Wild brevibacillus laterosporus competent cell and application thereof in plasmid transformation

Abstract

The invention discloses a wild brevibacillus laterosporus competent cell, two layers of cell wall proteins outside cell walls at two ends of the competent cell are completely removed, more than 40% of cell wall proteins in the middle are removed, and the competent cell is high in transformation efficiency and easy to resuscitate, and can be used for rapid transformation of wild brevibacillus laterosporus. The invention provides the preparation method of the wild brevibacillus laterosporus competent cells, which can elute and weaken two layers of cell wall proteins outside the cells of the brevibacillus laterosporus to obtain the brevibacillus laterosporus competent cells. The invention further provides an electroporation genetic transformation method based on the brevibacillus laterosporus competent cells, transformation of wild brevibacillus laterosporus by exogenous plasmids can be effectively achieved, the method is easy and convenient to operate, short in period and good in transformation effect, the problem that genetic manipulation of industrial production strains is difficult is solved, and the method is suitable for industrial production of brevibacillus laterosporus competent cells. And a foundation is laid for more efficient directional genetic modification of brevibacillus laterosporus industrial strains.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic transformation, and particularly relates to a genetic transformation method of wild-type Brevibacillus laterosporus. Background Art

[0002] Brevibacillus laterosporus ( Brevibacillus laterosporus ) is a Gram-positive, spore-forming bacterium that is widely found in soil and water around the world. It can produce antimicrobial peptides (AMPs), pesticides, enzymes, antibacterial agents and antifungal agents, and is considered an effective probiotic. It has potential application prospects in animal breeding as an alternative to antibiotics. However, B. laterosporus The practical application of antimicrobial peptides faces some challenges, such as limited productivity, lack of efficient strains, and restrictions on industrial scalability. Genome modification using antimicrobial peptide-producing chassis strains has the advantages of maintaining the stability of engineered bacteria and increasing production, but the difficulty of gene editing research in wild-type microorganisms lies in the genetic manipulation of cells. Therefore, the establishment of a good genetic transformation system is the most critical part of the gene editing workflow.

[0003] Currently, the transformation methods commonly used for Bacillus include protoplast transformation and traditional electroporation transformation. However, these two traditional transformation methods cannot achieve artificial transformation of wild-type Bacillus laterosporus under laboratory conditions. Summary of the invention

[0004] The purpose of the present invention is to provide a wild-type Brevibacillus laterosporus competent cell with good performance and a method for transforming wild-type Brevibacillus laterosporus, which has simple operation, short cycle, high transformation efficiency and high yield of transformed strains. In order to achieve the above purpose, the present invention adopts the following technical scheme: The present invention provides a competent cell of wild-type Brevibacillus laterosporus, wherein the outer two layers of cell wall proteins at both ends of the cell wall are completely removed, and the outer two layers of cell wall proteins between the two ends are removed by more than 40%. The outer two layers of cell wall proteins of the cell wall are the outermost outer wall protein (OW) and the middle middle wall protein (MW).

[0005] The present invention provides a method for preparing the above-mentioned wild-type Brevibacillus laterosporus competent cells, comprising the following steps: Step 1: Take 8% of the overnight cultured wild-type Bacillus laterosporus and culture it in fresh NB liquid medium with shaking for about 5 hours until the OD 600 About 0.85-0.95; Step 2: Wash with an equal volume of 50 mmol / L Tris-HCl (pH = 7.5) and centrifuge at 6000 rpm at 24°C to precipitate.

[0006] Step 3: Collect the cells by centrifugation at 24°C and 6000 rpm for 5 min, and culture them in 50 mmol / L Tris-HCl (pH=8.5) solution at 33°C and 150 rpm for 30-60 min.

[0007] Step 4, the culture solution was placed on ice for 10 minutes, centrifuged and washed twice with sterile water, and then washed once with Hepes-PEG, all at 4°C and 6000 rpm; Step 5: Resuspend with 1 / 100 volume of Hepes-PEG, dispense 100 μl into each tube, and prepare freshly for use.

[0008] Furthermore, the Hepes-PEG electroporation buffer is 1 mM Hepes containing 15% PEG 6000.

