A high-conversion-rate transaminase mutant, its encoding gene and its application

Abstract

This invention discloses a high-conversion-rate transaminase mutant, its encoding gene, and its applications, belonging to the field of bioengineering technology. The transaminase mutant is obtained by amino acid mutation of transaminase mutant M1 as shown in SEQ ID NO.3, with mutation sites at at least one of positions 33, 88, 90, 157, 177, 391, 392, and 442. Compared to transaminase mutant M1, the transaminase mutant provided by this invention exhibits higher enzyme activity and can prepare (S)-1-(3-methoxyphenyl)ethylamine using 3-methoxyacetophenone as a substrate. The product yield is high, and the conversion rate remains high even with increased substrate concentration, with no byproducts generated, showing excellent prospects for industrial application.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, specifically to a transaminase mutant modified from Bacillus megaterium-derived transaminase BM-ATA, its encoding gene, and its application in the preparation of (S)-1-(3-methoxyphenyl)ethylamine. Background Technology

[0002] Rivastigmine is an orally active and potent cholinesterase (ChE) inhibitor that inhibits butyrylcholinesterase (BChE) and acetylcholinesterase (AChE). Rivastigmine is a parasympathomimetic or cholinergic agent that crosses the blood-brain barrier (BBB) ​​and increases the function of cholinergic neurons in the brain by inhibiting acetylcholinesterase. It can be used to treat mild to moderate Alzheimer's disease and dementia caused by Parkinson's disease.

[0003] (S)-1-(3-methoxyphenyl)ethylamine is one of the key chiral intermediates in the synthesis of rivastigmine. Currently, the preparation of chiral intermediates of rivastigmine mainly involves two methods: chemical methods and biocatalytic methods. Chemical methods primarily utilize chiral catalysts for asymmetric-induced synthesis, such as using (salen)Mn(III) and tetraisopropyl titanate as chiral catalysts for asymmetric-induced synthesis of chiral intermediates of rivastigmine; or employing specific resolution systems to chirally resolve racemic amine or alcohol intermediates to obtain the key chiral amine or chiral alcohol intermediate, which is then further transformed to obtain the S-configuration rivastigmine product. Although the reagents used in chemical resolution methods are relatively inexpensive, only half of the racemate can be utilized, while the other configuration is wasted, resulting in high costs and a large amount of waste.

[0004] Biocatalysis can yield highly stereoselective products in a single step, reducing the use of chiral inducers in asymmetric inductive synthesis, simplifying the process, lowering production costs, and improving atom economy. For example, patent document CN116926027A describes an alcohol dehydrogenase mutant and its application in the synthesis of rivastigmine intermediates. Besides alcohol dehydrogenases, transaminases can transfer amino groups from donors to acceptors via the cofactor pyridoxal phosphate, exhibiting high stereoselectivity and a broad substrate spectrum.

[0005] Patent document CN 116334022 A discloses a transaminase mutant for the synthesis of (S)-1-(3-methoxyphenyl)ethylamine, obtained by amino acid mutation of transaminase derived from Bacillus megaterium. Its concentration for catalyzing the synthesis of chiral amines ranges from 1 to 8 g / L, with a maximum space-time yield of 22.3 g / L / day and an optical purity of 98%. However, further increasing the substrate concentration leads to a decrease in conversion rate. This is mainly because with increasing substrate and amine donor concentrations, unstable catalytic intermediates accumulate, making the transaminase in the system more prone to inactivation or denaturation, resulting in substrate-induced enzyme activity inhibition.

