Preharvest sprouting resistant OsRDR3 gene of fresh rice seeds as well as InDel marker and application of preharvest sprouting resistant OsRDR3 gene

Abstract

The invention discloses a fresh rice seed pre-harvest sprouting resistant OsRDR3 gene and an InDel marker and application thereof, the fresh rice seed pre-harvest sprouting resistant OsRDR3 gene is obtained through a map-based cloning method, and the rice pre-harvest sprouting rate is increased due to deletion of the gene. An inner primer ZIRDR3 of the gene OsRDR3 is designed to be used for rice pre-harvest sprouting resistant molecular marker-assisted selection, the pre-harvest sprouting resistant gene OsRDR3 is successfully introduced into a pre-harvest sprouting susceptible variety wild Xiangxiang B, and the pre-harvest sprouting rate of the variety is extremely remarkably reduced.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic breeding, and in particular to a method for preventing fresh rice seeds from germinating. OsRDR3 Gene and InDel marking and application. Background Art

[0002] In the rice-growing areas of southern my country, high temperature and high humidity during rice maturity can easily cause panicle germination, thereby reducing rice yield and quality, causing great economic losses. In addition, gibberellins are used in hybrid rice seed production to solve the necking problem of sterile lines, but this also increases the incidence and severity of panicle germination. During the domestication and breeding process of rice, the selection of rapid and uniform germination characteristics also led to a decrease in seed dormancy, thereby increasing the sensitivity of rice to panicle germination.

[0003] Rice panicle germination is affected by intrinsic factors (such as maturity, seed morphology and biochemical composition) and external environment (temperature, humidity and light) of different varieties. It is a complex quantitative trait controlled by multiple genes. So far, some QTLs / genes related to panicle germination have been located and cloned. OsVP1 , Sdr4 , GA2ox9 , miR156 , SD6 However, these genes cannot completely solve the problem of rice ear sprout resistance. Therefore, finding new ear sprout resistance genes and analyzing their functions are the key basis for breeding varieties resistant to ear sprout. Summary of the invention

[0004] In order to overcome the deficiencies of the prior art, the present invention aims to provide a method for preventing fresh rice seeds from germinating. OsRDR3 Gene and InDel marking and application.

[0005] In order to achieve the above object, the present invention adopts the following technical solution: Fresh rice seed anti-ear germination OsRDR3 Gene, the OsRDR3 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0006] The above OsRDR3 Application of genes in regulating the germination of fresh rice seeds.

[0007] Furthermore, the lack OsRDR3 The gene improves the germination level of fresh rice seeds and reduces germination resistance.

[0008] The above OsRDR3 The application of genes in regulating the germination of fresh seeds of plants.

[0009] Furthermore, the plant is wheat, rice or Arabidopsis thaliana.

[0010] A primer pair for identifying InDel markers for rice panicle sprouting resistance / susceptibility, the nucleotide sequence of the primer pair is: ZIRDR3-F: 5'- TCAATTTTCTCAATATGCTTGCCA-3'; ZIRDR3-R: 5'- AGAAATGGACCAGCTACCCG -3'; A kit for identifying rice ear sprouting resistance / susceptibility, characterized in that the kit comprises the above-mentioned primer pair.

[0011] Application of the above-mentioned InDel-labeled primer pair or the above-mentioned kit in auxiliary breeding of rice ear sprout resistance trait.

[0012] Furthermore, the above application includes the following steps: (1) extracting genomic DNA of rice to be tested; (2) Using genomic DNA as a template, PCR amplification was performed on the genomic DNA using the ZIRDR3-F / R primer pair, and rice panicle germination resistance / susceptibility analysis was performed based on the agar gel electrophoresis results; the nucleotide sequence of the primer pair was: ZIRDR3-F: 5'- TCAATTTTCTCAATATGCTTGCCA-3'; ZIRDR3-R: 5'-AGAAATGGACCAGCTACCCG-3'.

[0013] Furthermore, when the agar gel electrophoresis result is 556 bp, it indicates that the tested rice carries OsRDR3 Gene Nipponbare allele type; when the agar gel electrophoresis result is 417bp, it means that the tested rice does not carry OsRDR3 Gene Nipponbare allele type.

