Tobacco AP2 transcription factor TOE3 and application thereof

Abstract

The invention discloses a tobacco AP2 transcription factor TOE3 and application thereof, and relates to the technical field of plant genetic engineering, and the technical key points are as follows: the tobacco AP2 transcription factor TOE3 is a gene TOE3, the gene TOE3 is from common tobacco NC89, and the nucleotide sequence of the gene TOE3 is as shown in SEQ ID NO: 1; the amino acid sequence of the protein TOE3 coded by the gene TOE3 is shown in SEQ ID NO: 2. The gene TOE3 participates in regulating and controlling the transcription of an antiviral related gene NtMLP43, and the expression of the antiviral related gene NtMLP43 is improved, so that the gene TOE3 is applied to tobacco resistance to tobacco mosaic virus (TMV), cucumber mosaic virus (CMV) and pepper vein mottle virus (ChiVMV). The invention overcomes the problems in the prior art that chemical pesticides are high in prevention and control toxicity, easy to remain and pollute the environment, harmful to human and livestock, and capable of generating drug resistance to plants when being continuously used, and the scheme of the invention is applied to tobacco virus prevention and control, and has important significance on sustainable development and environmental safety.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to a tobacco AP2 transcription factor TOE3 and an application thereof. Background Art

[0002] Tobacco mosaic virus (TMV) is a single-stranded, positive-sense RNA virus with many hosts and wide distribution. It is one of the most economically important plant viruses. In tobacco-growing areas, tobacco or other Solanaceae plants will be infected and damaged by the virus. After TMV infects plants, it will multiply rapidly and reach any part other than the growing point, resulting in phenotypes such as yellowing leaves and abnormal leaf growth. The infected leaves are mottled and stained, and the leaves of the plant system show typical mosaic symptoms. The large-scale occurrence of TMV disease will seriously affect the yield and variety of cash crops, causing huge economic losses.

[0003] Cucumber mosaic virus (CMV) belongs to the Bromoviridae family and the Cucumovirus genus, and is recognized as one of the important plant viruses in the world. Current research shows that CMV can infect not only Cucurbitaceae plants, but also more than 1,200 monocotyledonous or dicotyledonous plants such as Brassicaceae, Solanaceae, and Leguminosae. Infected plants generally show symptoms such as chlorosis, yellowing, shrinkage, and deformity, which seriously affects the growth and development of crops and causes huge losses to crop production. Therefore, CMV is listed as one of the 10 most destructive agricultural viruses.

[0004] Chilli veinal mottle virus (ChiVMV) is a potato Y virus that seriously harms Solanaceae crops such as tobacco, pepper, and tomato. After infecting the plants, it produces symptoms such as necrotic spots and chlorotic mottles, causing serious losses to the quality and yield of cash crops and operators, and seriously threatening the development of the agricultural economy.

[0005] Therefore, studying the broad-spectrum disease resistance of TOE3 against TMV, CMV and ChiVMV, revealing plant defense responses and disease resistance strategies, and providing scientific support for the sustainable development of agriculture are of great practical significance and value.

[0006] At present, the existing technology uses chemical pesticides for prevention and control, which are highly toxic, easy to pollute the environment, and harmful to humans and animals. Continuous use will also cause plants to develop resistance. Therefore, clarifying the mechanism of tobacco antiviral resistance and cloning related disease resistance genes are increasingly used in virus prevention and control, which is of great significance to the sustainable development of the tobacco industry and environmental safety.

[0007] To this end, the present invention aims to provide an AP2 transcription factor TOE3 and its application to solve the problems in the prior art that chemical pesticides are highly toxic to TMV, CMV and ChiVMV, easily pollute the environment with residues, are harmful to humans and animals, and continuous use may cause plants to develop drug resistance. Summary of the invention

[0008] The purpose of the present invention is to solve the above problems and provide a tobacco AP2 transcription factor TOE3 and its application.

[0009] In order to achieve the above object, the technical solution of the present invention is as follows:

[0010] The present invention provides a tobacco AP2 transcription factor TOE3, wherein the AP2 transcription factor TOE3 is a gene TOE3, and the gene TOE3 is from common tobacco NC89, and its nucleotide sequence is shown in SEQ ID NO: 1; the amino acid sequence of the protein TOE3 encoded by the gene TOE3 is shown in SEQ ID NO: 2.