[0006] Resting stability and operational stability are both closely related to the economic viability of enzymes for industrial use. Improving the stability of transaminases is crucial for making them more suitable for industrial applications. Therefore, developing transaminases with high catalytic activity and strong stereoselectivity for the synthesis of (S)-1-(3-methoxyphenyl)ethylamine is a problem that needs to be solved by those skilled in the art. Summary of the Invention

[0007] The purpose of this invention is to provide a transaminase with high catalytic activity and strong stereoselectivity for the preparation of high optical purity (S)-1-(3-methoxyphenyl)ethylamine, which meets the requirements of industrial production.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] This invention addresses the previous site-directed mutagenesis of mutant M1 obtained by our research group through site-directed mutagenesis of the transaminase-encoding gene from Bacillus megaterium, resulting in a transaminase mutant with high conversion efficiency. Specifically, the transaminase mutant is a mutant obtained by amino acid mutation of transaminase mutant M1, whose amino acid sequence is shown in SEQ ID NO.3. The mutation sites are at least one of positions 33, 88, 90, 157, 177, 391, 392, and 442. Specifically, proline at position 33 is mutated to cysteine, threonine at position 88 to lysine, alanine at position 90 to cysteine, threonine at position 157 to alanine, serine at position 177 to asparagine, aspartic acid at position 391 to glutamic acid, isoleucine at position 392 to leucine, and arginine at position 442 to isoleucine.

[0010] Studies have shown that, compared to mutant M1, the transaminase mutant provided by this invention significantly enhances the enzyme activity in catalyzing the production of (S)-1-(3-methoxyphenyl)ethylamine from 3-methoxyacetophenone.

[0011] Preferably, the amino acid mutation site is a combination of position 442 and at least one of the remaining sites. More preferably, the amino acid mutation site is a combination of position 442, position 391, and at least one of the remaining sites.

[0012] More preferably, the amino acid mutation site is a combination of all the above sites, and the amino acid sequence of the resulting mutant is shown in SEQ ID NO.4.

[0013] The amino acid mutation site is a combination of positions 88 and 157, and the amino acid sequence of the resulting mutant is shown in SEQ ID NO.5.

[0014] The amino acid mutation sites are a combination of positions 33, 90, and 442, and the amino acid sequence of the resulting mutant is shown in SEQ ID NO.6.

[0015] The amino acid mutation sites are a combination of positions 33, 90, 391 and 442, and the amino acid sequence of the resulting mutant is shown in SEQ ID NO.7.

[0016] The amino acid mutation sites are a combination of positions 391, 392, and 442, and the amino acid sequence of the resulting mutant is shown in SEQ ID NO.8.

[0017] The amino acid mutation sites are a combination of positions 88, 391, and 442, and the amino acid sequence of the resulting mutant is shown in SEQ ID NO.9.

[0018] The amino acid mutation site is a combination of positions 157 and 442, and the amino acid sequence of the resulting mutant is shown in SEQ ID NO.10.

[0019] The amino acid mutation sites are a combination of positions 88, 391, 157 and 442, and the amino acid sequence of the resulting mutant is shown in SEQ ID NO.11.

[0020] This invention also provides a coding gene for encoding the transaminase mutant, wherein the nucleotide sequence of the coding gene is based on the nucleotide sequence shown in SEQ ID NO.2, with codons encoding the corresponding amino acids replaced. This invention can obtain the coding gene artificially; alternatively, it can be obtained through site-directed mutagenesis.

[0021] The present invention also provides a recombinant expression vector comprising a coding gene encoding the amino acid sequence of the aforementioned transaminase mutant. Preferably, the recombinant expression vector uses pET30a as the vector plasmid.

[0022] The present invention also provides a genetically engineered bacterium comprising the recombinant expression vector, the genetically engineered bacterium being used to produce the transaminase mutant. The recombinant vector is transformed into host cells to obtain the recombinant genetically engineered bacterium. The host cells can be various conventional host cells in the art; preferably, the host bacterium for the genetically engineered bacterium is *Escherichia coli* BL21.

[0023] The present invention also provides a method for constructing the transaminase mutant, the method comprising the following steps:

[0024] (1) Design site-directed mutagenesis primers, use plasmids carrying the gene encoding transaminase mutant M1 as templates, perform reverse PCR to obtain transaminase single point mutation products.