[0009] The present invention also provides the use of the wild-type Brevibacillus laterosporus competent cells in plasmid transformation.

[0010] The present invention also provides a method for plasmid transformation, comprising the following steps: Step 1, mix 500 ng of the plasmid to be transformed with 100 μl of the above-mentioned wild-type Brevibacillus laterosporus competent cells, place the mixture on ice for 2 minutes, transfer the mixture to an electric shock cup, and place the mixture on ice for another 2 minutes; Step 2, setting the voltage value of the electroporator to 1500V, the pulse time to about 5.0ms, and performing electric shock; Step 3, quickly add 1 mL of room temperature MN resuscitation solution, slowly blow and evenly mix with a pipette, then transfer to a 5 mL sterile EP tube and resuscitate at 33°C and 220 rpm for 3 hours; Step 4: Centrifuge at 8000 rpm for 2 min at room temperature, discard the supernatant, resuspend the bacteria in the remaining 150 μl, spread on a resistant plate, and culture inverted at 33°C for 48-72 hours until a single colony of Brevibacillus laterosporus grows.

[0011] Furthermore, the above-mentioned electroporator is an Eppendorf Eporator®, the resistance of the electroporation may be specifically 200Ω, the capacitance may be specifically 25μF, the electrode spacing of the electroporation cup is 0.1 cm, and the electroporation pulse time is about 5ms.

[0012] Furthermore, the MN resuscitation solution is a MN resuscitation solution containing 20 mM Mg 2+ NB liquid culture medium, Furthermore, Mg 2+ It is added to NB liquid culture medium in the form of MgC12 and is injected into the NB liquid culture medium with a 0.22 μm needle. Filter sterilize.

[0013] Furthermore, any of the above NB liquid culture media is prepared by thoroughly mixing 10.0 g of tryptone, 3.0 g of yeast extract, 5.0 g of sodium chloride, and double distilled water, and then diluting the mixture to 1 L with double distilled water, and sterilizing the mixture by high pressure steam sterilization at 121° C. for 20 min; the agar powder concentration of the solid culture medium is 2%.

[0014] Furthermore, the plasmid to be transformed is modified by cytosine methyltransferase.

[0015] Furthermore, the cytosine methyltransferase gene sequence of the above plasmid is shown in SEQ No 1.

[0016] Furthermore, the plasmid is a shuttle vector pBL5, which is extracted from the gene-edited MC1061-09365 strain, which can express Bacillus laterosporus cytosine methyltransferase. pBL5 is Amp-resistant (100 μg / ml) in Escherichia coli and Erm-resistant (2.5 μg / ml) in wild-type Bacillus laterosporus.

[0017] The beneficial effects of the present invention are as follows: The invention provides a wild-type Brevibacillus laterosporus competent cell, in which the outer two layers of cell wall proteins at both ends of the cell wall are completely eluted, and the middle cell wall protein is eluted by more than 40%. By partially eluting the OW and MW layers, the partial integrity of the cell is ensured when the cell has sufficient permeability, and the competent cell can be used for rapid transformation of the wild-type Brevibacillus laterosporus.

[0018] The invention provides a method for preparing wild-type Brevibacillus laterosporus competent cells, which can elute and weaken the outer two-layer cell wall proteins of Brevibacillus laterosporus in the logarithmic growth phase, so as to prepare competent cells with high transformation efficiency and easy recovery. In particular, culturing cells in the logarithmic growth phase in a preferred appropriate buffer is beneficial to the entire preparation process.

[0019] The invention provides a new method for rapid transformation of wild-type Brevibacillus laterosporus. An electrotransformation method is performed on the basis of using competent cells of the wild-type Brevibacillus laterosporus as thin-walled cells. The method has the advantages of simple operation, short cycle, high transformation efficiency and high transformation strain yield. The method is helpful to solve the problem of difficult genetic manipulation of industrial production strains and lays a foundation for more efficient directional genetic transformation of industrial strains of Brevibacillus laterosporus. The application of the invention in the transformation of wild-type Brevibacillus laterosporus has broad prospects.