[0011] The present invention also provides an application of tobacco AP2 transcription factor TOE3, wherein the gene TOE3 regulates the antiviral-related gene NtMLP43 and enhances the expression of the antiviral-related gene NtMLP43.

[0012] Furthermore, the method in which the gene TOE3 regulates the expression of the antiviral-related gene NtMLP43 is:

[0013] An overexpression vector of TOE3 was constructed, and the full-length TOE3 gene was positively inserted between the restriction sites BamHI and KpnI of the PCM1307 vector. The obtained overexpression vector of the gene was introduced into common tobacco NC89.

[0014] Furthermore, the TOE3 overexpression vector is used in tobacco resistance to TMV.

[0015] Compared with the prior art, this solution has the following beneficial effects:

[0016] 1. The scheme of the present invention clones a regulatory factor TOE3 of tobacco disease resistance gene NtMLP43 from common tobacco NC89, which can enhance the expression of NtMLP43, and the encoded protein is TOE3. TOE3 can be used for genetic engineering disease resistance, and its nucleotide sequence is inserted into the overexpression vector PCM1307, and the overexpression vector of the gene is introduced into common tobacco NC89, which can improve the resistance of common tobacco NC89 to TMV, CMV and ChiVMV.

[0017] 2. The present invention overcomes the problems in the prior art of using chemical pesticides for prevention and control, which are highly toxic, easily leave residues to pollute the environment, are harmful to humans and animals, and continuous use may cause plants to develop drug resistance. The application of the present invention to tobacco virus prevention and control is of great significance to sustainable development and environmental safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is the real-time fluorescence quantitative qRT-PCR analysis of TOE3 in various tobacco tissues in the embodiment of the present invention (X-axis: root, stem, lower leaf and upper leaf represent different tissues of tobacco, namely root, stem, lower leaf and upper leaf; Y-axis: expression multiple of TOE3 in different tobacco tissues);

[0019] Figure 2 This is a construction map of the TOE3 overexpression vector in an embodiment of the present invention;

[0020] Figure 3 This is a diagram for identifying positive transgenic plants of the T0 generation transformed with the PCM1307-TOE3 overexpression vector in the embodiment of the present invention.

[0021] Figure 4 The positive transgenic plants of the T1 generation of common tobacco NC89 transformed with the PCM1307-TOE3 overexpression vector in the embodiment of the present invention were inoculated with TMV, wherein (a) is the phenotype after inoculation, and (b) is the detection of virus accumulation;

[0022] Figure 5 The positive transgenic plants of the T1 generation of common tobacco NC89 transformed with the PCM1307-TOE3 overexpression vector in the embodiment of the present invention were inoculated with CMV, wherein (a) is the phenotype after inoculation, and (b) is the detection of virus accumulation;

[0023] Figure 6 The T1 positive transgenic plants of common tobacco NC89 transformed with the PCM1307-TOE3 overexpression vector in the embodiment of the present invention were inoculated with ChiVMV, wherein (a) is the phenotype after inoculation, and (b) is the detection of virus accumulation. DETAILED DESCRIPTION

[0024] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments of the present invention and the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0025] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present invention can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0026] Example:

[0027] The inventors of the present application used common tobacco (Nicotiana tabacum cv. NC89) at an optical density of 60 μM m -2 s -1 , the photoperiod was 12 hours of light / 12 hours of darkness, and the growth temperature was 24°C. In the study, the inventors of the present application found that the AP2 transcription factor TOE3 is expressed in all parts of the plant tissues, among which the highest expression level is in the upper leaves. Through the dual luciferase complementation experiment, it was found that the AP2 transcription factor TOE3 and its regulatory factor MLP43 interacted with each other, which enhanced the expression of MLP43. Using Agrobacterium-mediated genetic transformation technology, the overexpression vector PCM1307-TOE3 was transformed into common tobacco NC89 to obtain transgenic overexpression TOE3 positive plants. The results of molecular identification and resistance identification showed that the ability of plants overexpressing TOE3 to resist TMV, CMV and ChiVMV was enhanced, indicating that the gene plays a positive regulatory role in the process of tobacco resistance to TMV, CMV and ChiVMV. The present invention will be described in detail below in conjunction with the embodiments.

