Lactobacillus rhamnosus helpful for maintaining healthy level of blood fat and application of lactobacillus rhamnosus

Abstract

The invention belongs to the technical field of lactic acid bacteria, and particularly relates to preparation and application of lactobacillus rhamnosus. The lactobacillus rhamnosus is preserved in China General Microbiological Culture Collection Center (CGMCC) on August 27, 2024, the preservation address is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the preservation number is CGMCC No.31767, and the lactobacillus rhamnosus is classified and named as lactobacillus rhamnosus. The lactobacillus rhamnosus prepared by the preparation method disclosed by the invention has the efficacy of being beneficial to maintaining the health level of blood fat.

Description

Technical Field

[0001] The invention belongs to the technical field of lactic acid bacteria, and particularly relates to the preparation and application of Lactobacillus rhamnosus. Background Art

[0002] Lactobacillus rhamnosus is a lactic acid bacterium commonly used in food production. Lactobacillus rhamnosus is mostly found in the intestines of humans and animals. It belongs to the rhamnosus subspecies of the genus Lactobacillus in bacterial taxonomy. It is an anaerobic, acid-resistant, non-spore-forming Gram-positive lactic acid bacterium. Lactobacillus rhamnosus is a lactic acid bacterium with a wide range of effects, and plays a positive role in maintaining intestinal health and enhancing immunity.

[0003] It helps maintain healthy blood lipid (cholesterol / triglyceride) levels. The effect is popularly known as lowering blood lipids. The blood lipid-lowering effect of Lactobacillus rhamnosus has attracted much attention in recent years. Existing research results show that Lactobacillus rhamnosus has a blood lipid-lowering effect, and its theoretical basis is mainly concentrated in the following aspects. Lactobacillus rhamnosus can directly bind to cholesterol, making it impossible to absorb, thereby lowering the cholesterol level in the blood; Lactobacillus rhamnosus can convert cholesterol in the intestine into bile salts, which are not easily absorbed and are excreted from the body with feces; Lactobacillus rhamnosus can inhibit bacteria that produce harmful substances in the intestine, thereby reducing the damage of harmful substances to the liver and helping to lower blood lipids; Lactobacillus rhamnosus can promote the growth of beneficial bacteria that produce short-chain fatty acids, which have the function of regulating lipid metabolism; Lactobacillus rhamnosus can regulate the levels of low-density lipoprotein (LDL) and high-density lipoprotein (HDL) by affecting the expression of liver lipoprotein receptors; Lactobacillus rhamnosus can reduce the synthesis of fat in the body by inhibiting the activity of fatty acid synthase; Lactobacillus rhamnosus can enhance the intestinal barrier function, reduce intestinal permeability, and reduce the absorption of harmful substances such as endotoxins, thereby alleviating liver inflammation and helping to lower blood lipids; Lactobacillus rhamnosus can inhibit intestinal inflammatory reactions and reduce the production of inflammatory factors (such as TNF-α), thereby improving lipid metabolism. Lactobacillus rhamnosus exerts its lipid-lowering effect through multiple mechanisms, including direct binding to cholesterol, regulating intestinal flora, affecting lipoprotein metabolism, improving intestinal barrier function and regulating inflammatory response, etc. However, its specific mechanism of action has not yet been fully elucidated by existing research. Currently, the factors that are known to affect the lipid-lowering effect of Lactobacillus rhamnosus include the type of Lactobacillus rhamnosus strain, the daily intake of Lactobacillus rhamnosus, the use period of Lactobacillus rhamnosus and the individual differences between users. Different strains of Lactobacillus rhamnosus also have different effects. Only through rigorous and meticulous breeding research can a Lactobacillus rhamnosus strain from nature have the effect of helping to maintain healthy levels of blood lipids (cholesterol / triglycerides). Summary of the invention

[0004] The purpose of the present invention is to provide a preparation method and application of Lactobacillus rhamnosus which is helpful to maintain healthy blood lipid level.

[0005] A rhamnosus lactobacillus, wherein the rhamnosus lactobacillus LR-R50 has been deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on August 27, 2024, with the deposit address being No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number being CGMCC No. 31767.

[0006] Furthermore, the dry bacterial powder of Lactobacillus rhamnosus LR-R50 strain was identified by the Institute of Microbiology, Chinese Academy of Sciences; The test items include cell morphology and physical and chemical tests, molecular biology identification (16S rRNA gene sequence determination and pheS gene sequence determination), antibiotic sensitivity test, and strain stability evaluation.

[0007] The experimental results showed that the 16S rRNA gene sequence and pheS gene sequence of the F1 generation and the F5 generation were the same. The Lactobacillus rhamnosus LR-R50 strain was stable in succession. Figure 1 .

[0008] The results of the detection and identification of the Lactobacillus rhamnosus LR-R50 strain of the present invention by the Institute of Microbiology, Chinese Academy of Sciences are as follows: Under the conditions of this laboratory, based on a comprehensive analysis of experimental data such as cell morphology, physiological and biochemical experiments, 16S rRNA gene and pheS gene sequences of the tested strains, and with reference to the Bergey's Manual of Systematic Bacteriology, the identification result of the strain (strain number: LR-R50) submitted by Jiangsu Dexi Biotechnology Co., Ltd. was: Lacticaseibacillusrhamnosus.