[0014] The beneficial effects of the present invention are: (1) The present invention provides rice OsRDR3 The application of genes can enhance the resistance of rice panicle germination.

[0015] (2) The present invention provides a rice ear sprout resistance gene OsRDR3 Indel molecules within the gene mark ZIRDR3.

[0016] (3) Anti-ear sprouting gene OsRDR3 Molecular marker-assisted screening can obtain rice varieties or lines with significantly improved resistance to ear germination. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 :Rice ear sprout resistance gene OsRDR3 Fine positioning.

[0018] Among them: JFZ is the parent Jiafuzhan that is susceptible to ear sprouting, NIP is the parent Nihonbare that is resistant to ear sprouting, and L1, L2, L3, L5-1, L5-2, L6, L7, and L8 are recombinant substitution lines.

[0019] Figure 2 : OsRDR3 Sequencing verification of gene-edited lines.

[0020] Figure 3 : OsRDR3 Ear sprouting phenotype of gene-edited lines.

[0021] Figure A shows the ear germination phenotype of Nipponbare and the gene-edited strains rdr3-c1, rdr3-c2, and rdr3-c3; Figure B shows the ear germination rate of Nipponbare and the gene-edited strains rdr3-c1, rdr3-c2, and rdr3-c3.

[0022] Figure 4 : Amplification results of molecular marker ZIRDR3 in resistant / susceptible ear germination parents, where Takara DL1000 was used as the marker.

[0023] Figure 5 : The ear sprouting performance of the ear sprouting resistant near-isogenic line of Yexiang B; in Figure 5 A is the individual plant phenotype of Yexiang B (left) and the disease-resistant near-isogenic line (Yexiang B-RDR3, right); Figure 5 B is the ear sprouting phenotype of Yexiang B and the disease-resistant near-isogenic line (Yexiang B-RDR3); Figure 5 C is a comparison of the ear germination rates of Yexiang B and the disease-resistant near-isogenic line (Yexiang B-RDR3). DETAILED DESCRIPTION

[0024] The technical solution of the present invention is further described in detail below through specific embodiments. It should be understood that the implementation of the present invention is not limited to the following embodiments.

[0025] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from commercial channels unless otherwise specified.

[0026] Example 1: Rice ear sprout resistance gene OsRDR3 Identification (1) Rice ear sprout resistance gene OsRDR3 Fine positioning It was observed that Nipponbare and Jiafuzhan had significant differences in ear sprout resistance. A random mating recombinant inbred line population constructed using Jiaster and Nipponbare was used to locate an ear sprout resistance locus qPHS1a . Then use one of the groups qPHS1a Residual system (i.e. qPHS1a The recombinant fragment replacement line was constructed to precisely locate the anti-ear sprouting gene. Figure 1 As shown, the anti-ear sprouting locus qPHS1a The gene was located in the approximately 20 kb interval between the molecular markers InDel14 and InDel21. The search revealed that this region contained only one gene. OsRDR3 , the gene number is Os01g0197900 (NCBI number), LOC_Os01g10130 (MSU number). OsRDR3 The CDS of the gene coding region is 3489 bp in length. OsRDR3 The coding sequence of the gene is shown in SEQ ID NO. 1. Therefore, this gene is used as an anti-ear sprouting locus qPHS1a candidate genes.

[0027] (2) Rice ear sprout resistance gene OsRDR3 Knockout validation To clarify OsRDR3 As the target gene, CRISPR-GE software was used to target the OsRDR3 Gene search for PAM sequence. Through BLAST analysis, select RDR3 Single gene editing has a preferred sequence with high conservation OsRDR3 -bar2, the specific target sequence is ACTTCAAACCTTCTGAACCG. Wuhan Boyuan Biotechnology Co., Ltd. was commissioned to use CRISP / Cas9 technology to construct the vector pBWA(V)HU-yl- RDR3 Transformed Nipponbare, a total of 31 transgenic plants were obtained. DNA was extracted from these transgenic plants using the Tiangen Plant Genome Extraction Kit, and hygromycin (primer Hyg) was tested to identify positive plants. The positive plants were amplified by the gene editing target site primer R3-b2 and the PCR products were sent to Shanghai Biotech for sequencing to determine the type of gene editing.