[0028] Example 1: Cloning of the TOE3 gene

[0029] Total RNA from the leaves of the samples was extracted using TRIZOL (Invitrogen). Ⅲ1st Strand cDNA Synthesis SuperMix for qPCR (YEASEN) synthesized the first strand of reverse transcription to obtain the cDNA of the sample. A 1518bp nucleotide sequence was blasted through the NCBI website, encoding 515 amino acids. The gene was named TOE3. Specific primers were designed according to the nucleotide sequence:

[0030] F1(ATGGAGTGTAGAGAAATGTG) and

[0031] R1(CTAGTCTATCTGCTGGGGGA);

[0032] Obtain the TOE3 fragment.

[0033] Example 2: Tissue-specific expression characteristics of TOE3

[0034] Sow the seeds of common tobacco in nutrient soil for germination, and transplant the seedlings into flower pots after they turn white. When the common tobacco is cultured to 5 weeks old, select seedlings of uniform size and growth. Take the root, stem, lower leaf and upper leaf tissues respectively, and store the samples in a -80℃ refrigerator for future use. Extract the total RNA of the sample leaves, and reverse transcribe to obtain the cDNA of the sample.

[0035] The F2 primer (AGGTCTAGGAGCTCACAGTA) and R2 primer (AGCACATGCACAAATTCTTC) that can specifically amplify TOE3 were used to perform qRT-PCR analysis of this gene in tobacco tissue samples. The qRT-PCR reaction was amplified on a Q-PCR instrument. The 20 μL reaction system contained 2 μL cDNA and 10 μL Hieff Universal BlueqPCR SYBR Green Master Mix (YEASEN), 0.5 μL primer F1 and 0.5 μL primer R1. Amplification parameters were: 95°C for 2 minutes, then 95°C for 10 seconds, 60°C for 30 seconds, and 40 cycles. After the reaction, the relative expression was calculated: the relative expression of the target gene at different time points after TMV infection relative to the negative control group was calculated based on the obtained Cq value, i.e., 2 -CT CT = (CT.Target-CT.Tublin)-(CT.Target-CT.Tublin). The results showed that among all tobacco tissues, TOE3 was expressed at the highest level in the lower leaves.

[0036] Example 3: Construction of TOE3 overexpression vector

[0037] Using the above-mentioned TOE3 cDNA as a template, PCR amplification was performed with primers F1 and R1 that can specifically amplify the TOE3 gene fragment, and the amplified fragment was recovered. The amplified target fragment was inserted into the multiple cloning sites BamHI and KpnI behind the promoter of the vector PCM1307 using BamHI and KpnI double restriction enzymes. Thus, the overexpression vector PCM1307-TOE3 of the TOE3 gene was obtained.

[0038] Example 4: Leaf disc method-mediated transformation of TOE3 overexpression stable genetic material

[0039] Take 100μL of Agrobacterium GV3101 competent cells and melt them on ice, then add 5μL of the ligation product, mix gently, and let it stand on ice for 25 minutes; then quickly freeze the mixed liquid in liquid nitrogen for 5 minutes, and quickly transfer it to a 37℃ water bath for heat shock for 5 minutes; then let it stand on ice for 5 minutes; add 500mL of LB culture medium without antibiotics to the centrifuge tube, and revive it at 28℃ for 2 hours; after the revival is completed, enrich the bacteria at 5000rpm, and take a suitable volume of the revival liquid and evenly apply it to the culture medium containing the corresponding antibiotics with sterilized beads, and invert and culture it in a 28℃ incubator overnight. Pick the positive Agrobacterium strain into the LB culture medium containing the corresponding antibiotics, and culture it at 28℃ for about 12 hours; after the bacterial liquid grows up, take 100μL of the mother liquid and inoculate it into 5mL of LB culture medium containing the corresponding antibiotics, and shake and culture it at 28℃ for about 10 hours; when the bacterial liquid OD 600nm When the density reaches 0.8, centrifuge at 5000 rpm for 3 minutes and resuspend the bacteria with infection buffer; after the prepared infection solution is allowed to stand at room temperature for 3-4 hours, infect with Agrobacterium containing the PCM1307-TOE3 vector.

[0040] Co-cultivation: Take the sterile tobacco seedlings, cut off the leaves, and temporarily store them in water. After PCM1307-TOE3 positive Agrobacterium liquid is enriched, it is resuspended in MS liquid medium (MS salt 1.89g; sucrose 8g; H2O is fixed to 400mL and pH is adjusted to 5.8 with NaOH). Cut the leaves into small pieces and infect them in the resuspended leaves for 5-10 minutes. Filter paper is used to absorb the excess bacterial liquid on the surface, and the co-cultivation medium (MS salt 1.89g; sucrose 8g; H2O is fixed to 400mL and pH is adjusted to 5.8 with NaOH, and agar powder 3g; 6-BA 0.8mg; NAA 0.4mg) is added for dark cultivation for 48h.