[0020] The present invention has been studied and analyzed: B. laterosporus It has four methyltransferases that can prevent the invasion of foreign DNA, but the plasmid modified by one of the methyltransferases can replicate normally in the bacteria. Through electron microscopy, it was found that B. laterosporusThere are multiple S layers, including the outermost outer wall protein (OW) and the middle middle wall protein (MW) layer and the peptidoglycan layer covering the plasma membrane. The presence of multiple S layers is an important reason for limiting the successful transformation of plasmids. The present invention achieves partial elution of the outer two layers of protein of the cell wall of wild-type Bacillus laterosporus and retains the peptidoglycan layer, thereby obtaining competent cells with good stability, high transformation efficiency and good recovery efficiency. The exogenous shuttle vector pBL5 can be transformed into wild-type Bacillus laterosporus by electroporation genetic transformation, laying a foundation for more efficient directed genetic transformation of industrial strains of Bacillus laterosporus.

[0021] The present invention is further described in detail below with reference to the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Schematic diagram of the structure of the shuttle vector pBL5.

[0023] Figure 2 The cell wall changes before and after Tris-HCl treatment in Example 1 (the red line represents intact cell wall).

[0024] Figure 3 The results are for single colonies grown by the electroporation transformation method in Example 2.

[0025] Figure 4 A plate streaked with a single colony after electrotransformation in Example 2.

[0026] Figure 5 This is the gel electrophoresis diagram of the bacterial liquid PCR in Example 3.

[0027] Figure 6 This is the NCBI alignment result of 16S rRNA sequencing in Example 3.

[0028] Figure 7 This is the result of BglII restriction enzyme digestion identification in Example 3. DETAILED DESCRIPTION

[0029] The following experimental examples are further illustrative of the present invention and are not intended to limit the present invention. Specific experimental conditions and methods are not specified in the following examples. The experimental methods that do not specify specific conditions in the following examples are selected according to conventional methods and conditions or according to the product specifications. "h" in this patent represents hours, and "min" represents minutes.

[0030] In the present invention, the various materials and reagents described are commonly used in the art and can be obtained through conventional commercial channels.

[0031] NB liquid culture medium: 10.0 g tryptone, 3.0 g yeast extract, 5.0 g sodium chloride, and double distilled water are thoroughly mixed and the volume is adjusted to 1 L with double distilled water, and sterilized by high-pressure steam at 121°C for 20 min; the agar powder concentration of the solid culture medium is 2%.

[0032] LB liquid culture medium: 10.0 g peptone, 5.0 g yeast extract, 10.0 g sodium chloride and double distilled water were thoroughly mixed and the volume was adjusted to 1 L with double distilled water, and sterilized at 121°C for 20 min; the agar powder concentration of the solid culture medium was 1.5%.

[0033] MN resuscitation solution: 0.2 ml MgCl2 (1 mol / L) was added to 10 ml NB liquid medium and sterilized by filtration with a 0.22 μm syringe filter.

[0034] Hepes-PEG: 15 g PEG6000 was added to 1 mmol / L Hepes solution and sterilized by high pressure steam at 121°C for 15 min.

[0035] Erythromycin: Erm; Ampicillin: Amp.

[0036] Wild-type Brevibacillus laterosporus Brevibacillus laterosporus M811, the bacteria is deposited in the China Center for Type Culture Collection, the preservation number is CCTCC NO: M2024715, the preservation date is April 18, 2024, the address of the preservation unit is Wuhan, China, and the test results of the preservation center show that it is alive. It was isolated and preserved by the Antimicrobial Peptide Laboratory of the Institute of Nutrition and Feed, Chongqing Academy of Animal Husbandry Sciences, and the public can obtain it from Chongqing Academy of Animal Husbandry Sciences.

[0037] Shuttle vector pBL5 (see Figure 1 ), which is available to the public from Chongqing Academy of Animal Science.

[0038] Mutant MC1061-09365 Escherichia coli, which can express wild-type Brevibacillus laterosporus cytosine methyltransferase, is publicly available from Chongqing Academy of Animal Science.

