Meiosis-related gene CrMER3 and application thereof in seedless breeding of citrus

Abstract

The invention discloses a meiosis related gene CrMER3 and application thereof in seedless breeding of citrus, and belongs to the field of citrus biotechnology and genetic breeding. The CrMER3 gene has three genotypes of CrMER3A, CrMER3a and CrMER3A-103bp, and a complete nucleotide sequence and a nucleotide sequence of a coding region of the CrMER3 gene are respectively as shown in SEQ ID NO: 1-6. CrMER3a mostly exists in existing citrus varieties and can be widely applied to seedless breeding of citrus. The KASP molecular marker is used for identifying whether a citrus variety carries a citrus seedless gene CrMER3a or not, the 2295th basic group corresponding to the CrMER3 gene is C / T in the citrus variety carrying / not carrying the CrMER3a gene, and the molecular marker or an amplification primer thereof can be used for citrus seedless molecular marker-assisted selective breeding.

Description

Technical Field

[0001] The invention belongs to the field of citrus biotechnology and genetic breeding, and specifically relates to a meiosis-related gene CrMER3 and an application thereof in citrus seedless breeding. Background Art

[0002] Citrus originated in China and is the world's largest fruit. It is also the most important fruit tree in southern my country, with extremely high economic and nutritional value. Seedlessness is an important indicator in the evaluation of citrus fruit quality. It is favored by consumers and has great commercial value in the market. Therefore, it is one of the important goals of citrus breeding. At present, seedless citrus varieties in my country mainly come from bud mutation selection and hybrid breeding. Bud mutation selection relies on natural mutation, with random direction and low probability; a small part comes from hybrid breeding, using the cytoplasmic male sterility of Wenzhou mandarin to cultivate seedless varieties, but due to the relatively narrow genetic background of the parents, high-generation varieties show shortcomings such as weak fragrance, weak resistance, and easy premature aging. Citrus has the characteristics of long juvenile period, polyembryony, and complex genetic background, making it very difficult to cultivate seedless varieties with good quality through traditional hybrid breeding methods. At present, genes that can be used for seedless breeding of citrus have not been reported. Discovering seedless-related genes in citrus resources and using them for hybrid breeding is of great significance to improve the efficiency of citrus seedless breeding, broaden the genetic background of hybrid breeding parents, and enrich the diversity of citrus varieties.

[0003] The main reasons for seedless citrus are male sterility, embryo sac abortion, self-incompatibility, etc. At the same time, the parthenocarpy ability of most citrus varieties is the basis for producing seedless citrus fruits. Meiotic gene abnormalities lead to meiotic disorders of both male and female organs, which in turn can lead to abortion of male and female organs. That is, seedless citrus fruits can be obtained without isolation planting, which is an ideal seedless type. 'Qianyang Seedless' ponkan is a seedless bud mutation variety selected from ordinary ponkan. It has vigorous tree vigor, early fruiting and high yield, and both males and females are sterile. It is the first completely seedless ponkan variety in China. Natural seedless bud mutation varieties are valuable resources for studying the mechanism of seedless citrus, and are crucial to the study of citrus seedless functional genomics and seedless breeding. KASP (Kompetitive AlleleSpecific PCR) technology has the characteristics of high throughput, low cost, high accuracy, simplicity and speed. It can accurately perform double allele typing of target SNPs and InDels, and plays an increasingly important role in citrus molecular marker-assisted breeding. Summary of the invention

[0004] In view of the current problems of the lack of molecular markers available for seedless breeding and research on the mechanism of citrus seedlessness, the present invention provides a meiosis-related gene CrMER3 and its application in seedless breeding of citrus. The present invention discovered the seedless variation site of the 'Qianyang Seedless' mandarin orange through cytological observation and genome sequencing. There are two common alleles (CrMER3A and CrMER3a) in the citrus CrMER3 gene. Compared with CrMER3A, CrMER3a terminates prematurely due to the deletion of a single base T in the coding region, producing a truncated protein. The 103bp deletion in the CrMER3A gene segment of the 'Qianyang Seedless' mandarin orange causes changes in its transcription product, which in turn causes the premature termination of protein coding, and it is named CrMER3A. -103bp Two alleles of CrMER3 in 'Qianyang Seedless' ponkan: CrMER3a and CrMER3A -103bp All of them cannot encode functional CrMER3 protein, resulting in meiotic disorder and abortion of both male and female organs, which is the reason why the 'Qianyang Seedless' mandarin orange is seedless. -103bp It is a mutant gene unique to the 'Qianyang Seedless' mandarin orange, and CrMER3a exists in many existing citrus varieties and can be widely used in citrus seedless breeding.

