NtTHF1b mutant gene and application thereof in tobacco leaf yellowing

Abstract

The invention discloses an NtTHF1b mutant gene and application of the NtTHF1b mutant gene in tobacco leaf yellowing. The nucleotide sequence of the NtTHF1b mutant gene is as shown in SEQ ID NO.1, the mutant gene is obtained by carrying out manual intervention mutation on a fragment CCACCTCTGCTTGTCGTTCAT of a CDS sequence of the NtTHF1b gene of tobacco, the sequence of the fragment after mutation is CCACCTTGTCGTTCAT (SEQ ID NO.4), the sequence of the fragment after mutation is lack of five basic groups CTCGC, the CDS sequence of the NtTHF1b gene is as shown in SEQ ID NO.2, and the sequence of an encoding protein of the NtTHF1b gene is as shown in SEQ ID NO.3. The invention further discloses an application of the gene in tobacco leaf yellowing. The invention provides a group of tobacco NtTHF1b mutant gene sequences and mutant fragment sequences, and a technical scheme in the aspect of gene function research in the tobacco leaf yellowing or leaf senescence process, so that the blank of the gene in the technical field of tobacco leaf yellowing is filled, and meanwhile, a research basis is provided for tobacco genetic breeding or seed production.

Description

Technical Field

[0001] The invention relates to the technical field of crop breeding, and in particular to an NtTHF1b mutant gene and application thereof in yellowing of tobacco leaves. Background Art

[0002] THF1 (Thylakoid Formation 1) is an important conserved gene in oxygenic photoautotrophs from cyanobacteria to flowering land plants. The protein encoded by this gene plays a key role in the formation and organization of thylakoids, ensuring that the vesicles can properly organize mature thylakoid stacks, which is crucial for leaf development.

[0003] Leaf growth, development and senescence are important links in the life history of plants. After the leaves mature, they gradually enter senescence under the influence of internal and external factors. The degradation of chlorophyll is an early event in the process of chloroplast disintegration and is the most obvious sign of leaf senescence. In the initial stage of chlorophyll degradation, Chlb is converted into Chla through the chlorophyll cycle; first, Chla removes the phytol group under the catalysis of chlorophyllase (CHLase) to form chlorophyllide ester; then, red chlorophyll metabolites (RCC) are generated under the catalysis of pheophorbide a oxygenase (PaO); then RCC is catalyzed by RCC reductase (RCCR) to generate primary fluorescent chlorophyll metabolites (pFCCs), and finally converted into non-fluorescent chlorophyll metabolites, completing the chlorophyll degradation metabolic process (Xiao Huaijuan, 2014). Carotenoids are the second most abundant pigments in nature and participate in important physiological and biochemical processes of plants. Phytoene synthase (PSY) catalyzes the conversion of geranylgeranyl pyrophosphate to phytoene. This reaction is the key rate-limiting step in the synthesis of carotenoids, and PSY is the key rate-limiting enzyme in this reaction.

[0004] At present, the research on THF1 gene is mostly focused on model plants such as Arabidopsis and rice. Our research group discovered the tobacco chloroplast-related protein-related gene NtTHF1b, whose nucleotide sequence SEQ ID NO.1 is 969bp and the encoded protein is 322aa. As a crop with leaves as the main economic value, in-depth study of the molecular regulatory mechanism of its chloroplast-related protein gene THF1 in the process of leaf senescence has scientific significance and application value. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a NtTHF1b mutant gene and its application in yellowing of tobacco leaves, so as to provide a theoretical basis and data support for tobacco strain breeding.

[0006] The technical problem to be solved by the present invention is achieved through the following technical solutions:

[0007] The invention discloses an application of a NtTHF1b mutant gene in yellowing of tobacco leaves. The nucleotide sequence of the NtTHF1b mutant gene is shown in SEQ ID NO.1. The mutant gene is obtained by artificially intervening a mutation in a fragment CCACCTCTCGCTTTGTCGTTCAT of a CDS sequence of the tobacco NtTHF1b gene. The sequence of the mutated fragment is CCACCTTTTGTCGTTCAT (SEQ ID NO.4). The mutated fragment lacks 5 bases CTCGC. The CDS sequence of the NtTHF1b gene is shown in SEQ ID NO.2. The sequence of the protein encoded by the NtTHF1b gene is shown in SEQ ID NO.3.

[0008] Preferably, in the above technical solution, the NtTHF1b mutant gene is used in any of the following applications: (1) in treating yellowing of tobacco leaves; (2) in tobacco genetic breeding or seed production.