[0025] (2) Using the single point mutation product as a template, reverse PCR was performed using site-directed mutation primers to obtain multi-site mutation products.

[0026] (3) The single point mutation product and the multi-site mutation product are transformed into the host bacteria, and the transaminase mutant expression strain is screened and induced to express to obtain the transaminase mutant.

[0027] Preferably, the original vector for the recombinant plasmid is pET30a; the host bacterium is Escherichia coli BL21.

[0028] Another object of the present invention is to provide the use of the aforementioned transaminase mutant in the preparation of (S)-1-(3-methoxyphenyl)ethylamine, the use comprising asymmetric catalytic amination of 3-methoxyacetophenone to (S)-1-(3-methoxyphenyl)ethylamine under conditions of addition of an amine donor.

[0029] The transaminase mutant provided by this invention asymmetrically catalyzes the amination of 3-methoxyacetophenone with the addition of an amine donor to generate (S)-1-(3-methoxyphenyl) with high optical purity (ee>99%), which has good prospects for industrial application.

[0030] The application includes: using engineered bacteria containing a transaminase mutant encoding gene, centrifuged to obtain wet bacterial cells, immobilized cells, enzymes extracted from wet bacterial cells after ultrasonic disruption, or immobilized enzymes as catalysts, reacting with 3-methoxyacetophenone as substrate under the conditions of (S)-α-methylbenzylamine and pyridoxal phosphate, and a buffer solution with pH ≤ 8 containing organic solvent as the reaction medium at 25-37℃ and 150-300 rpm. After the reaction is completed, the reaction solution is separated and purified to obtain (S)-1-(3-methoxyphenyl)ethylamine.

[0031] The transaminase mutant described in this invention can be used in whole-cell engineered bacteria, as unpurified crude enzyme, or as partially or fully purified enzyme. Furthermore, the transaminase mutant of this invention can be prepared into immobilized enzymes or immobilized cell-based biocatalysts using immobilization techniques known in the art.

[0032] The fermentation culture method was as follows: the recombinant engineered bacteria were inoculated into LB liquid medium containing kanamycin (final concentration 50 μg / mL) and cultured at 37℃ with shaking for 18 h; the seed culture was inoculated at a volume ratio of 1% into fresh LB liquid medium containing kanamycin (final concentration 50 μg / mL) and cultured at 37℃ and 220 rpm with shaking until the cell OD reached the target value. 600 The concentration was 0.6, and isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.1 mM. The cells were induced and cultured at 25°C and 220 rpm for 16 h, and then collected by centrifugation at 4°C and 3500 rpm for 10 min.

[0033] The beneficial effects of this invention are as follows:

[0034] (1) Compared with the transaminase mutant M1, the transaminase mutant provided by the present invention has higher enzyme activity and can prepare (S)-1-(3-methoxyphenyl)ethylamine using 3-methoxyacetophenone as a substrate. The product yield is high, and the conversion rate is still high when the substrate concentration is increased, and no by-products are generated.

[0035] (2) This invention utilizes transaminase mutants as biocatalysts for the chiral intermediate of rivastigmine, making it more economical and convenient to obtain high optical purity chiral products. The production method has the advantages of simple operation and low cost, which greatly reduces the production cost and has a good prospect for industrial application. Attached Figure Description

[0036] Figure 1 This is a plasmid map of the recombinant mutant.

[0037] Figure 2 The high-performance liquid chromatography (HPLC) retention times of the standards for (S / R)-1-(3-methoxyphenyl)ethylamine, substrate 3-methoxyacetophenone, (S)-phenylethylamine, and acetophenone in the whole-cell catalytic reaction of 3-methoxyacetophenone are given. Detailed Implementation

[0038] The present invention will be further described below with reference to specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention.