[0028] Sequence of sequencing primer R3-b2: SEQ ID NO.2: R3-b2-F: 5'-ACCGCTGAAAGGATATGCAG-3'; SEQ ID NO.3: R3-b2-R: 5'-CCTGTTTATGTTTGATCTGGAC-3'.

[0029] The results are as follows Figure 2 As shown, the sequencing results were compared with the corresponding sequence of the wild-type Nipponbare, and it was found OsRDR3 Single gene editing positive vaccine OsRDR3 - There are differences at the bar2 site, which can be divided into three categories: OsRDR3 The gene deletion of 32 bp in rdr3-c1, OsRDR3 The gene deletion 29bp rdr3-c2, OsRDR3 The gene was inserted into 1bp of rdr3-c3.

[0030] (3) OsRDR3 Ear germination phenotype of gene-edited lines Planting Nihonbare OsRDR3 The knockout lines are rdr3-c1, rdr3-c2, and rdr3-c1. When mature, the whole ear germination method was used to evaluate the germination resistance of rice ears. The specific steps are as follows: First, record the date for each line at the initial heading stage and mark it. When the grains are mature (30-35 days after heading), select more than 10 rice ears with the same maturity date from each line, put them into a seed soaking bag and tie them up. After sampling, soak the seeds in an incubator at 28°C for 10 hours. After that, carry out a germination treatment for 7 days (28°C), wash with water twice a day and dry them. After the germination is completed, investigate the germination rate of each ear.

[0031] Figure 3 The results showed OsRDR3 The ear germination rates of the gene knockout strains rdr3-c1, rdr3-c2, and rdr3-c1 were significantly higher than those of the wild-type Nipponbare. OsRDR3 The functional loss of the gene leads to a decrease in the resistance to Japanese haru germination. This gene should be the QTL locus for the resistance to Japanese haru germination. qPHS1a target gene.

[0032] Example 2: Rice Anti-ear Sprouting Gene OsRDR3 Development of the intragenic tag ZIRDR3 Comparison of Japan's sunny and good radiation OsRDR3 The full-length sequence of the gene. It was found that compared with Nipponbare, Jiayu accounted for OsRDR3 The allele starts to lack 139 bp at ATG-12248 bp; the deletion sequence is shown in SEQ ID NO.4, and primers ZIRDR3 are designed on both sides of the deletion.

[0033] Sequence of primer ZIRDR3: SEQ ID NO.5: ZIRDR3-F: 5'- TCAATTTTCTCAATATGCTTGCCA-3'; SEQ ID NO.6: ZIRDR3-R: 5'-AGAAATGGACCAGCTACCCG-3'; The product of the anti-ear sprouting allele amplified by this sequence is 556 bp, and the nucleotide sequence is shown in SEQ ID NO.7.

[0034] The product of the susceptible ear germination allele amplified by this sequence is 417 bp, and the nucleotide sequence is shown in SEQ ID NO.8.

[0035] The primers were applied to the ear sprout-resistant varieties Nipponbare and the ear sprout-susceptible varieties Jiafuzhan, Taifeng B, Yexiang B, Guang 8B, Hengfeng B, Quan 9311B, Gang 46B, II-32B and Jing 4155s.

[0036] The specific steps are as follows: (1) Using Tiangen Plant Genome Extraction Kit to extract genomic DNA of the above varieties; (2) Use the extracted genomic DNA as a template for PCR amplification: the PCR reaction system is 20 μL, containing 2.0 μL 10× buffer, 0.3 μL 10 mM dNTP, 2.0 μL 25 mM Mg 2+ , 2.0 μL 4 μM forward and reverse primers (SEQ ID NO.5 and SEQ ID NO.6), 0.25 μL 4 U / μL Taq enzyme, 2.0 μL 20 ng / μL template DNA, 11.45 μL ultrapure water. The PCR reaction program was: 94℃ pre-denaturation for 5 minutes, then 35 cycles of 94℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 30 seconds, and finally 72℃ extension for 10 minutes.

[0037] (3) Take 5 μL of the amplified product and load it onto a 1% agarose gel. Perform electrophoresis for 20 minutes and take a photo to preserve the electrophoresis results.

