Csdc2 overexpression vector and construction method of interference cell model

Abstract

The invention discloses a construction method of a Csdc2 overexpression vector and an interference cell model, and belongs to the technical field of cell engineering and gene engineering. Csdc2 is found to be an important gene for regulating and controlling periodic development of hair follicles, and gene expression is acted by related hormones and participates in regulation and control of villus growth of down producing goats. The Csdc2 is taken as a research object, the Csdc2 gene is overexpressed through a gene engineering technology, and the Csdc2 in the dermal papilla cell of the down producing goat can be accurately overexpressed; the expression of the goat Csdc2 gene at the mRNA level can be effectively inhibited by acting the siRNA for inhibiting the expression of the goat Csdc2 gene on the dermal papilla cells of the down producing goat, and successful establishment of a Csdc2 overexpression vector and siRNA interference cell model is proved. The Csdc2 gene is helpful for researching the function of the Csdc2 gene, and has a good application value for researching the molecular mechanism of periodic growth of secondary hair follicles of down producing goats and regulating and controlling the growth of villus.

Description

Technical Field

[0001] The invention belongs to the technical field of cell engineering and gene engineering, and particularly relates to a method for constructing a Csdc2 overexpression vector and an interference cell model. Background Art

[0002] Cashmere goats are one of the most important economic animals, famous for producing high-quality cashmere. How to improve cashmere production and quality has always attracted the attention of researchers and producers. Cashmere is produced by secondary hair follicles, which directly affects cashmere production and quality. The secondary hair follicles of cashmere goats have the characteristics of periodic circulation, which are mainly divided into growth phase, regression phase and resting phase. This is a delicate biological process regulated by the environment and multiple signal pathways, and the research on its regulatory mechanism has attracted much attention.

[0003] The protein encoded by the Csdc2 gene belongs to a member of the cold shock protein CSD (Cold shock domain, CSD) family, and is involved in cell proliferation, differentiation, immune response and other processes. Csdc2 was found to be highly expressed in the growth phase of the hair follicles of cashmere goats and lowly expressed in the resting phase. It is an important gene for regulating the periodic development of hair follicles, but its specific regulatory mechanism has not been studied in depth. The present invention hopes to explore the role of Csdc2 in hair follicle development by designing and constructing an overexpression plasmid for the goat Csdc2 gene, designing a specific siRNA sequence for the goat Csdc2 gene, transfecting the dermal papilla cells of the cashmere goat, and laying a foundation for further research on the function of the goat Csdc2 gene in the future, and can be widely used in cells and animal models related to the goat Csdc2 gene, with important application prospects and economic value. Summary of the invention

[0004] The purpose of the present invention is to provide a method for constructing a Csdc2 overexpression vector and an interference cell model. To achieve the above purpose, the present invention adopts the following technical solutions: 1. A method for constructing a goat Csdc2 overexpression vector comprises the following steps: (1) PCR amplification of the CDS sequence fragment of the goat-derived Csdc2 gene; (2) Double enzyme digestion and ligation of the obtained gene fragment and expression vector; ⑶ Transform the ligation product into Escherichia coli, pick the positive clones for culture, and then extract the plasmid.

[0005] The upstream and downstream primer sequences required for PCR amplification of the CDS sequence fragment in step (1) are as follows: Upstream primer: Forword: 5'-CGGAATTCATGACTTCGGAGCCTCAG-3' Downstream primer: Reverse: 5' -GCTCTAGACTAGGAGCCCACAACCTG-3' The expression vector in step (2) is a pcDNA3.1(+) vector.

[0006] The restriction endonucleases used in the step (2) are EcoRⅠ and XbaⅠ ( Figure 1 ).

[0007] A goat Csdc2 gene overexpression host cell contains the goat Csdc2 gene overexpression plasmid.

[0008] Preferably, the goat Csdc2 gene overexpression host cell is a cashmere goat dermal papilla cell ( Figure 2 ).

[0009] The pcDNA3.1-Csdc2 overexpression plasmid was transfected into the dermal papilla cells of cashmere goats. The mRNA expression level of the Csdc2 gene was detected by qRT-PCR. Overexpression of Csdc2 significantly upregulated the expression level of the Csdc2 gene mRNA (P<0.01) ( Figure 3 ).