[0005] One of the purposes of the present invention is to provide a citrus seedless-related CrMER3 gene and its application. The CrMER3 gene can be used as a candidate gene for improving citrus seedless varieties.

[0006] The second purpose of the present invention is to provide a KASP molecular marker for identifying whether a citrus variety carries the seedless gene CrMER3a and its application, which can provide useful information for the selection of genotypes of hybrid parents in citrus seedless breeding, and provide a simple, fast and effective auxiliary method for early diagnosis of offspring fertility, thereby improving the efficiency of genetic improvement of seedless citrus.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] A CrMER3 gene related to seedlessness in citrus, CrMER3A, CrMER3a, and CrMER3A in citrus -103bp 3 genotypes, CrMER3A, CrMER3a, CrMER3A -103bp The complete nucleotide sequences are shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively.

[0009] The nucleotide sequences of the coding regions of the above three citrus seedless-related CrMER3 genes are shown in SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6, respectively.

[0010] The application of the citrus seedless-related CrMER3 gene in citrus seedless breeding. For example, the citrus seedless-related CrMER3 gene can be precisely and directionally edited using CRISPR / Cas9 gene editing technology without changing the genetic background of the citrus variety, so that the CrMER3 protein loses its function, so as to achieve the purpose of quickly improving seedless citrus; or by hybridizing CrMER3A / CrMER3a genotype varieties to obtain CrMER3a / CrMER3a homozygous citrus plants, create new seedless citrus germplasm.

[0011] A KASP molecular marker KASP-CrMER3 for identifying whether a citrus variety carries the seedless gene CrMER3a. The molecular marker corresponds to the 2295th base of the CrMER3 gene on chromosome 2 of the ponkan genome. In citrus varieties carrying the CrMER3a gene, the 2295th base of the CrMER3 gene is C, and in citrus varieties not carrying the CrMER3a gene, the 2295th base of the CrMER3 gene is T.

[0012] A KASP-CrMER3 primer for amplifying the above molecular marker.

[0013] The KASP-CrMER3 primers include a CrMER3A allele upstream primer KASP-CrMER3-F, a CrMER3a allele upstream primer KASP-CrMER3-H, and a common downstream primer KASP-CrMER3-C;

[0014] The nucleotide sequence of the CrMER3A allele upstream primer KASP-CrMER3-F is preferably: 5'-gaaggtgaccaagttcatgctGCTATGCCCCAGCAAAAAATGATTTT-3' (SEQ ID NO: 7, the lowercase letter part is the specific fluorescent label sequence FAM);

[0015] The nucleotide sequence of the CrMER3a allele upstream primer KASP-CrMER3-H is preferably: 5'-gaaggtcggagtcaacggattGCTATGCCCCAGCAAAAAATGATTTC-3' (SEQ ID NO: 8, the lowercase letter part is the specific fluorescent label sequence HEX);

[0016] The nucleotide sequence of the common downstream primer KASP-CrMER3-C is: 5'-AGAATCAAGAGCTTGCCTTTTCAAAT-3' (SEQ ID NO: 9).

[0017] An application of the KASP-CrMER3 molecular marker or its amplification primer in citrus seedless molecular marker-assisted selection breeding.

[0018] A method for identifying whether a citrus variety carries the seedless gene CrMER3a, comprising the following steps: extracting whole genome DNA of a tissue of a to-be-tested citrus variety, performing PCR amplification on the whole genome DNA of a to-be-tested sample using primers for amplifying the KASP-CrMER3 molecular marker, performing fluorescent signal reading on the PCR amplification product, and obtaining a typing result of the to-be-tested sample.