[0009] The conclusion of the strain stability evaluation of the Lactobacillus rhamnosus LR-R50 strain of the present invention by the Institute of Microbiology, Chinese Academy of Sciences is as follows: After five consecutive generations of subculture, comparative experiments were conducted, and no visible changes were found in the morphological characteristics, physical and chemical characteristics, classification and identification shapes, and antibiotic sensitivity of the tested strains, indicating that the characteristics of the tested strains can be stably inherited.

[0010] A method for preparing a working strain of Lactobacillus rhamnosus, comprising the following steps: (1) Take a sample of the Lactobacillus rhamnosus LR-R50 strain, add it to the liquid activation culture medium, and culture it in an anaerobic chamber at 37°C for 8-10 hours. (2) Take the activated bacterial solution and inoculate it into the slant of the eggplant bottle. Inoculate 180μL of bacterial solution into each slant of the eggplant bottle and culture it in an anaerobic chamber at 37°C for 12-16 hours. (3) Use 20ml of protective agent to scrape off the bacterial moss on the slant culture medium of the eggplant bottle, mix it evenly, and divide it into sterile screw-cap cryopreservation tubes and store it at -80°C to obtain the working strain of Lactobacillus rhamnosus LR-R50.

[0011] Furthermore, the liquid activation culture medium formula comprises peptone, yeast powder, glucose (monohydrate), sodium chloride, anhydrous sodium acetate, purified water, and the pH is adjusted to 6.5. After packaging, it is sterilized at 121°C for 20 minutes. The eggplant bottle slant culture medium formula comprises peptone, yeast powder, glucose (monohydrate), sodium chloride, anhydrous sodium acetate, purified water, and agar strips. The pH is adjusted to 6.5. After packaging, it is sterilized at 121°C for 20 minutes. The protective agent formula comprises skim milk powder, yeast powder, and purified water. The pH is adjusted to 6.5. After packaging, it is sterilized at 115°C for 20 minutes.

[0012] A method for preparing the Lactobacillus rhamnosus freeze-dried powder is prepared by the following steps: A Lactobacillus rhamnosus fermentation method comprising: The Lactobacillus rhamnosus strain was inoculated on the eggplant bottle solid culture medium for activation; Transplanting the activated bacterial strain into a primary liquid culture medium for expansion; Transplanting the expanded primary bacterial strain into a secondary liquid culture medium for fermentation; The fermented secondary bacterial strain is transplanted into the tertiary liquid culture medium for fermentation, and the fermentation liquid is filtered to obtain the rhamnosus lactobacillus slurry; The activated solid culture medium uses the MRS formula.

[0013] The formula of the primary liquid culture medium is 9-12 g / L yeast powder, 4-6 g / L glucose monohydrate, 4-6 g / L peptone, 2-3 g / L sodium chloride, and 2-4 g / L anhydrous sodium acetate. The pH is adjusted to 6.5.

[0014] The formula of the secondary liquid culture medium is 18-22 g / L yeast powder, 22-26 g / L glucose monohydrate, 18-22 g / L peptone, 3-4 g / L anhydrous sodium acetate, and 3-5 g / L xylooligosaccharide. The pH is adjusted to 6.0.

[0015] The formula of the three-stage liquid culture medium is 18-22 g / L yeast powder, 16-20 g / L glucose monohydrate, 16-20 g / L peptone, 3-4 g / L anhydrous sodium acetate, and 4-6 g / L xylooligosaccharide. The pH is adjusted to 6.0.

[0016] During the fermentation process, the secondary and tertiary liquid culture media are supplemented with 3M sodium hydroxide solution. The pH of the secondary liquid culture media is 5-6; the pH of the tertiary liquid culture media varies in the range of 5-6.

[0017] In a specific possible implementation scheme, it includes: S1. Take Lactobacillus rhamnosus LR-R50 and inoculate it on solid culture medium at a volume ratio of 1:(8-10), and then activate it in an anaerobic environment at 37°C for 24 hours; S2, the activated bacteria were placed at 60cm 2 The solid culture medium is inoculated with (200-300) mL of liquid culture medium in the first-level liquid culture medium, and then placed in an oxygen-free environment at 37°C for 12 hours; S3, transplanting the expanded bacterial strain into the secondary liquid culture medium at an inoculation rate of (2-3) vol%, and then fermenting it in an anaerobic environment at 37°C for 8-10 hours; during the fermentation process, nitrogen is introduced into the fermentation tank, and 3M sodium hydroxide is added to the secondary liquid culture medium to control the pH of the secondary liquid culture medium at 5-6; when the fermentation time is greater than 8 hours, sampling the fermentation liquid and detecting OD600, when OD600 is greater than 1.2, it can be judged that the secondary fermentation is completed; S4. The fermented secondary strains are transplanted into the tertiary liquid culture medium at an inoculation rate of (4-5) vol%, and then fermented in an oxygen-free environment at 37°C for 8-10 hours. During the fermentation process, nitrogen is introduced into the fermentation tank, and 3M sodium hydroxide is added to the tertiary liquid culture medium to control the pH of the tertiary liquid culture medium at 5-6. When the fermentation time is greater than 8 hours, the fermentation liquid is sampled and the OD600 is tested. When the OD600 is greater than 1.7, samples are taken at intervals of 10 minutes. When the OD600 no longer increases significantly, the tertiary fermentation is considered complete. The fermentation liquid is sampled to test the number of viable bacteria.