[0041] Differentiation screening: The leaves in the co-culture were transferred to differentiation screening medium (MS salt 1.89 g; sucrose 8 g; H2O was fixed to 400 mL and then the pH was adjusted to 5.8 with NaOH, and agar powder 3 g; 6-BA 0.6 mg; NAA 0.1 mg) was added. After three weeks, buds were differentiated at the edge of the leaf disc, and a complete single bud was separated from it with tweezers.

[0042] Elongation and rooting: The separated buds were transferred to elongation medium (MS salt 1.89 g; sucrose 8 g; H2O was made up to 400 ml, then the pH was adjusted to 5.8 with NaOH, and agar powder 3 g; 6-BA 0.04 mg; NAA 0.1 mg was added). Rooted seedlings appeared in three to four weeks. When the root system of the plant was strong, the lid of the tissue culture bottle could be opened to harden the seedlings for 1-2 days. Finally, the culture medium residue attached to the roots was washed off and the seedlings were transferred to the soil to obtain 10 transgenic materials.

[0043] Identification: Extract the total protein of all transgenic materials and identify the expression level of TOE3. Take the fresh leaf tissue in Example 3 and place it in a fully pre-cooled mortar and grind it until the tissue sample turns white; accurately weigh 0.1g of the ground sample and transfer it to a 2mL centrifuge tube, add an appropriate amount of 2× protein extraction buffer, and then mix it thoroughly on a vortex shaker; then place the sample in a constant temperature water bath at 90°C for 10-15 minutes to fully denature the protein; place the denatured protein sample in a centrifuge and centrifuge at 8000rpm for 10 minutes, carefully aspirate the supernatant and transfer it to a new 1.5mL centrifuge tube, quickly freeze it with liquid nitrogen and store it at -20°C for later use;

[0044] Prepare 12% separation gel and 5% stacking gel; 12% SDS-PAGE separation gel (H2O 9.2mL; 30% polyacrylamide 5.4mL; 1.5M Tis-HCl (pH=8.8) 5mL; 10% SDS 100μL; 10% APS 100μL; TEMED 10μL); 5% SDS-PAGE stacking gel (H2O 4mL; 30% polyacrylamide 1.67mL; 0.5M Tis-HCl (pH=6.8) 622.5μL; 10% SDS 25μL; 10% APS 17μL; TEMED 6μL). After the SDS-PAGE gel is completely solidified, the comb can be carefully pulled out under the water flow, and then the gel plate is placed in the electrophoresis tank, an appropriate amount of electrophoresis buffer is added, and the samples are added to the gel wells in sequence; the protein sample is electrophoresed at 120V for about 1-2 hours until the bromophenol blue indicator is electrophoresed to the bottom of the separation gel; then the glass plate is taken out and carefully pried open to remove the concentrated gel, and the separation gel is placed on the filter paper in the transfer clamp (note that the gel is fragile and needs to be operated with care); cut a piece of PVDF membrane of the same size as the separation gel and soak it in methanol; place the membrane soaked in methanol on the separation gel and cover it with another layer of filter paper; place the assembled transfer clamp in the electrophoresis tank and perform electrophoresis according to the principle of "negative gel and positive membrane"; the electrophoresis time is about 80V for 2 hours, and the transfer process should be performed on ice; place the PVDF membrane in 25mL of blocking solution (NO-fat Milk 2.5g; TBST 50mL) and blocked on a shaker for about 2 hours. After blocking, the membrane was placed in the primary antibody diluent and hybridized at room temperature for 2 hours. After the primary antibody was bound, the membrane was washed with TBST (1MTris-HCl (pH=8.0) 20mL; NaCl 8.8g; Tween-20 1mL; H2O to 1L) eluent for 4 times, 5 minutes each time. The washed PVDF membrane was placed in the secondary antibody diluent and hybridized at room temperature for 1-2 hours. After the secondary antibody was bound, the membrane was washed again with TBST eluent for 4 times, 5 minutes each time. Pierce TMMix ECL chemiluminescent solution A and solution B in a ratio of 1:1; apply the developer solution evenly on the membrane, and place the membrane on a gel imaging system for exposure; save the development results and analyze the experiment.