[0039] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0040] Nucleic acid sequences are written from left to right in a 5' to 3' direction, while amino acid sequences are written from left to right in a direction from the amino terminus to the carboxyl terminus.

[0041] Example 1: Construction of engineered bacteria capable of expressing mutants

[0042] 1. Based on the amino acid sequence of the 5G0A protein (Bacillus megaterium-derived transaminase BM-ATA, www.rcsb.org / structure / 5G0A) in the PDB protein library, the corresponding coding gene was synthesized by Shanghai Jierui Biotechnology Co., Ltd. The his tag at the end of the 5G0A amino acid sequence was removed, i.e., the ending sequence was changed from EWQALEHHHHHH to EWQ*. The amino acid sequence of the wild-type Bacillus megaterium-derived transaminase is shown in SEQ ID NO.1, and the nucleotide sequence of the coding gene is shown in SEQ ID NO.2.

[0043] Using plasmid pET30a as a vector, a recombinant plasmid containing the encoding gene was obtained through routine preparation procedures. This recombinant plasmid was transformed into *E. coli* BL21 to obtain an engineered recombinant strain containing wild-type transaminase. The recombinant strain was activated on LB agar plates containing 1‰ kanamycin (Kan) resistance and cultured at 37°C for 18 h. Single colonies were picked and cultured in 50 mL LB Erlenmeyer flasks containing 1‰ kanamycin resistance at 37°C and 220 rpm until OD500. 600 The concentration was around 0.6. Plasmids were extracted according to the instructions of the plasmid miniprep kit.

[0044] 2. Construction of transaminase mutant M1

[0045] Using the plasmid extracted in step 1 as a template, multiple rounds of mutation were performed using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, United States) to construct the mutant plasmid. Multiple site mutations were performed on alanine (A) at position 242, threonine (T) at position 295, leucine (L) at position 387, and valine (V) at position 436 in the wild-type amino acid sequence. Corresponding primers were designed, as shown in Table 1.

[0046] Table 1. Mutant Primers

[0047] Primers Sequence (5'-3') A242V-F: GAAGTTAGCCAGGGTGTGGGTAGCGCAATG A242V-R: CATTGCGCTACCCACACCCTGGCTAACTTC T295C-F: CAGCCGGATATTATTTGCATGGGTAAAGGTCTGAG T295C-R: CTCAGACCTTTACCCATGCAAATAATATCCGGCTG L387A-F: GATGGTTATGGCCTGGCGTGGATTGTTGATATTGTG L387A-R: CACAATATCAACAATCCACGCCAGGCCATAACCATC V436A-F: GATTGGTGGTGCTATGCCGAATACCATGCG V436A-R: CGCATGGTATTCGGCATCGCACCACCAATC

[0048] The constructed mutant plasmid was transformed into E. coli BL21 competent cells, mixed well, and placed on ice for 25 min. After that, the E. coli BL21 competent cells were heat-shocked at 42℃ for 90 s and then placed on ice for 5 min. 1 mL of LB medium was added and cultured at 37℃ for 50 min. After that, the cells were centrifuged at 12000 rpm for 1 min, and 100 μL of the supernatant was taken to resuspend the cells. The cells were then spread on LB plates containing 1‰ kanamycin and cultured at 37℃ for 18 h.

[0049] Pick a single colony from the plate and place it in a test tube containing 5 mL of LB medium. After incubating for 8 hours, take 1 mL of the culture for sequencing. If the sequencing results are correct, add an equal volume of 40% glycerol solution to the remaining bacterial culture and store it in a -80°C freezer for later use.

[0050] A transaminase mutant engineered bacterium, E. coli BL21 / pET30a-BmATA-M1, was obtained. Sequencing results showed that the codon GCA encoding alanine (A) at position 242 was mutated to the codon GTG encoding valine (V); the codon ACC encoding threonine (T) at position 295 was mutated to the codon TGC encoding cysteine ​​(C); the codon CTG encoding leucine (L) at position 387 was mutated to the codon GCG encoding alanine (A); and the codon GTT encoding valine (V) at position 436 was mutated to the codon GCT encoding alanine (A). The amino acid sequence of mutant M1 is SEQ ID NO.3.