[0018] By adopting the above technical scheme, the fermentation and cultivation process of Lactobacillus rhamnosus is optimized, which is conducive to obtaining an ideal fermentation and cultivation effect of Lactobacillus rhamnosus.

[0019] In a specific embodiment, in S3, the secondary liquid culture medium is stirred at a speed of 60-100 rpm during fermentation; in S4, the tertiary liquid culture medium is stirred at a speed of 60-100 rpm during fermentation.

[0020] A method for centrifuging and freeze-drying Lactobacillus rhamnosus, comprising: S5, bacterial cell collection: centrifuging the Lactobacillus rhamnosus fermentation broth, discarding the supernatant, and obtaining Lactobacillus rhamnosus bacterial slurry; S6. Vacuum freeze drying and protective agent preparation Vacuum freeze drying: the rhamnosus Lactobacillus casei bacterial slurry is mixed with a protective agent to obtain an emulsion; the emulsion is subjected to vacuum freeze drying until the moisture content of the bacterial powder is less than 5%, the freeze-dried bacterial powder is crushed with a 60-mesh sieve, and stored after vacuum packaging.

[0021] Preparation of protective agent: The protective agent is prepared and sterilized from the following raw materials in parts by weight: 5-6 parts of maltodextrin, 2-3 parts of trehalose, 2-3 parts of resistant dextrin and 0.5-1 part of sodium D ascorbate, and the balance is purified water.

[0022] By adopting the above technical solution and adding a protective agent during vacuum freeze drying, the bacterial strains can be protected from low temperature damage, thereby further enhancing the survival rate of the bacterial strains.

[0023] In a specific embodiment, the mass ratio of the Lactobacillus rhamnosus slurry to the protective agent is 1:(1-1.5).

[0024] By adopting the above technical solution, the mass ratio of Lactobacillus rhamnosus mud to the protective agent is optimized, which is beneficial to enhancing the survival rate of Lactobacillus rhamnosus after freeze-drying.

[0025] The Lactobacillus rhamnosus LR-R50 of the present invention has the effect of helping to maintain a healthy blood lipid level. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a comparison chart of the pheS gene sequences of the F1 and F5 generations.

[0027] Figure 2 Cell morphology and physicochemical test results.

[0028] Figure 3 These are the results of the acid and bile salt resistance tests.

[0029] Figure 4 is the body weight of rats during the experimental period.

[0030] Figure 5 These are the test results of TC, TG, LDL-C, and HDL-C in rats' blood lipids in the fourth week of the experiment. DETAILED DESCRIPTION

[0031] The present invention will be further described by the following embodiments and test examples. Example 1

[0032] A kind of Lactobacillus rhamnosus LR-R50 strain isolation and identification: Strain collection: The samples were collected from feces of healthy adults in Suzhou, Jiangsu Province, who had no history of taking lactic acid bacteria in the past six months. The samples were diluted with sterile physiological saline to different concentration gradients; the above samples were spread on MRS plate culture medium using a spreader and cultured at 37°C anaerobic conditions for 48 hours; single colonies were selected on the culture medium; microscopic examination confirmed that they had the morphology of Lactobacillus rhamnosus; the selected single colonies were inoculated on MRS plate culture medium using the streak method, cultured at 37°C anaerobic conditions for 48 hours, single colonies were picked, the operation was repeated 5 times for purification, and then stored in glycerol tubes at -80°C.

[0033] Bacterial species identification: The Lactobacillus rhamnosus LR-R50 strain was detected and identified by the Institute of Microbiology, Chinese Academy of Sciences.

[0034] Cell morphology and physicochemical experimental results are shown in Figure 2 .