[0045] Example 5: Verification of gene function of TOE3

[0046] Three positive plants were selected according to the results of Western blot, and the strain numbers were: WT, TOE3-OE#4 and TOE3-OE#5. WT, TOE3-OE#4 and TOE3-OE#5 were sown respectively. The results showed that WT material first showed yellowing symptoms on the 28th day after inoculation with TMV, while TOE3-OE#4 and TOE3-OE#5 had weaker yellowing symptoms, indicating that TOE3-OE plants have stronger antiviral ability and can recover faster from TMV infection. The total protein in the plants was extracted and the content of TMV in the leaves was detected. The results showed that the TMV content in TOE3-OE#4 and TOE3-OE#5 was lower than that in WT.

[0047] On the 7th day after CMV inoculation, the WT material was observed to be the first to show mosaic symptoms, while TOE3-OE#4 and TOE3-OE#5 were basically asymptomatic. On the 28th day after CMV inoculation, a large number of green island tissues were observed in the TOE3-OE#4 and TOE3-OE#5 transgenic materials, while the WT material had more yellow tissues, indicating that TOE3-OE plants have stronger antiviral ability and are less affected during CMV infection. The total protein in the plants was extracted and the CMV content in the leaves was detected. The results showed that the CMV content in TOE3-OE#4 and TOE3-OE#5 was lower than that in WT.

[0048] On the 7th day after ChiVMV inoculation, WT material was observed to be the first to show necrotic spots, while TOE3-OE#4 and TOE3-OE#5 had no obvious symptoms, and on the 28th day after ChiVMV inoculation, WT material showed obvious yellowing symptoms, indicating that TOE3-OE plants have stronger antiviral ability and are less affected during ChiVMV infection. The total protein in the plants was extracted and the content of ChiVMV in the leaves was detected. The results showed that the ChiVMV content in TOE3-OE#4 and TOE3-OE#5 was lower than that in WT.

[0049] In summary, through the above embodiments of the present invention, the present invention cloned a regulatory factor TOE3 of the tobacco disease resistance gene NtMLP43 from common tobacco NC89, which can interact with NtMLP43, and the encoded protein is TOE3. TOE3 can be used for genetic engineering disease resistance, and its nucleotide sequence is inserted into the overexpression vector PCM1307, and the overexpression vector of the gene is introduced into common tobacco NC89, which can improve the resistance of common tobacco NC89 to TMV, CMV and ChiVMV. The scheme of the present invention overcomes the problems in the prior art that chemical pesticides are used for prevention and control, which are highly toxic, easy to pollute the environment, and harmful to humans and animals, and continuous use will also cause plants to develop drug resistance. It can be applied to the field of tobacco virus prevention and control, and is of great significance for sustainable development and environmental safety.

[0050] The above specific embodiments are merely explanations of the present invention and are not limitations of the present invention. After reading this specification, those skilled in the art may make modifications to the embodiments without any creative contribution as needed. However, such modifications are protected by the patent law as long as they are within the scope of the claims of the present invention.

Claims

1. A tobacco AP2 transcription factor TOE3, Its characteristics are: The tobacco AP2 transcription factor TOE3 is gene TOE3, which is from Nicotiana tabacum cv.NC89, and its nucleotide sequence is shown in SEQ ID NO: 1; the amino acid sequence of protein TOE3 encoded by gene TOE3 is shown in SEQ ID NO:

2.

2. The tobacco AP2 transcription factor TOE3 as claimed in claim 1 is a use of gene TOE3, Its characteristics are: The gene TOE3 regulates the antiviral-related gene NtMLP43, and regulates the expression of the antiviral-related gene NtMLP43.

3. The use of a tobacco AP2 transcription factor TOE3 as claimed in claim 2, Its characteristics are: The method by which the gene TOE3 regulates the expression of the antiviral-related gene NtMLP43 is: An overexpression vector of TOE3 was constructed, and the full-length TOE3 gene was positively inserted between the restriction sites BamHI and KpnI of the PCM1307 vector, and the overexpression vector of the gene was introduced into common tobacco NC89.

4. The use of a tobacco AP2 transcription factor TOE3 as claimed in claim 3, Its characteristics are: The application of the TOE3 overexpression vector in tobacco broad-spectrum antiviral therapy.

Images