[0039] Example 1 Preparation of wild-type Brevibacillus laterosporus competent cells 1. Take out the wild-type Brevibacillus laterosporus 811 stored in a -80℃ refrigerator ( Brevibacillus laterosporus ) (Certification No.: M2024715), and activated by streaking on NB solid medium for 48 h.

[0040] 2. Pick up a single colony after activation with a sterilized toothpick, inoculate it into 5 mL of NB, and culture it at 33°C and 220 rpm for 16 h.

[0041] 3. Take 3 mL of the above bacterial solution and inoculate it into 30 mL of NB (8%), and culture it at 33°C and 220 rpm for ~5 h (OD 600 =0.85-0.95).

[0042] 4. Collect the cells by centrifugation at 24°C and 600 rpm for 5 min, wash the cell pellet with 30 mL of 50 mmol / L Tris-HCl (pH 7.5), resuspend in 15 mL of 50 mmol / L and 100 mmol / L Tris-HCl (pH 8.5) solution, and culture at 33°C, 80 rpm and 150 rpm for 30-60 min. 5. Place on ice for 10 minutes.

[0043] 6. Collect the bacteria by centrifugation at 4°C and 6000 rpm for 5 min, wash the precipitate twice with 30 mL of sterile water, and collect the bacteria by centrifugation at 4°C and 6000 rpm for 5 min.

[0044] 7. Wash once with 15 ml of Hepes-PEG buffer, collect the cells by centrifugation at 4°C and 6000 rpm for 5 min, and wash twice with sterile water.

[0045] 8. Resuspend with 300 μl Hepes-PEG buffer and dispense into 100 μl per tube to obtain wild-type Brevibacillus laterosporus competent cells.

[0046] 9. The structures of wild-type Brevibacillus laterosporus and competent cells of wild-type Brevibacillus laterosporus under electron microscope are as follows: Figure 2 As shown (Figure Ⅰ represents a complete cell; Figure Ⅱ red represents a complete cell wall; Ⅲ is a magnification), Figure 2 a is a normal competent cell without Tris-HCl. After incubation with 50mmol / L Tris-HCl (pH 8.5) on a shaker at 150rpm (competent state 1), the outer wall protein and middle wall protein of the wild-type Bacillus laterosporus cell wall are intact and clearly layered. The outer wall protein and middle wall protein at both ends of the blunt circle of the wild-type Bacillus laterosporus competent cell are eluted, and the outer wall protein and middle wall protein in the middle are eluted by more than 40%, showing loose arrangement and fusion ( Figure 2 b). Note: The wild-type Bacillus laterosporus has blunt ends, while the middle part is cylindrical with evenly straight edges. The perimeter of a competent cell in a logarithmic growth phase is approximately 7.111μm, and the sum of the perimeters at both ends is 3.133μm, accounting for 42.85% of the entire cell perimeter. The data was calculated using Image J.

[0047] 10. The combination of different concentrations of Tris-HCI treatment and different speed recovery has a great influence on the removal of cell wall proteins in competent cells: After incubation with 50mmol / L Tris-HCI (pH 8.5) on a shaker at 80rpm (competent cell No. 2), the removal of cell wall proteins was not obvious ( Figure 2 c). After incubation with 100 mmol / L Tris-HCl (pH 8.5) on a shaker at 150 rpm (competent condition 3), the cell wall proteins were excessively removed ( Figure 2 d).

[0048] Example 2 Electroporation transformation of wild-type Brevibacillus laterosporus plasmid 1. Pretreatment of the electric cup: Soak the 1mm electric cup in anhydrous ethanol overnight, wash and dry it, irradiate it with ultraviolet light on the clean bench for 30 minutes, cover it with a lid and place it in an ice bath for 20 minutes; 2. Add 500 ng of plasmid pBL5 to the three competent cells obtained in Example 1, mix slowly and place on ice for 2 min, transfer to a 1 mm electroporation cuvette sterilized and ice-bathed in advance, and incubate on ice for 2 min.

[0049] 3. Perform electric shock on the electroporator, set the corresponding voltage value to 1500V, and the pulse time to about 5.0ms.