[0035] Molecular biological identification results: 16S rRNA gene sequence is as follows: The pheS gene sequence is as follows: CCGCACGTAAACATTCGGATGCACCATGCCGGCACCGAGAACTTCAATCCAGCCGGTATACTTGCAAACAGGGCAGCCCTTGCCACCGCAGCGGAAGCAGGAAACGTCCACTTCTACAGACGGTTCTGTAAACGGAAAATAGCTCGGGCGCAGGCGAATCGTCCGATCAGCGCCAAACACATGCTGACACATGGCGAGTAACGTCCCCTTAAGATCAG CCATTGTAATATGCTTGTCGATCACCAGGCCTTCCATCTGATGGAACTGGTGGCTATGTGTGGCATCATCATCATCACGCCGATAAACCACGCCTGGACTGATCATTTTCAGCGGGCCCTTAGTAAAGTCATGTTTCTCCATCGTCCGCGCCTGCATCGGGCTGGTTTGGGACCGCATCAGCAACTCATTGGTAATATAAAAAGTTTCCTGCATATCCC Based on a comprehensive analysis of experimental data such as cell morphology, physiological and biochemical experiments, 16S rRNA gene and pheS gene sequences of the tested bacteria, and with reference to the Bergey's Manual of Systematic Bacteriology, the Institute of Microbiology, Chinese Academy of Sciences identified LR-R50 as Lacticaseibacillus rhamnosus. Example 2

[0036] A method for preparing the Lactobacillus rhamnosus freeze-dried powder is prepared by the following steps: A Lactobacillus rhamnosus fermentation method comprising: The Lactobacillus rhamnosus strain was inoculated on the eggplant bottle solid culture medium for activation; Transplanting the activated bacterial strain into a primary liquid culture medium for expansion; Transplanting the expanded primary bacterial strain into a secondary liquid culture medium for fermentation; The fermented secondary bacterial strain is transplanted into the tertiary liquid culture medium for fermentation, and the fermentation liquid is filtered to obtain the rhamnosus lactobacillus slurry; The activated solid culture medium uses the MRS formula.

[0037] The formula of the primary liquid culture medium is 9 g / L yeast powder, 4 g / L glucose monohydrate, 4 g / L peptone, 2 g / L sodium chloride, and 2 g / L anhydrous sodium acetate. The pH is adjusted to 6.5.

[0038] The secondary liquid culture medium is formulated with 18 g / L yeast powder, 22 g / L glucose monohydrate, 18 g / L peptone, 3 g / L anhydrous sodium acetate, and 3 g / L xylooligosaccharide. The pH is adjusted to 6.0.

[0039] The formula of the tertiary liquid culture medium is 18 g / L yeast powder, 16 g / L glucose monohydrate, 16 g / L peptone, 3 g / L anhydrous sodium acetate, and 4 g / L xylooligosaccharide. The pH is adjusted to 6.0.

[0040] During the fermentation process, the secondary and tertiary liquid culture media are supplemented with 3M sodium hydroxide solution. The pH of the secondary liquid culture media varies in the range of 5-6; the pH of the tertiary liquid culture media varies in the range of 5-6.

[0041] In a specific possible implementation scheme, it includes: S1. Take Lactobacillus rhamnosus LR-R50 and inoculate it on solid culture medium at a volume ratio of 1:8, and then activate it in an anaerobic environment at 37°C for 24 hours; S2, the activated bacteria were placed at 60cm 2 The solid culture medium was inoculated with 200 mL of liquid culture medium in the same proportion and then inoculated into the primary liquid culture medium, and then incubated in an oxygen-free environment at 37°C for 12 hours; S3, transplanting the expanded strain into the secondary liquid culture medium at an inoculation rate of 2 vol%, and then fermenting it in an anaerobic environment at 37°C for 8-10 hours; during the fermentation process, nitrogen is introduced into the fermentation tank, and 3M sodium hydroxide is added to the secondary liquid culture medium to control the pH of the secondary liquid culture medium at 5-6; when the fermentation time is greater than 8 hours, sampling the fermentation liquid and detecting OD600, when OD600 is greater than 1.2, it can be judged that the secondary fermentation is completed; S4. The fermented secondary strains were transplanted into the tertiary liquid culture medium at an inoculation rate of 4 vol%, and then fermented in an oxygen-free environment at 37°C for 8-10 hours. During the fermentation process, nitrogen was introduced into the fermentation tank, and 3M sodium hydroxide was added to the tertiary liquid culture medium to control the pH of the tertiary liquid culture medium at 5-6. When the fermentation time was greater than 8 hours, the fermentation liquid was sampled and the OD600 was tested. When the OD600 was greater than 1.7, the samples were taken at intervals of 10 minutes. When the OD600 no longer increased significantly, the tertiary fermentation was considered to be complete. The fermentation liquid was sampled to test the number of viable bacteria.

[0042] By adopting the above technical scheme, the fermentation and cultivation process of Lactobacillus rhamnosus is optimized, which is conducive to obtaining an ideal fermentation and cultivation effect of Lactobacillus rhamnosus.

[0043] In a specific embodiment, in S3, the secondary liquid culture medium is stirred at a speed of 60-100 rpm during fermentation; in S4, the tertiary liquid culture medium is stirred at a speed of 60-100 rpm during fermentation.

[0044] A method for centrifuging and freeze-drying Lactobacillus rhamnosus, comprising: S5, bacterial cell collection: centrifuging the Lactobacillus rhamnosus fermentation broth, discarding the supernatant, and obtaining Lactobacillus rhamnosus bacterial slurry; S6. Vacuum freeze drying and protective agent preparation Vacuum freeze drying: the rhamnosus Lactobacillus casei bacterial slurry is mixed with a protective agent to obtain an emulsion; the emulsion is subjected to vacuum freeze drying until the moisture content of the bacterial powder is less than 5%, the freeze-dried bacterial powder is crushed with a 60-mesh sieve, and stored after vacuum packaging.