[0051] 3. Construction of transaminase mutant M2

[0052] Using the pET30a-BmATA-M1 constructed in step 2 as a template, the mutant plasmid was constructed using a point mutation kit. Specifically, proline (P) at position 33 was mutated to cysteine ​​(C), threonine (T) at position 88 to lysine (K), alanine (A) at position 90 to cysteine ​​(C), threonine (T) at position 157 to alanine (A), serine (S) at position 177 to asparagine (N), aspartic acid (D) at position 391 to glutamic acid (E), isoleucine (I) at position 392 to leucine (L), and arginine (R) at position 442 to isoleucine (I). Corresponding primers were designed, as shown in Table 2. The construction method was the same as above.

[0053] Table 2. Mutant Primers

[0054]

[0055] The transaminase mutant engineered strain E. coli BL21 / pET30a-BmATA-M2 was obtained. Sequencing results showed that the codon CCG encoding proline (P) at position 33 was mutated to the codon TGC encoding cysteine ​​(C); the codon ACC encoding threonine (T) at position 88 was mutated to the codon AAA encoding lysine (K); the codon GCC encoding alanine (A) at position 90 was mutated to the codon TGC encoding cysteine ​​(C); the codon ACC encoding threonine (T) at position 157 was mutated to the codon GCC encoding alanine (A); the codon AGC encoding serine (S) at position 177 was mutated to the codon AAC encoding asparagine (N); the codon GAT encoding aspartic acid (D) at position 391 was mutated to the codon GAA encoding glutamate (E); the codon ATT encoding isoleucine (I) at position 392 was mutated to the codon CTG encoding leucine (L); and the codon CGT encoding arginine (R) at position 442 was mutated to the codon ATT encoding isoleucine (I). The amino acid sequence of mutant M2 is SEQ ID NO.4.

[0056] 4. Construction of transaminase mutant M3

[0057] Using pET30a-BmATA-M1 constructed in step 2 as a template, the mutant plasmid was constructed using a point mutation kit. Threonine (T) at position 88 was mutated to lysine (K), and threonine (T) at position 157 was mutated to alanine (A). The construction method was the same as above.

[0058] A transaminase mutant strain, E. coli BL21 / pET30a-BmATA-M3, was obtained. Sequencing results showed that the codon ACC encoding threonine (T) at position 88 was mutated to the codon AAA encoding lysine (K), and the codon ACC encoding threonine (T) at position 157 was mutated to the codon GCC encoding alanine (A). The amino acid sequence of mutant M3 is SEQ ID NO.5.

[0059] 5. Construction of transaminase mutant M4

[0060] Using pET30a-BmATA-M1 constructed in step 2 as a template, the mutant plasmid was constructed using a point mutation kit. Proline (P) at position 33 was mutated to cysteine ​​(C), alanine (A) at position 90 was mutated to cysteine ​​(C), and arginine (R) at position 442 was mutated to isoleucine (I). The construction method was the same as above.

[0061] A transaminase mutant engineered bacterium, E. coli BL21 / pET30a-BmATA-M4, was obtained. Sequencing results showed that the codon CCG encoding proline (P) at position 33 was mutated to the codon TGC encoding cysteine ​​(C), the codon GCC encoding alanine (A) at position 90 was mutated to the codon TGC encoding cysteine ​​(C), and the codon CGT encoding arginine (R) at position 442 was mutated to the codon ATT encoding isoleucine (I). The amino acid sequence of mutant M4 is SEQ ID NO. 6.

[0062] 6. Construction of transaminase mutant M5

[0063] Using pET30a-BmATA-M4 constructed in step 5 as a template, the mutant plasmid was constructed using a point mutation kit. The aspartic acid (D) at position 391 was mutated to glutamic acid (E), and the construction method was the same as above.