[0050] 4. After electric shock, quickly add 1 mL of room temperature MN resuscitation solution, slowly blow and evenly distribute it with a pipette, transfer it to a 5 mL sterilized EP tube, and resuscitate it on a shaker at 33°C and 220 rpm for 3 hours.

[0051] 5. After incubation, centrifuge at 8000rpm for 2min at room temperature. Finally, discard the supernatant and resuspend the bacteria in 150μl. Spread it on a solid NB plate containing Erm (2.5μg / ml). Incubate it upside down at 33℃ for 48-72 hours to grow a single colony of Brevibacillus laterosporus ( Figure 3 ). Competent cell No. 1 (incubated with 50mmol / L Tris-HCl (pH 8.5) on a shaker at 150rpm) grew a single colony ( Figure 3 a), No single colony grew out of competent cell 2 (two single colonies were false positives) ( Figure 3 b); Due to the excessive removal of the outer layer protein, the competent cells of No. 3 failed to regenerate the complete cell wall structure in time after subsequent electroporation, resulting in death and no single colony growth ( Figure 3 c).

[0052] Example 3 The electroporation transformation effect of wild-type Brevibacillus laterosporus was verified, and the specific steps were as follows: 1. Randomly pick a single colony from Example 2 that has a growth morphology similar to that of wild-type Bacillus laterosporus 811 and streak it on an NB Erm resistance plate ( Figure 4 ), a total of 10 pure culture strains were obtained.

[0053] 2. The next day, single colonies were selected for PCR identification. Wild-type Bacillus laterosporus 811 is a Gram-positive bacterium. It needs to be placed in a boiling water bath for 15 minutes before colony PCR. PCR identification mainly uses 16S universal primers (27F: AGAGTTTGATCCTGGCTCAG; 1492R: TACGGCTACCTTGTTACGACTT), erythromycin (Ermerythromycin) primers (Erm-F: GAAATCGGCTCAGGAAAAGGC; Erm-R: AATCGTCAATTCCTGCATGTTT) and TraJ (PlasmidRP4 relaxosome protein) primers (traJ-F: GCCTTCCAGACGAACGAAGAtraJ-R: TAGTGCTTTACGGCACCTCG). If the gel band of Erm's PCR product is 525bp, the gel band of TraJ's PCR product is 229bp, and the blast review result of 811's 16s rDNA sequencing result on NCBI is Brevibacillus laterosporus , indicating that the electroporation transformation of Brevibacillus laterosporus was successful. One of the 16S rDNA of 811 is shown in SEQ No. 2 of the sequence table.

[0054] 3. The 10 strains obtained in Example 1 were all recombinant strains that successfully introduced the shuttle vector pBL5 into wild-type Brevibacillus laterosporus 811, and the colony PCR of TraJ and Erm were both positive ( Figure 5 ), NCBI review results are Brevibacillus laterosporus ( Figure 6 ), therefore, the transformation positive efficiency is 100%.

[0055] Example 4 Plasmid identification after transformation of wild-type Brevibacillus laterosporus 811, the specific steps are as follows: 1. Use a sterilized toothpick to randomly select a single colony of a positive clone successfully verified in Example 2, inoculate it into 5 mL of Erm's NB liquid culture medium, and culture it at 33° C. and 220 rpm for 16 h.

[0056] 2. Use a plasmid extraction kit (TIANGEN, catalog number: DP103) to extract the pBL5 plasmid in 811 cells.

[0057] 3. Use the heat shock transformation method to transform the plasmid (500 ng) extracted from 811 into MC1061-09365 competent cells and spread them on antibiotic LB plates containing Amp.

[0058] 4. After about 16-18 hours, single colonies will grow on the LB plate. Randomly select 3 single colonies and inoculate them into 5 mL of LB liquid medium containing Amp. Incubate the culture overnight at 33°C and 220 rpm with shaking.

[0059] 5. The next day, the plasmid of MC1061-09365 was extracted using a plasmid extraction kit and the quality was tested using NanoDrop 2000 (Thermo Fisher Scientific).