[0045] Preparation of protective agent: The protective agent is prepared and sterilized from the following raw materials in parts by weight: 5 parts of maltodextrin, 2 parts of trehalose, 2 parts of resistant dextrin and 0.5 parts of sodium D ascorbate, and the balance is purified water.

[0046] By adopting the above technical solution and adding a protective agent during vacuum freeze drying, the bacterial strains can be protected from low temperature damage, thereby further enhancing the survival rate of the bacterial strains.

[0047] In a specific embodiment, the mass ratio of the Lactobacillus rhamnosus slurry to the protective agent is 1:1.

[0048] By adopting the above technical solution, the mass ratio of Lactobacillus rhamnosus mud to the protective agent is optimized, which is beneficial to enhancing the survival rate of Lactobacillus rhamnosus after freeze-drying.

[0049] The Lactobacillus rhamnosus LR-R50 of the present invention has the effect of helping to maintain a healthy blood lipid level. Example 3

[0050] A method for preparing the Lactobacillus rhamnosus freeze-dried powder is prepared by the following steps: A Lactobacillus rhamnosus fermentation method comprising: The Lactobacillus rhamnosus strain was inoculated on the eggplant bottle solid culture medium for activation; Transplanting the activated bacterial strain into a primary liquid culture medium for expansion; Transplanting the expanded primary bacterial strain into a secondary liquid culture medium for fermentation; The fermented secondary bacterial strain is transplanted into the tertiary liquid culture medium for fermentation, and the fermentation liquid is filtered to obtain the rhamnosus lactobacillus slurry; The activated solid culture medium uses the MRS formula.

[0051] The formula of the primary liquid culture medium is 12 g / L yeast powder, 6 g / L glucose monohydrate, 6 g / L peptone, 3 g / L sodium chloride, and 4 g / L anhydrous sodium acetate. The pH is adjusted to 6.8.

[0052] The formula of the secondary liquid culture medium is 22 g / L yeast powder, 26 g / L glucose monohydrate, 22 g / L peptone, 4 g / L anhydrous sodium acetate, and 5 g / L xylooligosaccharide. The pH is adjusted to 6.0.

[0053] The formula of the tertiary liquid culture medium is 22 g / L yeast powder, 20 g / L glucose monohydrate, 20 g / L peptone, 4 g / L anhydrous sodium acetate, and 6 g / L xylooligosaccharide. The pH is adjusted to 6.0.

[0054] During the fermentation process, the secondary and tertiary liquid culture media are supplemented with 3M sodium hydroxide solution. The pH of the secondary liquid culture media varies in the range of 5-6; the pH of the tertiary liquid culture media varies in the range of 5-6.

[0055] In a specific possible implementation scheme, it includes: S1. Lactobacillus rhamnosus LR-R50 was inoculated on a solid culture medium at a volume ratio of 1:10, and then activated in an anaerobic environment at 37°C for 24 hours; S2, the activated bacteria were placed at 60cm 2 The solid culture medium was inoculated with 300 mL of liquid culture medium in the same proportion and then transferred to the primary liquid culture medium, which was then incubated at 37°C in an anaerobic environment for 12 hours. S3, transplanting the expanded strain into the secondary liquid culture medium at an inoculation rate of 3 vol%, and then fermenting it in an anaerobic environment at 37°C for 8-10 hours; during the fermentation process, nitrogen is introduced into the fermentation tank, and 3M sodium hydroxide is added to the secondary liquid culture medium to control the pH of the secondary liquid culture medium at 5-6; when the fermentation time is greater than 8 hours, sampling the fermentation liquid and detecting OD600, when OD600 is greater than 1.2, it can be judged that the secondary fermentation is completed; S4. The fermented secondary strains were transplanted into the tertiary liquid culture medium at an inoculation rate of 5 vol%, and then fermented in an oxygen-free environment at 37°C for 8-10 hours. During the fermentation process, nitrogen was introduced into the fermentation tank, and 3M sodium hydroxide was added to the tertiary liquid culture medium to control the pH of the tertiary liquid culture medium at 5-6. When the fermentation time was greater than 8 hours, the fermentation liquid was sampled and the OD600 was tested. When the OD600 was greater than 1.7, the samples were taken at intervals of 10 minutes. When the OD600 no longer increased significantly, the tertiary fermentation was considered to be complete. The fermentation liquid was sampled to test the number of viable bacteria.

[0056] By adopting the above technical scheme, the fermentation and cultivation process of Lactobacillus rhamnosus is optimized, which is conducive to obtaining an ideal fermentation and cultivation effect of Lactobacillus rhamnosus.

[0057] In a specific embodiment, in S3, the secondary liquid culture medium is stirred at a speed of 60-100 rpm during fermentation; in S4, the tertiary liquid culture medium is stirred at a speed of 60-100 rpm during fermentation.