[0010] The present invention also provides a method for establishing a Csdc2 interference cell model, comprising the following steps: a siRNA for inhibiting the expression of goat CSDC2 gene, characterized in that the siRNA sequence is: si-Csdc2-01 AGAACUGCUUACAGACGCCTT si-Csdc2-02 AUGUCAGACACGUGCACGATT si-Csdc2-03 AACUUCUGGUUCUUGGGCGTT Transfect si-Csdc2 into cashmere goat dermal papilla cells ( Figure 4 ), using qRT-PCR and detecting the expression level of Csdc2 gene mRNA, interference with Csdc2 significantly reduced the expression level of Csdc2 gene mRNA (P<0.01)( Figure 5 ),; Preferably, the siRNA preferably has a nucleotide sequence of: si-Csdc2-02 AUGUCAGACACGUGCACGATT BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 Csdc2 overexpression vector map Figure 2 Cashmere goat dermal papilla cells transfected with overexpression plasmid Figure 3 Figure 2 shows the RT-qPCR results after overexpression. Figure 4 Cashmere goat dermal papilla cells transfected with interference fragments Figure 5 Figure 2 shows the RT-qPCR results after interference. Implementation

[0012] The present invention discloses a method for constructing a Csdc2 overexpression vector and an interference cell model. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0013] In the method for constructing the Csdc2 overexpression vector and the interference cell model provided by the present invention, all raw materials and reagents used can be purchased from the market. The present invention is further described below in conjunction with the examples: Example 1 Preparation of pcDNA3.1-Csdc2 plasmid 1. Primer design: The restriction endonucleases present in the CDS region of Csdc2 (XM_005681114.3) were compared with the analysis of restriction endonucleases in the pcDNA3.1(+) overexpression vector using SnapGene v6.0.2 software to determine the specific restriction endonucleases, and primers containing specific restriction endonucleases were designed and synthesized by Beijing Qingke Biotechnology Co., Ltd. (see Table 1 ).

[0014] Table 1 Csdc2 primer sequences

[0015] 2. cDNA Extraction ⑴ After washing the cells with PBS, add 500 μL Trizol to each well of the culture plate, pipette repeatedly, and place on ice for 5 minutes to fully lyse the cells. Transfer to a 1.5 mL enzyme-free centrifuge tube; (2) Add 200 μL chloroform, shake for 5 min, mix thoroughly, and centrifuge (4°C, 12000g, 15 min); ⑶ The solution is divided into three layers. The upper colorless aqueous phase is RNA. Use a pipette to carefully absorb the upper colorless liquid and transfer it to a new enzyme-free centrifuge tube; ⑷ Add 1 / 2 volume of isopropanol to the centrifuge tube, invert the tube to mix thoroughly. Let stand at room temperature for 10 minutes, centrifuge (4°C, 12000g, 10 minutes), and discard the supernatant; ⑸ Add 75% ethanol prepared with DEPC water to the centrifuge tube, vortex for 30 seconds, centrifuge (4°C, 7500g, 5 minutes), discard the supernatant, and dry at room temperature for 5 minutes; ⑹Add 50 μL DEPC water to dissolve the precipitate and store it at -80 ℃ for later use.

[0016] ⑺cDNA synthesis was carried out according to the instructions of the one-step reverse transcription kit of Quanshijin Company, and the procedure is shown in Table 2.

[0017] Table 2 Instructions for use of one-step reverse transcription kit

[0018] 42℃ 2 min; 85℃ 5 sec 3. Cloning of Csdc2 gene The CDS sequence of Csdc2 was amplified using pfu DNA polymerase, and the reaction system was as follows: Table 3 Reaction system of CDS sequence amplification of Csdc2 by pfu DNA polymerase

[0019] Table 4 PCR amplification reaction program

[0020] 4. The double enzyme digestion system of PCR products and overexpression vectors is as follows: Table 5 Double restriction enzyme digestion system of PCR products and overexpression vectors

[0021] Digest in 37℃ water bath overnight.

[0022] 5. Connection system Table 6 Connection system

[0023] Ligation was allowed to proceed overnight at room temperature.

[0024] 6. Transformation of ligation products and plasmid extraction Add 10 μL of ligation product to 100 μL of competent cells, flick to mix, and place on ice for 30 min; heat shock in a 42 ℃ water bath for 90 s and quickly transfer to ice for 3-5 min; add 800 μL of LB liquid culture medium without ampicillin resistance, shake and culture at 37 ℃, 220 rpm / min for 1 h; centrifuge at 8000 rpm / min for 2 min; discard the supernatant, keep 80-100 μL of bacterial solution for resuspending, evenly spread on the plate containing ampicillin resistance, and invert and culture at 37 ℃ overnight; pick a single white colony in the transformation plate, shake and extract the plasmid, and send the plasmid for sequencing.