[0038] The results are as follows Figure 4 As shown, the amplification product of the resistant ear sprouting variety is 556bp; while the amplification product of the susceptible ear sprouting varieties Jiafuzhan, Taifeng B, Yexiang B, Guang 8B, Hengfeng B, Quan 9311B, Gang 46B, II-32B and Jing 4155s is 417bp, indicating that the molecular marker ZIRDR3 can be used to distinguish resistant and susceptible varieties, and can be used as a marker for prospect selection to introduce the Nipponbare ear sprouting resistance allele into the susceptible ear sprouting varieties.

[0039] Example 3: Using molecular marker-assisted selection technology to select rice anti-ear sprouting gene OsRDR3 Imported into the sensitive budding variety Yexiang B The donor parent Nipponbare and the recurrent parent Yexiang B were hybridized once, backcrossed five times, and selfed once. The molecular marker ZIRDR3 was used for auxiliary selection in backcrossing and selfing, and finally a seed with anti-ear sprouting was obtained. OsRDR3 The allele type of Yexiang B near isogenic line. The specific steps are as follows: (1) Hybridize Nipponbare and Noka B to obtain F1 seeds; (2) Planting F1, and backcrossing with the recurrent parent Yexiang B after heading to obtain BC1F1 seeds; (3) Planting BC1F1 and screening for ZIRDR3-containing OsRDR3 After heading, select the individual plants of the recurrent parent Yexiang B and backcross with Yexiang B to obtain BC2F1 seeds; (4) In BC2F1 to BC5F1, the method in step (3) was used to screen for OsRDR3 The individual plants were backcrossed with wild fragrance B until BC5F2 was harvested; (5) Planting BC5F2 and screening for ZIRDR3-containing OsRDR3 When mature, fresh rice ears are taken for identification of ear germination resistance (the specific steps are the same as step (3) of Example 1).

[0040] The results are as follows Figure 5 As shown, the ear germination rate of the Yexiang B ear germination resistant near-isogenic line (Yexiang B-RDR3) was significantly lower than that of the susceptible ear germination variety (Yexiang B) observed in Shaxian in 2023, Hainan in 2024 and Shaxian in 2024.

[0041] The above is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent change made to the above embodiment according to the technical essence of the invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. A method for resisting ear germination of fresh rice seeds OsRDR3 A gene characterized by: Said OsRDR3 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The method according to claim 1 OsRDR3 Application of genes in regulating the germination of fresh rice seeds.

3. The use according to claim 2, characterized in that: Missing OsRDR3 The gene improves the germination level of fresh rice seeds and reduces germination resistance.

4. The method according to claim 1 OsRDR3 The application of genes in regulating the germination of fresh seeds of plants.

5. The use according to claim 4, characterized in that: The plant is wheat, rice or Arabidopsis thaliana.

6. A primer pair for identifying InDel markers for rice panicle sprouting resistance / susceptibility, characterized in that: The nucleotide sequence of the primer pair is: ZIRDR3-F: 5'- TCAATTTTCTCAATATGCTTGCCA-3'; ZIRDR3-R: 5'-AGAAATGGACCAGCTACCCG-3'.

7. A kit for identifying rice panicle sprouting resistance / susceptibility, characterized in that: The kit comprises the primer pair according to claim 6.

8. Use of the InDel-labeled primer pair according to claim 6 or the kit according to claim 7 in auxiliary breeding for rice anti-ear sprouting trait.

9. The use according to claim 8, characterized in that: The steps include: (1) extracting genomic DNA of rice to be tested; (2) Using genomic DNA as a template, PCR amplification was performed on the genomic DNA using the ZIRDR3-F / R primer pair, and rice panicle germination resistance / susceptibility analysis was performed based on the agar gel electrophoresis results; the nucleotide sequence of the primer pair was: ZIRDR3-F: 5'- TCAATTTTCTCAATATGCTTGCCA-3'; ZIRDR3-R: 5'-AGAAATGGACCAGCTACCCG-3'.

10. The use according to claim 9, characterized in that: The agar gel electrophoresis result is 556 bp, indicating that the tested rice carries OsRDR3 Gene Nipponbare allele type; when the agar gel electrophoresis result is 417bp, it means that the tested rice does not carry OsRDR3 Gene Nipponbare allele type.

Images