZJ2 in the composite yeast agent was 1:5, the fermentation temperature was 18°C, and the fermentation days were 6 days.

[0138] Embodiment 5:

[0139] Passion fruit wine was brewed with Angel Yeast RW (purchased from Angel Yeast Co., Ltd.), Saccharomyces cerevisiae G1 and the composite yeast agent of the present invention, and the quality of the obtained wines was compared.

[0140] Among them, the experiments were mainly divided into four groups, namely:

[0141] Commercial group: Angel yeast RW was inoculated to brew passion fruit wine, with an inoculation rate of 3%, a fermentation temperature of 30℃, and a fermentation period of 10 days;

[0142] Group G1: Brewing passion fruit wine with Saccharomyces cerevisiae G1, the inoculation amount was 3%, the fermentation temperature was 30℃, and the fermentation days were 10 days;

[0143] The group before compound optimization: the compound yeast agent was inoculated to brew passion fruit wine, wherein the compound yeast agent inoculation amount was 3%, the ratio of the number of live bacteria of G1:GZJ2 in the compound yeast agent was 1:1, the fermentation temperature was 30℃, and the fermentation days were 10 days;

[0144] The group after compound optimization: passion fruit wine was brewed by inoculating with compound yeast agent, wherein the inoculation amount of compound yeast agent was 2%, the ratio of live bacteria number of G1:GZJ2 in the compound yeast agent was 1:5, the fermentation temperature was 18℃, and the fermentation days were 6 days.

[0145] The passion fruit wine brewed with the above four groups of bacteria or composite bacteria was analyzed in terms of total acid, total ester, alcohol content and sensory evaluation. The scoring criteria for sensory evaluation are shown in Table 2, and the specific scores of each group are shown in Table 3.

[0146] Table 2. Scoring criteria for sensory evaluation of passion fruit wine

[0147]

[0148] Table 3. The scores of sensory evaluation indicators of passion fruit wine brewed in 4 groups

[0149] Sensory evaluation score Business Group G1 Group Compound optimization group After compound optimization Color (20 points) 16 16.1 16.2 16.1 Aroma (30 minutes) 24.2 26.2 27 27.9 Taste (30 points) 17.2 20.5 21.2 24.2 Typicality (20 points) 17.4 18.2 18.8 16.2 Total score 74.8 81 83.2 84.4

[0150] The results of the analysis of total acid, total esters, alcohol content and sensory evaluation of the four groups of passion fruit brewed are as follows:

[0151] like Fig.16As shown, the total acid content of passion fruit wine brewed by G1 group was significantly lower than that of the other three groups, while the difference in total acid content among passion fruit wines brewed by commercial group, group before compound optimization and group after compound optimization was not obvious.

[0152] like Fig.17 As shown, the passion fruit wine brewed by the compound optimization group had a maximum total ester content of 3.49 g / L, which was significantly higher than the total ester content in the passion fruit wines brewed by the other three groups; the high total ester content in the passion fruit wine brewed by the compound optimization group indicated that the content of ester substances in the wine was higher, which could increase the aroma of the wine.

[0153] like Fig.18 As shown, the alcohol content of the passion fruit wine brewed by the compound optimization group was significantly lower than that of the passion fruit wine brewed by the other three groups, but its alcohol content still reached 8.1% vol, ensuring the quality of the wine's alcohol content.

[0154] like Fig.19 The sensory evaluation scores of the passion fruit wines brewed by these four groups were summarized. The results showed that the passion fruit wine brewed by the compound optimization group had the highest sensory evaluation score due to its rich aroma, full body, comfortable and refreshing taste, and no astringency.

[0155] The above embodiments are only used to illustrate the present invention and are not intended to limit the technical solutions described in the present invention; therefore, although the present invention has been described in detail in this specification with reference to the above embodiments, it should be understood by those skilled in the art that the present invention may still be modified or replaced by equivalents; and all technical solutions and improvements thereof that do not depart from the spirit and scope of the present invention should be included in the scope of the claims of the present invention.

Claims

1. A composite yeast agent, It is characterized in that The composite yeast agent comprises saccharomyces cerevisiae and abnormal wickham yeast, wherein the saccharomyces cerevisiae is saccharomyces cerevisiae G1, and its preservation number is CCTCC NO: M2024815; the abnormal wickham yeast is abnormal wickham yeast GZJ2 (Wickerhamomyces anomalus GZJ2), and its preservation number is CCTCC NO: M2023857.

2. The composite yeast agent according to claim 1, It is characterized in that The ratio of the amount of Saccharomyces cerevisiae and the abnormal Wickham's yeast in the composite yeast agent is 1-6:6-1 based on the number of live bacteria; preferably, the ratio of the amount of Saccharomyces cerevisiae and the abnormal Wickham's yeast in the composite yeast agent is 1:5 based on the number of live bacteria.

3. The composite yeast agent according to claim 1, It is characterized in that The cerevisiae yeast G1 is an ester-producing yeast, and the abnormal wickham yeast GZJ2 is an aroma-enhancing yeast.

4. Use of the composite yeast agent according to any one of claims 1 to 3 in fruit wine brewing.

5. The use according to claim 4, It is characterized in that The fruit wine includes passion fruit wine.

6. A method for preparing passion fruit wine, It is characterized in that The method comprises: fermenting passion fruit with the composite yeast agent according to any one of claims 1 to 3 to prepare passion fruit wine.

7. The method according to claim 6, It is characterized in that Wash the passion fruit, cut it open and collect the passion fruit pulp; add appropriate amount of water and enzyme to the passion fruit pulp, stir it evenly and then perform enzymolysis; filter and remove the pulp and seeds in the pulp after enzymolysis; adjust the pH value and sugar content after removing the pulp and seeds; add potassium pyrosulfite, inoculate the composite yeast agent according to any one of claims 1 to 3 for fermentation; filter the fermentation product, centrifuge it, take the supernatant and sterilize it to obtain passion fruit wine.

8. The method according to claim 7, It is characterized in that The volume ratio of the passion fruit pulp to water is 3:1, the dosage ratio of the enzyme to the passion fruit pulp is 0.4 g:200 mL, the enzyme is a mixture of cellulase and pectinase, and the mass ratio of the cellulase to pectinase is 1:

5.

9. The method according to claim 7, It is characterized in that The enzymolysis was carried out in a 40° C. water bath for 2 h, with stirring every 15 min.

10. The method according to claim 8, It is characterized in that The pH value is adjusted with baking soda, and the sugar content is adjusted with white sugar; The amount of potassium pyrosulfite added is such that the sulfur dioxide concentration is 150 mg / L after adding potassium pyrosulfite; The inoculation amount of the composite yeast agent is 1-5%, preferably, the inoculation amount of the composite yeast agent is 2%; the fermentation condition is fermentation at a constant temperature of 15-30°C for 5-10 days, preferably, the fermentation condition is fermentation at a constant temperature of 18°C ​​for 6 days.

Images