[0019] The beneficial effects of the present invention are as follows: through the study of the completely seedless citrus natural mutant 'Qianyang Seedless' ponkan, the present invention cloned the first meiosis-related gene CrMER3 of citrus, the 'Qianyang Seedless' ponkan has normal vegetative growth, both male and female organs are sterile, and the fruit is completely seedless. The present invention provides the application of CrMER3 in seedless citrus breeding, develops the KASP molecular marker KASP-CrMER3 for identifying whether citrus varieties carry the seedless gene CrMER3a, realizes rapid, high-throughput, and accurate tracking of the CrMER3a gene, and accelerates the efficient use of the CrMER3a gene in molecular marker-assisted selection breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The male fertility observation of 'Qianyang Seedless' ponkan (QS) and common ponkan (WT) in Example 1. Figures A and D are blooming flowers, scale bar = 1 mm. Figures B and E are I2-KI mature pollen staining, scale bar = 100 μm. Figures C and F are paraffin sections of mature anthers, aPG, aborted pollen grains; E, epidermis; En, inner wall of anther chamber; Fb, fibrous tissue; PG, pollen grains; St, cleft area; scale bar = 50 μm. Figures G, H, I, and J are tetrad pressed slices, scale bar = 10 μm.

[0021] Figure 2 The results of comparative genome analysis and variation identification in Example 2. Figure A is a schematic diagram of the 103 bp deletion of the CrMER3 gene identified in the 'Qianyang Seedless' mandarin orange. Figure B is the variation verification result by agarose gel electrophoresis.

[0022] Figure 3 Schematic diagram of the CrMER3 gene structure of 'Qianyang Seedless' ponkan and common ponkan in Example 2, wherein the grey squares represent gene exons and the grey lines represent gene introns.

[0023] Figure 4 The genotyping results of citrus varieties with known genotypes using the developed KASP markers in Example 3 are shown in the figure. The right side shows the Sanger sequencing peak graph corresponding to the genotyping results. NTC: blank control without template.

[0024] Figure 5 This is the result of typing 83 samples of citrus natural population in Example 4 using the KASP molecular marker KASP-CrMER3 provided by the present invention.

[0025] Figure 6 This is the citrus model material obtained by CRISPR / Cas9 gene editing technology in Example 5 - the CrMER3 gene knockout line of Citrus fortunei and its phenotypic identification. Figures A and E are mature flower buds, scale bar = 1 mm; Figures B and F are I2-KI mature pollen staining, scale bar = 100 μm; Figures C and G are mature anther paraffin sections, scale bar = 40 μm; Figures D and H are tetrad pressed sections, scale bar = 10 μm; DETAILED DESCRIPTION

[0026] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand. The specific embodiments described herein are only used to explain the present invention, but not to limit the present invention.

[0027] Example 1: Observation on male fertility of 'Qianyang Seedless' ponkan

[0028] The 'Qianyang Seedless' mandarin orange is a seedless variety produced by the bud mutation of the ordinary seeded mandarin orange. Its vegetative growth is no different from that of the seeded mandarin orange, but both males and females are sterile. Its male fertility was comprehensively observed and compared with that of the seeded mandarin orange. The method is as follows:

[0029] 1) Pollen vitality observation:

[0030] Use I2-KI dye to stain the pollen for observation. Take 2-3 mature anthers on a glass slide, drop 1-2 drops of 1% I2-KI solution, crush the anthers with tweezers to release the pollen grains, remove the residue, cover with a cover glass, press lightly and let stand for 2 minutes, observe and take pictures under a universal microscope (Olympus BX61). Fertile pollen is dark blue, and sterile pollen is not colored.

[0031] 2) Observation of anther paraffin sections:

[0032] Flower buds at different developmental stages were collected and placed in FAA fixative (50% ethanol, 5% glacial acetic acid, 10% formaldehyde, v / v) and fixed at room temperature for 24 h. They were then dehydrated in 70%, 85%, 95% and 100% (v / v) ethanol, followed by gradient xylene infiltration and embedding in paraffin. The sections were cut into 6 μm thick sections using a microtome, stained with 0.25% (w / v) toluidine blue dye, and photographed using a microscope (Olympus BX61).