[0058] A method for centrifuging and freeze-drying Lactobacillus rhamnosus, comprising: S5, bacterial cell collection: centrifuging the Lactobacillus rhamnosus fermentation broth, discarding the supernatant, and obtaining Lactobacillus rhamnosus bacterial slurry; S6. Vacuum freeze drying and protective agent preparation Vacuum freeze drying: the rhamnosus Lactobacillus casei bacterial slurry is mixed with a protective agent to obtain an emulsion; the emulsion is subjected to vacuum freeze drying until the moisture content of the bacterial powder is less than 5%, the freeze-dried bacterial powder is crushed with a 60-mesh sieve, and stored after vacuum packaging.

[0059] Preparation of protective agent: The protective agent is prepared and sterilized from the following raw materials in parts by weight: 6 parts of maltodextrin, 3 parts of trehalose, 3 parts of resistant dextrin and 1 part of sodium D ascorbate, and the balance is purified water.

[0060] By adopting the above technical solution and adding a protective agent during vacuum freeze drying, the bacterial strains can be protected from low temperature damage, thereby further enhancing the survival rate of the bacterial strains.

[0061] In a specific embodiment, the mass ratio of the Lactobacillus rhamnosus slurry to the protective agent is 1:1.5.

[0062] By adopting the above technical solution, the mass ratio of Lactobacillus rhamnosus mud to the protective agent is optimized, which is beneficial to enhancing the survival rate of Lactobacillus rhamnosus after freeze-drying.

[0063] The Lactobacillus rhamnosus LR-R50 of the present invention has the effect of helping to maintain a healthy blood lipid level. Example 4

[0064] A lactic acid bacteria solid beverage prepared from the rhamnosus lactobacillus LR-R50, the formula is prepared from the following raw materials by weight: 25 parts of resistant dextrin, 17 parts of oligofructose, 14 parts of oligomalto-oligosaccharide, 14 parts of oligogalactose, 30 parts of inulin, 60 parts of trehalose, 20 parts of polydextrose, rhamnosus lactobacillus LR-R50 (viable bacteria count 4×10 11 CFU / g) lyophilized powder 10 parts, flavoring agent 10 parts.

[0065] The solid beverage preparation method comprises the following process steps: mixing freeze-dried bacterial powder of Lactobacillus rhamnosus LR-R50 (passed through a 60-mesh sieve), resistant dextrin, oligofructose, oligomalto-oligosaccharide, oligogalactose, inulin, trehalose, polydextrose, and flavoring agent uniformly, and packaging into 1g or 1.5g strips. The live bacteria content of 1g strips is 20 billion of Lactobacillus rhamnosus LR-R50 per strip, and the live bacteria content of 1.5g strips is 30 billion of Lactobacillus rhamnosus LR-R50 per strip.

[0066] The flavoring agent in the formula is mainly used to improve or cover up the bad taste of the fermentation raw materials and fermentation products in the freeze-dried powder of Lactobacillus rhamnosus, and give the solid beverage a specific flavor. Natural flavoring agents can be selected, including one and / or two of cranberry fruit extract, blueberry fruit extract or elderberry fruit extract.

[0067] The rhamnosus Lactobacillus LR-R50 strain of the present invention has the effect of helping to maintain a healthy level of blood lipids, but when used, it is usually prepared with lactic acid bacteria strains such as Bifidobacterium longum subsp. longum, Lactobacillus plantarum, Bifidobacterium animalis subsp. lactis, Lactobacillus casei, etc. to prepare a lactic acid bacteria agent of a composite strain with different proportions, thereby giving the product new functions. Test Example 5

[0068] Experiment and determination of acid and bile salt resistance of Lactobacillus rhamnosus LR-R50.

[0069] By rescreening the acid and bile salt resistance of Lactobacillus rhamnosus LR-R50 strain, the Lactobacillus rhamnosus LR-R50 strain with better stress resistance was obtained.

[0070] Lactobacillus rhamnosus LR-R50 (live bacteria 4 × 10 11 The lyophilized bacterial powder (CFU / g) was inoculated with 0.5% (W / V) in MRS medium at pH 6.0, pH 4.0 and pH 2.0, respectively, and cultured under anaerobic conditions for 3 h. The plate count method was used to detect the viable bacteria. The results are shown in the table. Figure 3 .

[0071] The experimental results showed that most of the live bacteria of Lactobacillus rhamnosus LR-R50 survived for 3 hours under pH 4.0, and there was still a sufficient number of live bacteria of Lactobacillus rhamnosus LR-R50 to survive for 3 hours under pH 2.0, indicating that most of the live bacteria of Lactobacillus rhamnosus LR-R50 can pass through the acidic environment of the stomach.

[0072] Lactobacillus rhamnosus LR-R50 (live bacteria 4 × 10 11 The lyophilized bacterial powder (CFU / g) was inoculated with 0.5% (W / V) bile salt concentration, 0.4% bile salt concentration and MRS medium without bile salt at an inoculation rate of 0.5%, cultured under anaerobic conditions for 3 h, and the plate count method was used to detect the viable bacteria. The results are shown in the table. Figure 3 .