[0064] A transaminase mutant engineered bacterium, E. coli BL21 / pET30a-BmATA-M5, was obtained. Sequencing results showed that the codon GAT encoding aspartic acid (D) at position 391 was mutated to the codon GAA encoding glutamic acid (E). The amino acid sequence of mutant M5 is SEQ ID NO.7.

[0065] 7. Construction of transaminase mutant M6

[0066] Using pET30a-BmATA-M1 constructed in step 2 as a template, the mutant plasmid was constructed using a point mutation kit. Aspartic acid (D) at position 391 was mutated to glutamic acid (E), isoleucine (I) at position 392 was mutated to leucine (L), and arginine (R) at position 442 was mutated to isoleucine (I). The construction method was the same as above.

[0067] A transaminase mutant engineered bacterium, E. coli BL21 / pET30a-BmATA-M6, was obtained. Sequencing results showed that the codon GAT encoding aspartic acid (D) at position 391 was mutated to the codon GAA encoding glutamic acid (E), the codon ATT encoding isoleucine (I) at position 392 was mutated to the codon CTG encoding leucine (L), and the codon CGT encoding arginine (R) at position 442 was mutated to the codon ATT encoding isoleucine (I). The amino acid sequence of mutant M6 is SEQ ID NO. 8.

[0068] 8. Construction of transaminase mutant M7

[0069] Using pET30a-BmATA-M1 constructed in step 2 as a template, the mutant plasmid was constructed using a point mutation kit. Threonine (T) at position 88 was mutated to lysine (K), aspartic acid (D) at position 391 was mutated to glutamic acid (E), and arginine (R) at position 442 was mutated to isoleucine (I). The construction method was the same as above.

[0070] A transaminase mutant engineered bacterium, E. coli BL21 / pET30a-BmATA-M7, was obtained. Sequencing results showed that the codon ACC encoding threonine (T) at position 88 was mutated to the codon AAA encoding lysine (K), the codon GAT encoding aspartic acid (D) at position 391 was mutated to the codon GAA encoding glutamic acid (E), and the codon CGT encoding arginine (R) at position 442 was mutated to the codon ATT encoding isoleucine (I). The amino acid sequence of mutant M7 is SEQ ID NO. 9.

[0071] 9. Construction of transaminase mutant M8

[0072] Using pET30a-BmATA-M1 constructed in step 2 as a template, a point mutation kit was used to construct the mutant plasmid. Threonine (T) at position 157 was mutated to alanine (A), and arginine (R) at position 442 was mutated to isoleucine (I). The construction method was the same as above.

[0073] A transaminase mutant engineered bacterium, E. coli BL21 / pET30a-BmATA-M8, was obtained. Sequencing results showed that the codon ACC encoding threonine (T) at position 157 was mutated to the codon GCC encoding alanine (A), and the codon CGT encoding arginine (R) at position 442 was mutated to the codon ATT encoding isoleucine (I). The amino acid sequence of mutant M8 is SEQ ID NO. 10.

[0074] 10. Construction of transaminase mutant M9

[0075] Using pET30a-BmATA-M7 constructed in step 8 as a template, the mutant plasmid was constructed using a point mutation kit. The threonine (T) at position 157 was mutated to alanine (A), and the construction method was the same as above.

[0076] A transaminase mutant engineered bacterium, E. coli BL21 / pET30a-BmATA-M9, was obtained. Sequencing results showed that the codon ACC encoding threonine (T) at position 157 was mutated to the codon GCC encoding alanine (A). The amino acid sequence of mutant M9 is SEQ ID NO.11.