[0009] Preferably, in the above technical solution, the yellowing of tobacco leaves includes changes in pigment content and related gene changes of the NtTHF1b mutant gene during the aging process of tobacco leaves.

[0010] A tobacco NtTHF1b mutant is named thf1, and the sequence of the mutant thf1 is shown as SEQ ID NO.1.

[0011] A tobacco NtTHF1b mutant is used in any of the following applications: application in yellowing of tobacco leaves: (1) application in yellowing of tobacco leaves; (2) application in tobacco genetic breeding or seed production.

[0012] Preferably, in the above technical solution, compared with the non-mutated NtTHF1b strain, the pigment content of the mutant thf1 is higher than that of the control NtTHF1b strain at both the seedling stage and the mature stage.

[0013] Preferably, in the above technical scheme, compared with the unmutated NtTHF1b strain, the chlorophyll a / b value of the mutant thf1 remained unchanged at 2.2 during the dark treatment of 0-7 days, and the chlorophyll degradation was slow; while in the control NtTHF1b strain, the ratio decreased from 2.35 to 2.0, and the chlorophyll degradation was obvious.

[0014] Preferably, in the above technical solution, compared with the non-mutated NtTHF1b strain, the PAO and RCCR1 genes in the mutant thf1 are higher than those in the control NtTHF1b strain.

[0015] Preferably, in the above technical scheme, compared with the unmutated NtTHF1b strain, the expression level of the RCCR1 gene under dark treatment in the mutant thf1 decreases with increasing dark treatment time, while the expression level in the control NtTHF1b strain increases with increasing dark treatment time.

[0016] The above technical solution of the present invention has the following beneficial effects:

[0017] This application successfully obtained the mutant thf1 by artificially intervening and mutating the tobacco NtTHF1b gene. The mutant gene showed significant technical effects in the yellowing process of tobacco leaves: at the seedling and mature stages, the pigment content of the mutant leaves was higher than that of the control, which delayed chlorophyll degradation, maintained a high chlorophyll a / b ratio, and slowed down leaf senescence. At the same time, the changes in the expression levels of PAO and RCCR1 genes in the mutant were opposite to those in the control plants, indicating that the NtTHF1b gene mutation has an important regulatory effect on pigment metabolism and related gene expression during leaf senescence. These findings provide new molecular mechanisms and genetic resources for tobacco leaf color improvement and senescence regulation.

[0018] The present invention provides a set of tobacco NtTHF1b mutant gene sequences and mutant fragment sequences, and a technical solution for studying gene function during tobacco leaf yellowing or leaf senescence, filling the gap in the technical field of tobacco leaf yellowing of the gene, and providing a research basis for tobacco genetic breeding or seed production. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The accompanying drawings, which are incorporated in and constitute a part of the specification, illustrate embodiments of the invention and, together with the description, serve to explain the principles of the invention.

[0020] Figure 1 This is the peak diagram for detecting the NtTHF1b mutant, CK is the control Honghua Dajinyuan, and thf1 is the NtTHF1b mutant;

[0021] Figure 2 is the expression level of NtTHF1b in different tissues of tobacco, namely root, stem and leaf;

[0022] Figure 3 is the pigment content in tobacco leaves at maturity, CK is the control Honghua Dajinyuan, thf1 is the NtTHF1b mutant;

[0023] Figure 4 is the relative expression level of plastid pigment metabolism-related genes in mature tobacco leaves, CK is the control Honghua Dajinyuan, thf1 is the NtTHF1b mutant;

[0024] Figure 5is the pigment content in tobacco leaves treated with darkness at the seedling stage, CK is the control Honghua Dajinyuan, and thf1 is the NtTHF1b mutant;

[0025] Figure 6 is the relative expression level of plastid pigment metabolism-related genes in tobacco leaves treated with darkness at the seedling stage, CK is the control Honghua Dajinyuan, and thf1 is the NtTHF1b mutant. DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present invention will now be described in detail with reference to the accompanying drawings. It should be noted that the relative arrangement of components and steps, numerical expressions and numerical values ​​set forth in these embodiments do not limit the scope of the present invention unless otherwise specifically stated.

[0027] In the various embodiments of the present application, if no specific technology or conditions are specified, the existing technology or conditions in the field are used, and the materials or equipment used without indicating the manufacturer are all conventional products that can be purchased.

[0028] Unless otherwise specified, the percentages in the present invention are volume percentages and the ratios are volume ratios. The tobacco variety used in the present application is Honghua Dajinyuan, a commercial tobacco variety.