[0073] The experimental results showed that most of the live bacteria of Lactobacillus rhamnosus LR-R50 survived for 3 hours at a bile salt concentration of 0.1%, and some live bacteria of Lactobacillus rhamnosus LR-R50 still survived for 3 hours at a bile salt concentration of 0.4%, indicating that Lactobacillus rhamnosus LR-R50 has good bile salt tolerance. Test Example 6

[0074] Animal test to evaluate the efficacy of Lactobacillus rhamnosus LR-R50 in maintaining healthy blood lipid levels.

[0075] The design of the experimental methods and the judgment of the results are based on the animal experiment part of the "Technical Guidelines for Functional Testing and Evaluation of Health Foods (2023 Edition)" issued by the State Administration for Market Regulation and the National Health Commission.

[0076] Animal selection: Healthy adult male SD rats, weighing 200±20 g at the end of the adaptation period.

[0077] Model feed: Add 20% sucrose, 15% lard, 1.2% cholesterol, 0.2% sodium cholate, appropriate amount of casein, calcium hydrogen phosphate, stone powder, etc. to the maintenance feed. The moisture, crude protein, crude fat, crude fiber, crude ash, calcium, phosphorus, calcium, and phosphorus of the model feed must meet the national standards for maintenance feed.

[0078] The test method uses a mixed hyperlipidemia animal model. Feeding animals with feed containing cholesterol, sucrose, lard, and sodium cholate can form an animal model of lipid metabolism disorder (mixed hyperlipidemia animal model), and then giving the animals test samples to detect the effects of the test samples on hyperlipidemia, and to determine the effects of the test samples on lipid absorption, lipoprotein formation, lipid degradation or excretion.

[0079] Animal grouping and administration time of Lactobacillus rhamnosus LR-R50: The test samples were divided into three dose groups of Lactobacillus rhamnosus LR-R50, high dose group, and low dose group. A blank control group and a model control group were also set up, with 10 rats in each group. The test sample Lactobacillus rhamnosus LR-R50 was administered to the three dose groups for 30 days; the high dose group was administered with 0.2 g / d of the solid beverage prepared in Example 4 (4×10 live bacteria of LR-R50) 9 CFU), the medium-dose group was given the solid beverage prepared in Example 4 at 0.1 g / d (LR-R50 viable bacteria 2×10 9 CFU), the low-dose group was given the solid beverage prepared in Example 4 at 0.05 g / d (LR-R50 viable bacteria 1×10 9 CFU).

[0080] The following are the specific experimental steps.

[0081] 1. Adaptation period: Rats were fed maintenance diet under the barrier system and observed for 7 days.

[0082] 2. Modeling period: Rats were randomly divided into 2 groups according to body weight, 10 rats were given maintenance diet as blank control group, and 40 rats were given high-fat model diet as model group. Body weight was measured once a week. After the model group was given high-fat model diet for 2 weeks, blood was collected from the rats without fasting (tail), and serum was separated as soon as possible after blood collection to measure serum TC, TG, LDL-C, and HDL-C levels. According to the TC level, the model group rats were randomly divided into 4 groups again, namely, the low-dose group, medium-dose group, high-dose group and model control group of Lactobacillus rhamnosus LR-R50.

[0083] 3. Experimental period: After grouping, the three dose groups were given Lactobacillus rhamnosus LR-R50 by oral gavage every day, among which the low dose group was gavaged with 0.05g of the solid beverage prepared in Example 4, the medium dose group was gavaged with 0.1g of the solid beverage prepared in Example 4, and the high dose group was gavaged with 0.2g of the solid beverage prepared in Example 4. The blank control group and the model control group were simultaneously given the same volume of a mixture of trehalose and resistant dextrin (2:1); the blank control group continued to be given maintenance feed, the model control group and the three dose groups continued to be given high-fat model feed, and body weight was measured regularly. The experimental period was 30 days.

[0084] 4. Observation indicators: After the end of the trial period, blood will be collected without fasting (from the tail). The serum will be separated as soon as possible after blood collection to measure the levels of TC, TG, LDL-C, and HDL-C in the serum.

[0085] 5. Result determination Results of efficacy in maintaining healthy blood lipid levels: At the end of the experiment, serum triglycerides increased, serum total cholesterol or low-density lipoprotein cholesterol increased when compared with the model control group and the blank control group, and the differences were significant, and the model was determined to be established. (1) Compared with the model control group, serum total cholesterol or low-density lipoprotein cholesterol decreased in any dose group, and serum triglycerides decreased in any dose group, and the differences were significant. At the same time, serum high-density lipoprotein cholesterol in any dose group was not significantly lower than that in the model control group. It can be determined that the animal experiment results of the test sample are positive in maintaining healthy blood lipid levels. (2) Compared with the model control group, serum total cholesterol or low-density lipoprotein cholesterol decreased in any dose group, and the differences were significant. At the same time, serum triglycerides in any dose group were not significantly higher than those in the model control group, and serum high-density lipoprotein cholesterol in any dose group was not significantly lower than that in the model control group. It can be determined that the animal experiment results of the test sample are positive in maintaining healthy blood cholesterol levels. (3) Compared with the model control group, the serum triglyceride level of each dose group was significantly reduced. At the same time, the serum total cholesterol and low-density lipoprotein cholesterol of each dose group were not significantly higher than those of the model control group, and the serum high-density lipoprotein cholesterol was not significantly lower than that of the model control group. It can be determined that the animal experiment results of the test sample are positive for helping to maintain a healthy level of serum triglycerides.