[0060] 6. Take 500 ng of plasmid and perform BglII double enzyme digestion identification. The results of enzyme digestion identification are as follows: two specific bands of 1282 bp and 5216 bp were obtained ( Figure 7 ), confirming that the plasmid was the original shuttle plasmid pBL5 before transformation of 811.

[0061] In summary, the competent cell preparation method of the present invention completely elutes the outer two layers of protein of the cell wall at both ends of the wild-type Bacillus laterosporus and elutes more than 40% of the outer two layers of cell wall protein between the two ends, thereby obtaining a competent cell with good stability, high transformation efficiency and good recovery efficiency. The exogenous shuttle vector pBL5 is transformed into the wild-type Bacillus laterosporus by the electroporation genetic transformation method, laying a foundation for more efficient directed genetic transformation of the industrial strain of Bacillus laterosporus. The method is simple to operate, short in cycle, and good in transformation effect, which helps to solve the problem of difficult genetic operation of industrial production strains.

Claims

1. A wild-type Brevibacillus laterosporus competent cell, characterized in that: The outer two layers of cell wall proteins at both ends of the competent cells are completely removed, and the outer two layers of cell wall proteins between the two ends are removed by more than 40%.

2. The method for preparing wild-type Brevibacillus laterosporus competent cells according to claim 1, comprising the following steps: Step 1: Wild-type Brevibacillus laterosporus was cultured in NB medium with shaking until OD 600 =0.85-0.95; Step 2: Collect the cells by centrifugation at 24°C and 6000 rpm for 5 min, resuspend and wash the cells with 50 mmol / L Tris-HCl (pH=7.5), and centrifuge at 24°C and 6000 rpm; Step 3, add 50mmol / L Tris-HCl (pH=8.5) solution and culture at 33℃, 150rpm for 30-60 minutes; Step 4, place the culture solution on ice for 10 minutes; collect the cells by centrifugation at 6000 rpm at 4°C, wash twice with sterile water, then wash once with Hepes-PEG buffer, and centrifuge; Step 5, resuspend with 1 / 100 volume of Hepes-PEG buffer to obtain wild-type Brevibacillus laterosporus competent cells, and use them immediately after aliquoting.

3. The method according to claim 2, characterized in that: The Hepes-PEG buffer was 1 mM Hepes containing 15% PEG6000.

4. Use of the wild-type Brevibacillus laterosporus competent cells in plasmid transformation as claimed in claim 1.

5. A method for plasmid transformation, comprising the following steps: Step 1, mix 500 ng of the plasmid to be transformed with 100 μl of the competent cells described in claim 1, place in an ice bath for 2 minutes, transfer to an electric shock cup, and place in an ice bath for another 2 minutes; Step 2, setting the voltage value of the electroporator to 1500V, the pulse time to about 5.0ms, and performing electric shock; Step 3, quickly add 1 mL of room temperature MN resuscitation solution, slowly blow and evenly mix with a pipette, then transfer to a 5 mL sterile EP tube and resuscitate at 33°C and 220 rpm for 3 hours; Step 4, centrifuge at 8000 rpm for 2 min at room temperature, discard the remaining 150 μl of the supernatant, resuspend the bacteria, spread on a resistant plate, and culture upside down at 33°C for 48-72 hours until a single colony of Brevibacillus laterosporus grows.

6. The method according to claim 5, characterized in that: In the step 1, the plasmid to be transformed is modified by cytosine methyltransferase expressed by Escherichia coli.

7. The method according to claim 6, characterized in that: The cytosine methyltransferase gene sequence is shown in SEQ No.

1.

8. The method according to claim 7, characterized in that: The plasmid is a shuttle vector pBL5, which is Amp-resistant (100 μg / ml) in E. coli and Erm-resistant (2.5 μg / ml) in wild-type B. laterosporus.

9. The method according to claim 8, characterized in that: The pBL5 plasmid is extracted from the gene-edited MC1061-09365 strain, which can express Brevibacillus laterosporus cytosine methyltransferase.

10. The method according to claims 5 to 9, characterized in that: The MN resuscitation solution is NB liquid culture medium containing 20 mM MgCl2.

Images