[0077] Example 2: Induced expression of various mutants

[0078] The engineered bacteria expressing the wild-type enzyme constructed in Example 1 and the engineered bacteria expressing each mutant were inoculated into 5 mL LB liquid medium tubes containing 50 μg / mL kanamycin and cultured at 37°C for 18 h. Then, 1% (v / v) was inoculated into 50 mL LB medium containing 50 μg / mL kanamycin and cultured at 37°C and 220 rpm until the bacterial cell concentration reached OD500. 600 When the concentration reaches approximately 0.6, add IPTG to a final concentration of 0.1 mmol / L and induce culture at 25℃ and 220 rpm for 16 h. Collect wet cells by centrifugation at 4℃ and 3500 rpm for 10 min to obtain wet cells of engineered bacteria expressing wild-type enzymes and engineered bacteria expressing various mutants.

[0079] Example 3: Preparation of (S)-1-(3-methoxyphenyl)ethylamine from mutant M1 (A242V / T295C / L387A / V436A)

[0080] Prepare a NaH2PO4-Na2HPO4 buffer solution with pH 7.5 containing 12 g / L (S)-α-methylbenzylamine, 0.25 g / L pyridoxal phosphate, 3 g / L 3-methoxyacetophenone, and 10% isopropanol.

[0081] The obtained mutant A242V / T295C / L387A / V436A wet cells were resuspended in the reaction solution to a wet cell concentration of 50 g / L, and this was used to prepare the reaction system solution. 1 mL of this reaction system solution was placed in a constant temperature shaker at 37°C and 220 rpm for 4 h. After the reaction, the mixture was extracted with ethyl acetate and centrifuged, then vacuum evaporated at 35°C for 1.5 h, followed by redissolution with a liquid mobile phase (pH 1.0 perchloric acid aqueous solution). The yield and ee value were determined using high performance liquid chromatography (HPLC). The final ee value of the product at a substrate concentration of 3 g / L was determined. s The value reached 95%, and the yield was 42.02%.

[0082] When the substrate concentration was further increased, the conversion rate decreased (see Table 3), so further optimization of the mutant is needed.

[0083] Table 3

[0084] Substrate concentration (g / L) Conversion rate (%) 3 42.02 4 36.15 5 22.1 6 12.11 7 5.9

[0085] Example 4: Preparation of (S)-1-(3-methoxyphenyl)ethylamine from mutant M2 (P33C / T88K / A90C / T157A / S177N / A242V / T295C / L387A / D391E / I392L / V436A / R442I) at a substrate concentration of 7.5 g / L

[0086] Prepare a NaH2PO4-Na2HPO4 buffer solution with pH 7.5 containing 30 g / L (S)-α-methylbenzylamine, 0.25 g / L pyridoxal phosphate, 7.5 g / L 3-methoxyacetophenone, and 10% isopropanol.

[0087] The obtained mutant M2 (P33C / T88K / A90C / T157A / S177N / A242V / T295C / L387A / D391E / I392L / V436A / R442I) wet cells were resuspended in the reaction solution to a wet cell concentration of 50 g / L, and this was prepared as the reaction system solution. 1 mL of this reaction system solution was taken and reacted at 37°C and 220 rpm in a constant temperature shaker for 4 h. After the reaction was complete, the mixture was extracted with ethyl acetate and centrifuged, then rotary evaporated under vacuum at 35°C for 1.5 h, and subsequently reconstituted with a liquid mobile phase (pH 1.0 perchloric acid aqueous solution).

[0088] The yield and ee were determined by high performance liquid chromatography. s The liquid chromatogram of (S / R)-1-(3-methoxyphenyl)ethylamine standard is shown below. Figure 2 As shown, the final measured ee s Value >99%, yield 91.91%. Example 5: Preparation of (S)-1-(3-methoxyphenyl)ethylamine from transaminase mutant M3-M9 at a substrate concentration of 7.5 g / L

[0089] Prepare a NaH2PO4-Na2HPO4 buffer solution with pH 7.5 containing 30 g / L (S)-α-methylbenzylamine, 0.25 g / L pyridoxal phosphate, 7.5 g / L 3-methoxyacetophenone, and 10% isopropanol.