[0025] 7. After obtaining the overexpression Csdc2 gene plasmid, express it, the steps are as follows: ⑴ Before transfection, the cells were seeded in a 12-well plate. When the confluence reached 70%, the old culture medium was discarded and the cells were washed with PBS and replaced with fresh culture medium without double antibody.

[0026] ⑵ Add the overexpression plasmid to an appropriate amount of Opti-MEM medium and mix well. According to the instructions, add the transfection reagent to the diluted plasmid DNA and mix gently. Let it stand at room temperature for 15 min.

[0027] ⑶ Pipette 100 μL of transfection complex into each transfection well and evenly add it to the cells, and culture them in a 37°C, 5% CO2 incubator for 48 h.

[0028] 8. RT-qPCR detection of Csdc2 overexpression (1) RNA extraction was carried out according to the Triozol instructions provided by Quanshijin Company. The procedure is as follows: After washing the cells with PBS, add 500 μL Trizol to each well of the culture plate, pipette repeatedly, and place on ice for 5 minutes to fully lyse the cells. Transfer to a 1.5 mL enzyme-free centrifuge tube; add 200 μL chloroform, shake for 5 minutes, mix thoroughly, and centrifuge (4°C, 12000g, 15 minutes); the solution is divided into three layers, the upper colorless aqueous phase is RNA, carefully pipette the upper colorless liquid and transfer it to a new enzyme-free centrifuge tube; add 1 / 2 volume of isopropanol to the centrifuge tube, and turn the centrifuge tube upside down to mix thoroughly. The tube was allowed to stand at room temperature for 10 min, centrifuged (4°C, 12000 g, 10 min), and the supernatant was discarded. 75% ethanol prepared with DEPC water was added to the centrifuge tube, vortexed for 30 s, centrifuged (4°C, 7500 g, 5 min), and the supernatant was discarded. The tube was air-dried at room temperature for 5 min. 50 μL of DEPC water was added to dissolve the precipitate, and the tube was stored at -80°C for later use.

[0029] ⑵ Synthesis of genomic DNA and cDNA The removal of genomic DNA and cDNA synthesis were performed according to the instructions of the one-step reverse transcription kit of Quanshijin Company. The procedure is as follows: Table 7 Instructions for use of one-step reverse transcription kit

[0030] 42℃ 2 min; 85℃ 5 sec. After the reaction is completed, the cDNA is diluted 5 times with sterile deionized water and stored at -20℃.

[0031] (3) Real-time fluorescence quantitative PCR For each sample, set up 3 target genes and 3 reference genes in parallel. The reaction system is 20 μL, as follows: Table 8 Reagents required for real-time fluorescence quantitative PCR

[0032] Table 9 Real-time fluorescence quantitative PCR reaction procedure

[0033] Table 10 Primers used for real-time fluorescence quantitative PCR

[0034] In order to accurately quantify the expression differences of the genes to be tested in different samples, it is necessary to normalize the data to reduce errors, balance the experimental differences through the CT value of the internal reference gene with uniform expression in the organism, and obtain the △CT value. For the △CT of the gene to be tested in a sample, the calculation is as follows: △CT = CT value of target gene - CT value of reference gene For the difference in the expression of the same gene between the two samples in the control group, -△△CT The value is calculated as:

[0035] Glossary: CT: The number of cycles that the fluorescence signal in each reaction tube goes through when it reaches the set threshold △CT: sample CT value - internal reference CT value △△CT: sample △CT value - internal reference △CT value 2 -△△CT : 2 to the power of -△△CT index ⑷Table 11 Overexpression rate

[0036] Example 2: Construction of interference cell model Design and synthesis of siRNA interference fragments According to the complete sequence of CSDC2 gene, the target sequence was searched in the coding sequence (CDS) of CSDC2 gene. The online siRNA design software (WhiteHead) was used to make preliminary design and selection with reference to the design principles of small interfering RNA. The BLAST (Basic Local Alignment Search Tool) was compared with NCBI genebank to remove sequences with high homology to gene fragments of other species. The relevant literature principles were searched to design interference fragments with high success rate.