[0086] 6. Data processing and result analysis The experimental results were expressed as mean ± standard deviation (X ± SD, n = 10), and the data were processed by one-way analysis of variance using IBM SPSS Statistics 26.0 statistical software.

[0087] (1) Body weight of rats during the test period The rats were weighed at each stage of the test period. Figure 4 shown.

[0088] The results showed that compared with the blank control group, the body weight of rats in the model control group increased significantly (P<0.05), indicating that the mixed hyperlipidemia animal model was successfully established. In the fourth week of the trial, compared with the model control group, the body weight of rats in the three dose groups of Lactobacillus rhamnosus LR-R50, high, medium and low, decreased significantly (P<0.05), indicating that Lactobacillus rhamnosus LR-R50 can improve the obesity of hyperlipidemia rats.

[0089] (2) Blood lipid indexes of rats during the experimental period The results of the test of TC, TG, LDL-C and HDL-C in rats in the fourth week of the experiment are as follows Figure 5 shown.

[0090] The results showed that compared with the blank control group, the TC, TG, and LDL-C levels in the serum of the model group rats were significantly increased (P<0.01), and the HDL-C level was significantly decreased (P<0.01), indicating that the mixed hyperlipidemia animal model was successfully established. Compared with the model control group, the TC, TG, and LDL-C levels in the serum of the rats in the three dose groups of Lactobacillus rhamnosus LR-R50 were significantly decreased (P<0.05), and the HDL-C levels in the serum of the rats in the high-dose group and the medium-dose group of Lactobacillus rhamnosus LR-R50 were significantly increased (P<0.05), and the HDL-C levels in the serum of the rats in the low-dose group of Lactobacillus rhamnosus LR-R50 were not significantly different (P>0.05). According to the above experimental data, Lactobacillus rhamnosus LR-R50 has a significant lipid-lowering effect on hyperlipidemia rats, and can effectively reduce the levels of serum TC, TG, and LDL-C, and increase the level of HDL-C.

[0091] In summary, Lactobacillus rhamnosus LR-R50 has the effect of improving blood lipid levels in mixed hyperlipidemia animal model rats and can improve obesity in hyperlipidemia rats. The above test results show that Lactobacillus rhamnosus LR-R50 has the effect of helping to maintain healthy blood lipid levels.

Claims

1. A Lactobacillus rhamnosus, characterized in that The Lactobacillus rhamnosus was deposited in the General Microbiology Center of China National Microbiological Culture Collection Administration on August 27, 2024, with the deposit number CGMCC No.31767.

2. The Lactobacillus rhamnosus according to claim 1, characterized in that The Lactobacillus rhamnosus 16SrRNA sequence is shown in SEQ ID No:

1.

3. A culture of Lactobacillus rhamnosus LR-R50 that helps maintain healthy blood lipid levels, characterized in that: The method for preparing the culture comprises: inoculating the Lactobacillus rhamnosus LR-R50 strain according to claim 1 into the following culture medium and culturing it at 35-38° C. for 8-10 hours; the formula composition of the culture medium comprises: yeast powder, glucose monohydrate, peptone, anhydrous sodium acetate, and xylooligosaccharides.

4. A lactic acid bacteria agent having the effect of helping to maintain healthy blood lipid levels, characterized in that: The lactic acid bacteria agent having the effect of helping to maintain healthy blood lipid levels comprises the Lactobacillus rhamnosus LR-R50 strain according to claim 1.

5. The lactic acid bacteria agent having the effect of helping to maintain healthy blood lipid levels according to claim 4, characterized in that: In the lactic acid bacteria agent, the viable count of the Lactobacillus rhamnosus LR-R50 strain is not less than 1×10 9 CFU / mL or 1×10 9 CFU / g; the solid form of the lactic acid bacteria agent includes freeze-dried powder or granular form; the liquid form of the lactic acid bacteria agent includes drops with edible oil as a carrier.

6. The lactic acid bacteria agent having the effect of helping to maintain healthy blood lipid levels according to claim 4, characterized in that: The lactic acid bacteria agent having the effect of helping to maintain healthy blood lipid levels also contains prebiotics; the prebiotics include any one of fructooligosaccharides, isomaltooligosaccharides, galacto-oligosaccharides, inulin, trehalose, resistant dextrin, and polydextrose, or a combination of two or more thereof.

Images