[0033] 3) Meiotic tetrad observation:

[0034] Collect fresh flower bud samples at the meiotic stage with sepal height approximately in the middle of the petals, fix them in Carnoy's fixative (ethanol: acetic acid = 3:1) for 24 h, and store them in 70% ethanol at 4°C. Take the above fixed flower buds, remove the anthers, wash them in distilled water for 3-5 times, take 2-3 anthers and place them on a slide, add a drop of Carbofuchsin dye, squeeze out the tetrads from the anthers, remove the large tissue fragments, cover with a coverslip, and observe and photograph them using a microscope (Olympus BX61).

[0035] like Figure 1 As shown in the figure, compared with the common seeded ponkan (WT), the mature pollen of 'Qianyang Seedless' ponkan (QS) was inactive, the meiotic process was defective, and a large number of abnormal tetrads were produced. This indicates that the cause of QS seedlessness is the abnormal meiotic process that leads to male and female sterility.

[0036] Example 2: Analysis of the reasons why 'Qianyang Seedless' ponkan is seedless

[0037] The present invention clones genes based on genome analysis and meiotic cytological phenotypes and through PCR specific amplification verification method, and locks in the reason that the seedless 'Qianyang seedless' mandarin orange is due to the mutation of the CrMER3 gene. Specifically, universal primers are designed for verification based on the DNA and cDNA sequences of CrMER3 predicted from the assembled genomes of common seeded mandarin oranges and 'Qianyang seedless' mandarin oranges. The primer sequences are as follows:

[0038] CrMER3 forward primer (CrMER3-F): 5′-ATGATGGATTCATACGCACTGAAATCTG-3′;

[0039] CrMER3 reverse primer (CrMER3-R): 5'-TTAGAGAAACGAAAAAACACTCTCAAACCC-3'.

[0040] The Illumina data of EG and QS were aligned to the EG genome using BWA-MEM software. SNPs and Indels were identified using GATK software. The PacBio data of EG and QS were aligned to the EG genome using minimap2 software, and structural variations (SVs) were identified using Sniffles. The results showed that there was a 103 bp deletion in the CrMER3 gene in the 'Qianyang Seedless' mandarin orange. Figure 2 shown.

[0041] The PCR products were amplified using the leaf DNA of 'Qianyang seedless' ponkan and common seeded ponkan as templates. The two CrMER3 alleles in common seeded ponkan were CrMER3A and CrMER3a, while the two CrMER3 alleles in 'Qianyang seedless' ponkan were CrMER3a and CrMER3A.-103bp Compared with CrMER3A, CrMER3a has a single base T deletion in the seventh exon; -103bp Compared with CrMER3A, a total of 103 bp were deleted in the 15th intron and the 16th exon, both of which resulted in premature termination of protein translation. -103bp The DNA lengths of the CrMER3 genes are 8165 bp, 8164 bp, and 8062 bp, respectively. The coding region sequence lengths are 3687 bp, 804 bp, and 1554 bp, respectively, encoding 1228 amino acids, 267 amino acids, and 517 amino acids, respectively. Figure 3 As shown, GSDS was used to draw the exon and intron structure of the gene. It can be seen that when the functional CrMER3 protein is missing in citrus, its meiotic process is disrupted, which leads to seedless fruit.

[0042] Example 3: Obtaining KASP molecular markers for identifying whether citrus varieties carry the seedless gene CrMER3a

[0043] The CrMER3 gene was identified in natural citrus populations and CrMER3A(A) was found to be ubiquitous in citrus varieties. -103bp It is unique to the 'Qianyang Seedless' mandarin orange, while CrMER3a(a) exists in a heterozygous state (Aa) in some varieties. According to the phenotype of the 'Qianyang Seedless' mandarin orange, by obtaining CrMER3a homozygous (aa) in traditional hybrid breeding, thereby obtaining a non-functional CrMER3 protein, a new seedless citrus germplasm can be created. The KASP molecular marker designed based on the 2295th base (T / C) of the gene CrMER3 can be used to identify whether citrus varieties carry the seedless gene CrMER3a.