[0029] Example 1

[0030] The seeds and tobacco seedlings provided in this example are respectively the control Honghua Dajinyuan (abbreviated as CK) and the NtTHF1b gene mutant (thf1).

[0031] thf1 (nucleotide sequence as SEQ ID NO.1) is a nucleotide fragment CCACCTCTCGCTTTGTCGTTCAT in the tobacco NtTHF1b gene as shown in the nucleotide sequence of SEQ ID NO.2, which is mutated into a nucleotide sequence fragment CCACCTTTTGTCGTTCAT (SEQ ID NO.4) under artificial intervention.

[0032] The roots, stems and leaves of red flower Dajinyuan in the seedling stage were selected as samples, and the specific primers for tobacco NtTHF1b fluorescence quantitative analysis qNtTHF1b-F / R and internal reference gene L25 fluorescence quantitative analysis qL25-F / R were designed (see Table 1). Fluorescence quantitative analysis was performed. The reaction system was prepared according to the instructions of SYBR GreenI premixed qPCR kit (Q711, Vazyme Biotechnology). The 2-ΔΔCT method was used to analyze the relative expression level of genes. Each reaction was repeated three times.

[0033] Table 1 Primer sequence information

[0034]

[0035] Example 2

[0036] The control Honghua Dajinyuan (CK) and NtTHF1b gene mutant (thf1) were used as experimental materials. At the maturity stage of tobacco plants, 6 control plants (CK) and 6 gene-edited plants thf1 were selected, and one leaf from the same leaf position of the middle leaf of each plant was collected as a sample; the main vein of the leaves was removed, and then wrapped in tin foil, placed in liquid nitrogen for transportation, and stored in a -70℃ ultra-low temperature refrigerator in the laboratory for future use.

[0037] The samples for pigment content detection were pretreated, the leaves were freeze-dried, ground into powder, sieved and set aside.

[0038] Weigh 0.2 g (accurate to 0.1 mg) of fresh tobacco leaf freeze-dried sample into a 50 mL conical flask, accurately add 25 mL of extractant (90% acetone solution, V / V), and extract by ultrasonic in an ice bath for 20 min. Take an appropriate amount of the supernatant and filter it through a 0.45 mm organic micromembrane. Place the filtrate in a brown chromatographic bottle for analysis.

[0039] Liquid chromatography conditions:

[0040] Chromatographic column: Waters Nova-Pak-C18 chromatographic column (150mm×3.9mm×4μm); flow rate: 0.5mL / min; column temperature: 30℃; injection volume: 10.0μL; mobile phase A: isopropanol; mobile phase B: 80% acetonitrile in water (V / V), gradient elution program is shown in Table 2; detection time: 40min; detection wavelength: 428nm for chlorophyll b and 448nm for other plastid pigments.

[0041] The pigment contents in the leaves of the edited plants and the control plants were measured, including chlorophyll a, chlorophyll b, total chlorophyll and carotenoids.

[0042] Table 2 Liquid chromatography gradient elution program

[0043]

[0044] The expression levels of chlorophyll degradation-related genes (CHLase, PAO, RCCR1, PSY) were determined, and the specific gene primers for fluorescence quantitative analysis are shown in Table 3.

[0045] Table 3 Primer sequence information

[0046]

[0047] Example 3

[0048] The control safflower Dajinyuan (CK) and NtTHF1b gene mutant (thf1) were used as experimental materials. At the seedling stage of tobacco plants, tobacco seedlings grown to 6 weeks were selected, and 6 control plants (CK) and 6 gene-edited plants thf1 were selected. Plants with consistent growth were selected, and the leaves at the 3rd and 4th nodes were picked, rinsed with distilled water, and the water on the leaf surface was absorbed by filter paper. The petiole was wrapped with moist absorbent cotton to keep it moist. Water (containing 0.5% Tween-20) was applied to the leaf surface. After the leaf surface was air-dried, it was placed in a culture dish with moist filter paper and transferred to an artificial climate box for dark treatment. The treatment conditions were a temperature of 25°C and a relative humidity of 80%. Samples were collected after 0, 3, and 7 days of treatment, and stored in a -80°C ultra-low temperature refrigerator after quick freezing with liquid nitrogen for pigment content determination and RNA extraction.

[0049] Research findings:

[0050] (1) Expression analysis results in different tissues:

[0051] The expression results of NtTHF1b gene in different tissues of cultivated tobacco Honghua Dajinyuan showed that the expression level of NtTHF1b gene was leaf>stem>root, and there were obvious differences in the expression levels in leaves, stems and roots, indicating that the expression of NtTHF1b gene in tobacco is tissue-specific.