[0037] According to the above steps, the following three siRNA sequences were preliminarily designed: Table 12 siRNA sequences

[0038] The above three groups of DNA sequences were synthesized by the company in powder form and diluted to a concentration of 10 pmol / μL by adding appropriate amount of nuclease-free water.

[0039] Interference fragment transfection ⑴Planning Sheep dermal papilla cells were plated into 12-well plates. When the cells adhered to the wall and the confluence reached 70%, they were washed once with 1×PBS and replaced with fresh culture medium containing 10% fetal bovine serum.

[0040] ⑵Transfection Mixing of interference fragments and transfection reagent: prepare 4 ep tubes, add 100 μL Opti-MEM reduced serum medium to each, add 3 interference fragments and 1 negative control fragment respectively, the final concentration of each siRNA fragment is 100 pmol / well, then add 7.5 μL of transfection reagent EL to each tube (add 2.5 μL transfection reagent for every 100 pmol interference fragment), and let stand at room temperature for 15 minutes.

[0041] Transfection: Add the interference fragment transfection reagent mixture prepared in the previous step to the 12-well plate in step 1. Replace with fresh culture medium after 5 hours.

[0042] RT-qPCR was used to detect whether Csdc2 was inhibited in dermal papilla cells Table 13 Inhibition rate

Claims

1. A method for constructing a Csdc2 overexpression vector and an interference cell model, characterized in that: The nucleotide sequence of the goat Csdc2 gene coding region is: ATGACTTCGGAGCCTACGCCGCCCGCGGTCGTGCCCCCGCTGCACTCCCCCAAGTCCCCTGTCTGGCCCACCTTTCCCTTCCACAGGGAGGGCAGCAGGGTCTGGGAGCGAGGCAGTGTCTCATCTCGGGACCTGCCCAGTCCCCTGCCCACCAAACGGACCAGGACGTATTCAGCGACAGCCCGTGCCTCGGCTGGCCCCGTGTTCAAGGGCGTCTGTAAGCAGTTCTCA CGCTCACAGGGCCACGGCTTCATCACCCCCGAGAACGGGTCGGAGGACATCTTCGTGCACGTGTCTGACATCGAGGGGGAGTACGTGCCGGTGGAAGGCGACGAGGTGACCTACAAGGTGTGCCCGATCCCGCCCAAGAACCAGAAGTTCCAAGCTGTGGAGGTGGTGCTCACCCAGCTGGCCCCACACACTCCCCACGAGACGTGGTCCGGCCAGGTTGTGGGCTCCTAG.

2. The siRNA for inhibiting goat Csdc2 gene expression according to claim 1, characterized in that: The siRNA is: si-Csdc2-01 AGAACUGCUUACAGACGCCTT si-Csdc2-02 AUGUCAGACACGUGCACGATT si-Csdc2-03AACUUCUGGUUCUUGGGCGTT.

3. According to claim 2, the small interfering fragment sequence is further selected as: si-Csdc2-02:AUGUCAGACACGUGCACGATT.

4. The Csdc2 overexpression vector according to claim 1, characterized in that The goat Csdc2 gene overexpression recombinant vector adopts pcDNA3.1(+) recombinant vector.

5. A method for constructing the goat Csdc2 gene overexpression plasmid according to claim 3, characterized in that: The construction method includes the following steps: (1) PCR amplification of the CDS sequence fragment of the goat-derived Csdc2 gene; (2) double-digesting the obtained gene fragment and expression vector, and ligating them; (3) The ligation product is transformed into Escherichia coli, and positive clones are selected for culture, and then the plasmid is extracted.

6. The method for constructing a goat Csdc2 gene overexpression plasmid according to claim 4, characterized in that: The upstream and downstream primer sequences required for PCR amplification of the CDS sequence fragment in step 1 are as follows: Upstream primer: Forword: 5'-CGGAATTCATGACTTCGGAGCCTCAG-3' Downstream primer: Reverse: 5'-GCTCTAGACTAGGAGCCCACAACCTG-3'.

7. The method for constructing a goat Csdc2 gene overexpression plasmid according to claim 4, characterized in that: The restriction endonucleases used for digestion in step 2 are EcoR and Xba.

8. A host cell comprising the interference fragment and the overexpression vector according to any one of claims 2 to 7, characterized in that: The cells are cashmere goat dermal papilla cells.

9. Use of the interference fragment and overexpression vector according to any one of claims 2 to 7 in the preparation of a reagent for interfering with or overexpressing goat Csdc2 gene.

Images