[0044] 1. The developed KASP molecular marker sequences are as follows:

[0045] KASP-CrMER3-F: 5'-gaaggtgaccaagttcatgctGCTATGCCCCAGCAAAAAATGATTTT-3' (SEQ ID NO: 7, the lowercase letter part is the specific fluorescent tag sequence FAM);

[0046] KASP-CrMER3-H: 5'-gaaggtcggagtcaacggattGCTATGCCCCAGCAAAAAATGATTTC-3' (SEQ ID NO: 8, the lowercase letters are the specific fluorescent tag sequence HEX);

[0047] KASP-CrMER3-C: 5'-AGAATCAAGAGCTTGCCTTTTCAAAT-3' (SEQ ID NO: 9).

[0048] 2. KASP reaction test:

[0049] (1) Extraction of whole genome DNA from leaves of the test sample: conventional CTAB method, adjusting the DNA concentration to about 50 ng / μL.

[0050] (2) Reaction system: 2.5 μL of 2×KASP Master mix (LGC, KBS-1050-122), 2.5 μL of genomic DNA, and 0.07 μL of primer mixture (mixed with equal volumes of KASP-MER3-F (concentration 36 μM), KASP-MER3-H (concentration 36 μM), and KASP-MER3-C (concentration 90 μM)), with a total volume of 5.07 μL. Reaction procedure: 94°C pre-denaturation for 15 min; 94°C denaturation for 20 s, 61°C gradient annealing and extension for 60 s, 10 cycles, with the annealing and extension temperature decreasing by 0.6°C in each cycle; 94°C denaturation for 20 s, 55°C annealing and extension for 60 s, 26 cycles (Roche LC480 fluorescence quantitative PCR instrument). A blank control (NTC) without adding DNA template to the reaction system was also set up in the experiment, and one or more blank controls were set up for each plate.

[0051] (3) Fluorescence data reading and analysis. Fluorescence data were read using a fluorescence quantitative PCR instrument (Roche LC480). Fluorescence signals were read at 37°C for 60 seconds. FAM and HEX were selected as the fluorescence types. The typing results of the samples to be tested were as follows: Figure 4 shown.

[0052] 3. To test the practicality of the KASP marker of the present invention, Sanger sequencing was used to verify the typing results of the KASP molecular marker.

[0053] Amplification primers are as follows:

[0054] Forward primer CrMER3-TF: 5′-GAACGGACAGGACACATTCTCTCA-3′;

[0055] Reverse primer CrMER3-TR: 5'-CTGTGCAGCTTCTTGTGCTCC-3'.

[0056] The PCR reaction system is as follows: 25 μL PCR Mix (purchased from Nanjing Novozyme Biotechnology Co., Ltd.), 2 μL DNA template, 2 μL forward and reverse primers, and ddH2O supplemented to a final volume of 50 μL. The thermal cycle parameters are: 95°C 3min; 95°C 30sec, 58°C 30sec, 72°C 15sec, 32 cycles; 72°C 7min, 1 cycle; 4°C storage. 5 μL of amplified product was drawn and tested using 1.0% agarose gel electrophoresis in a horizontal electrophoresis tank. If the band size is about 500 bp, the remaining 45 μL can be sent to the PCR product stock solution for sequencing (Wuhan Branch of Beijing Qingke Biotechnology Co., Ltd.). The sequencing results are shown in the figure. Figure 4 The KASP-CrMER3 molecular marker developed in the present invention can accurately identify whether a citrus variety carries the CrMER3a gene.

[0057] Example 4: Application of KASP-MER3 in molecular marker-assisted selection of citrus seedless breeding parents

[0058] The molecular marker KASP-CrMER3 was used to identify whether 83 samples of the natural population of citrus carried the CrMER3a gene. The method was as described in Example 3. The typing results of each material were as follows: Figure 5 As shown in the figure, the 16 citrus varieties represented by the points clustered at 45° carry the CrMER3a gene and exist in a heterozygous state (Aa). These citrus varieties can be used as parents for citrus seedless breeding and for creating new seedless citrus germplasm that is homozygous for CrMER3a (aa).

[0059] The CrMER3 gene provided by the present invention can be used as a candidate gene for citrus seedless breeding, and the provided KASP-CrMER3 molecular marker realizes accurate typing in identifying whether citrus varieties carry the seedless gene CrMER3a, and can realize efficient tracking and detection of the CrMER3a gene, and can be used for citrus seedless gene CrMER3a molecular marker-assisted breeding.