[0052] (2) Analysis of pigment content and pigment-related gene expression at maturity:

[0053] ① Liquid chromatography was used to detect the pigment content in the mature leaves of the control plant CK and the gene-edited plant thf1, including chlorophyll a, chlorophyll b, total chlorophyll and carotenoids. The results showed that the content of the four pigments in the edited plant thf1 was significantly higher than that in the control plant CK; the chlorophyll a / b value was about 2.0 in both the control plant and the gene-edited plant.

[0054] ②The relative expression levels of tobacco CHLase, PAO, RCCR1, and PSY related genes were determined. The results showed that there was no significant difference in the expression levels of CHLase and PSY genes in the gene-edited plant thf1 and the control plant CK (P>0.05), while the expression levels of PAO and RCCR1 genes were higher than those in the control plant CK.

[0055] (3) Analysis of pigment content and pigment-related gene expression during dark treatment in seedling stage:

[0056] To study the role of tobacco chloroplast-related protein gene NtTHF1b in the chlorophyll degradation metabolic pathway during leaf senescence, the changes in pigment content and related genes in tobacco leaves at the seedling stage were detected and analyzed under dark conditions for 0d, 3d, and 7d during the process of dark-induced leaf senescence.

[0057] ① The chlorophyll content decreased under darkness treatment, but it was significantly reduced in the control plant CK after 7 days of darkness treatment, and it was significantly reduced in the gene-edited plant thf1 after 3 days of darkness treatment. The chlorophyll a / b value in the gene-edited plant thf1 under darkness treatment was about 2.2, with basically no change, while in the control plant CK, the ratio decreased from 2.35 (0d) to 2.0 (7d).

[0058] ②The changing trends of CHLase, PAO, and PSY genes in the control plant CK and the gene-edited plant thf1 under dark treatment were relatively consistent, while the expression level of RCCR1 gene increased with the increase of dark treatment time in the control plant CK, while the expression level of gene in the gene-edited plant thf1 decreased with the increase of dark treatment time.

[0059] Although the present invention has been disclosed as above by the embodiments, it is not intended to limit the present invention. Any person skilled in the art may make various choices and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention is limited by the claims and their equivalents.

Claims

1. A NtTHF1b mutant gene, It is characterized in that The nucleotide sequence of the NtTHF1b mutant gene is shown in SEQ ID NO.

1. The mutant gene is an artificial intervention mutation of the fragment CCACCTCTCGCTTTGTCGTTCAT of the CDS sequence of the tobacco NtTHF1b gene. The sequence of the mutated fragment is CCACCTTTTGTCGTTCAT (SEQ ID NO.4). The mutated fragment lacks 5 bases CTCGC. The CDS sequence of the NtTHF1b gene is shown in SEQ ID NO.2, and the sequence of the protein encoded by it is shown in SEQ ID NO.

3.

2. The use of the NtTHF1 mutant gene according to claim 1 in any of the following: (1) application in yellowing of tobacco leaves; (2) application in tobacco genetic breeding or seed production.

3. The use according to claim 2, It is characterized in that The yellowing of tobacco leaves includes changes in pigment content and related gene changes of the NtTHF1b mutant gene during tobacco leaf senescence.

4. A tobacco NtTHF1b mutant, It is characterized in that The mutant is named thf1, and the sequence of the mutant thf1 is shown in SEQ ID NO.

1.

5. Use of the tobacco NtTHF1b mutant according to claim 4 in any of the following: (1) application in tobacco leaf yellowing; (2) application in tobacco genetic breeding or seed production.

6. The use according to claim 5, It is characterized in that Compared with the non-mutated NtTHF1b strain, the pigment content of the mutant thf1 was higher than that of the control NtTHF1b strain at both the seedling and mature stages.

7. The use according to claim 6, It is characterized in that Compared with the non-mutated NtTHF1b strain, the chlorophyll a / b value of the mutant thf1 remained unchanged at 2.2 during the dark treatment of 0-7 days, and the chlorophyll degradation was slow; while in the control NtTHF1b strain, the ratio decreased from 2.35 to 2.0, and the chlorophyll degradation was obvious.

8. The use according to claim 5, It is characterized in that Compared with the non-mutated NtTHF1b strain, the PAO and RCCR1 genes in the mutant thf1 were higher than those in the control NtTHF1b strain.

9. The use according to claim 5, It is characterized in that Compared with the non-mutated NtTHF1b strain, the expression level of RCCR1 gene in the mutant thf1 decreased with the increase of dark treatment time under dark treatment, while the expression level in the control NtTHF1b strain increased with the increase of dark treatment time.

Images