[0090] The obtained mutant wet cells were resuspended in the reaction solution to a wet cell concentration of 50 g / L, and this was prepared as the reaction system solution. 1 mL of this reaction system solution was placed in a shaker at 37°C and 220 rpm for 4 h. After the reaction, the cells were extracted with ethyl acetate and centrifuged, then rotary evaporated under vacuum at 35°C for 1.5 h, followed by redissolution with a liquid mobile phase (pH 1.0 perchloric acid aqueous solution). The yield and ee were determined using high-performance liquid chromatography (HPLC). s The values ​​are shown in Table 4.

[0091] Table 4

[0092] name mutation site Yield (%) <![CDATA[ee s Value (%) M3 T88K / T157A 67.1745 >99 M4 P33C / A90C / R442I 62.05805 >99 M5 P33C / A90C / D391E / R442I 55.4336 >99 M6 D391E / I392L / R442I 65.53105 >99 M7 T88K / D391E / R442I 88.17675 >99 M8 T157A / R442I 83.9663 >99 M9 T88K / D391E / T157A / R442I 77.1745 >99

[0093] Experimental results analysis: Compared with the transaminase mutant BmATA-M1, the BM-ATA mutant provided by this invention has superior catalytic activity. The concentration of chiral amines synthesized by the BM-ATA mutant is 1-8 g / L. For example, mutant M2, at a substrate concentration of 7.5 g / L, can achieve a maximum space-time yield of 41.4 g / L / day. s With a purity >99%, it exhibits high optical purity. Furthermore, the catalyst is easy to prepare, operates under mild reaction conditions, has broad substrate adaptability, and is environmentally friendly. It can efficiently catalyze the asymmetric amination reaction of prochiral ketones, demonstrating excellent prospects for industrial application development.

[0094] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any way, and all technical solutions obtained by equivalent substitution or equivalent transformation fall within the protection scope of the present invention.

Claims

1. A transaminase mutant, characterized in that, The amino acid sequence of the transaminase mutant is shown in any one of SEQ ID NO.4 to SEQ ID NO.

11.

2. A transaminase mutant gene, characterized in that, The gene is used to encode the transaminase mutant as described in claim 1.

3. A recombinant expression vector, characterized in that, The recombinant expression vector contains a coding gene that encodes the amino acid sequence of the transaminase mutant as described in claim 1.

4. The recombinant expression vector as described in claim 3, characterized in that, The recombinant expression vector uses pET30a as the vector plasmid.

5. A genetically engineered bacterium for producing the transaminase mutant as described in claim 1, characterized in that, The genetically engineered bacteria contain the recombinant expression vector as described in claim 3 or 4.

6. The genetically engineered bacteria as described in claim 5, characterized in that, The host bacterium is Escherichia coli. E. coli BL21.

7. The transaminase mutant as described in claim 1 in the preparation ( S Its application in 1-(3-methoxyphenyl)ethylamine is characterized by, The application includes the asymmetric catalytic amination of 3-methoxyacetophenone to ( ) under conditions with the addition of an amine donor. S )-1-(3-methoxyphenyl)ethylamine.

8. The application as described in claim 7, characterized in that, The application includes: using engineered bacteria containing a transaminase mutant encoding gene, centrifuged to obtain wet bacterial cells, immobilized wet bacterial cells, enzymes extracted from wet bacterial cells after ultrasonic disruption, or immobilized enzymes as catalysts, with the addition of (… S α-methylbenzylamine and pyridoxal phosphate were reacted with 3-methoxyacetophenone as the substrate in a buffer solution containing organic solvent with a pH ≤ 8 at 25-37℃ and 150-300 rpm. After the reaction, the reaction solution was separated and purified to obtain ( S )-1-(3-methoxyphenyl)ethylamine.

Images