[0060] Example 5: Acquisition and phenotypic identification of CrMER3 gene knockout lines of Citrus model material Citrus fortunei

[0061] In order to verify the function of the CrMER3 gene, the MER3 gene of F. hindsii was edited, and the sgRNA: TACAGGAGAAGCTCCGTGAC was designed and constructed into the pCAMBIA1300-pYAO:hSpCas9-eGFP vector. The CrMER3 gene was knocked out by Agrobacterium-mediated epicotyl genetic transformation. The high-throughput tracking of mutation technology (Hi-TOM) was used to detect the mutation type and frequency of the obtained transgenic positive seedlings, and a total of 6 homozygous edited plants were obtained. Fertility identification found that the phenotype of the homozygous edited plants of the CrMER3 gene was consistent with that of the 'Qianyang Seedless' mandarin orange, with normal floral organ development, infertile pollen, disordered meiosis, and abnormal tetrads ( Figure 6 ).

[0062] The above embodiments are intended to facilitate understanding by those skilled in the art. The implementation methods of the present invention are not limited to the above embodiments. Any modifications, equivalent substitutions, combinations, improvements, etc. made within the spirit and principles of the present invention are included in the protection scope of the present invention.

Claims

1. A CrMER3 gene related to seedlessness in citrus, characterized in that: The CrMER3 genes include CrMER3A, CrMER3a, CrMER3A -103bp One or more of the three genotypes, CrMER3A, CrMER3a, CrMER3A -103bp The complete nucleotide sequences of the genes are shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively.

2. The CrMER3 gene associated with seedlessness in citrus according to claim 1, characterized in that: CrMER3A, CrMER3a, CrMER3A -103bp The nucleotide sequences of the coding regions of the genes are shown in SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6, respectively.

3. Use of the CrMER3 gene associated with seedless citrus according to claim 1 in seedless citrus breeding.

4. The use according to claim 3, characterized in that: include: Use gene editing technology to edit the CrMER3 gene of citrus to make the CrMER3 protein lose its function and create a new seedless citrus germplasm; Or obtain CrMER3a homozygous citrus plants through hybrid breeding and create new seedless citrus germplasm.

5. A KASP molecular marker for identifying whether a citrus variety carries the citrus seedless gene CrMER3a, characterized in that: The molecular marker corresponds to the 2295th base of the CrMER3 gene on chromosome 2 of the mandarin orange genome. The 2295th base of the CrMER3 gene in citrus varieties carrying the CrMER3a gene is C, and the 2295th base of the CrMER3 gene in citrus varieties not carrying the CrMER3a gene is T.

6. A primer, characterized in that: The primers are used to amplify the KASP molecular marker described in claim 5.

7. The primer according to claim 6, characterized in that: The primers include a CrMER3A allele upstream primer KASP-CrMER3-F, a CrMER3a allele upstream primer KASP-CrMER3-H, and a common downstream primer KASP-CrMER3-C; The nucleotide sequence of the CrMER3A allele upstream primer KASP-CrMER3-F is: 5'-gaaggtgaccaagttcatgctGCTATGCCCCAGCAAAAAATGATTTT-3'; The nucleotide sequence of the CrMER3a allele upstream primer KASP-CrMER3-H is: 5'-gaaggtcggagtcaacggattGCTATGCCCCAGCAAAAAATGATTTC-3'; The nucleotide sequence of the common downstream primer KASP-CrMER3-C is: 5'-AGAATCAAGAGCTTGCCTTTTCAAAT-3'.

8. Use of the KASP molecular marker according to claim 5 or the primer according to claim 6 or 7 in citrus seedless molecular marker-assisted selection breeding.

9. A method for identifying whether a citrus variety carries the seedless gene CrMER3a, characterized in that: The following steps are involved: The whole genome DNA of the tissue of the citrus variety to be tested is extracted, and the whole genome DNA of the sample to be tested is amplified by PCR using the primers described in claim 6 or 7, and the fluorescent signal of the PCR amplification product is read to obtain the typing result of the sample to be tested.

Images