Primer probe group and kit capable of simultaneously detecting mycoplasma genitalium, mycoplasma perforatum, mycoplasma fermentum and mycoplasma pear

Abstract

The invention relates to the technical field of biology, in particular to a primer probe group and a kit capable of simultaneously detecting mycoplasma genitalium, mycoplasma perforatum, mycoplasma fermentum and mycoplasma pear. The invention provides a primer probe group and a kit for detecting mycoplasma genitalium, mycoplasma perforatum, mycoplasma fermentum and mycoplasma pear. According to the method, the mycoplasma genitalium, the mycoplasma perforatum, the mycoplasma fermentum and the mycoplasma pear can be independently or simultaneously and accurately detected in the same reaction system, the defect of mutual interference does not exist, the operation time of operators is shortened, and the detection cost is reduced.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a primer probe set and a kit capable of simultaneously detecting Mycoplasma genitalium, Mycoplasma penetrantum, Mycoplasma fermentum and Mycoplasma pear. Background Art

[0002] Mycoplasma genitalium is one of the main mycoplasmas of sexually transmitted diseases. It can cause urethritis, cervicitis, proctitis, and secondary pelvic inflammatory disease, prostatitis, epididymitis, and is closely related to premature birth. Other studies have shown that Mycoplasma genitalium can cause mucosal damage and trigger related inflammatory reactions such as increased cytokine expression and polymorphonuclear leukocyte reactions, thereby promoting the transmission of human immunodeficiency virus (HIV). At the same time, there is also a correlation between HIV virus budding and Mycoplasma genitalium adhesion. Mycoplasma genitalium adhesion to HIV-infected lymphocytes may activate the process of HIV virus replication or release, thereby accelerating disease progression.

[0003] Mycoplasma penetrans is a new mycoplasma isolated from the urine of AIDS patients in 1990. It was named Mycoplasma penetrans (Mpe), also known as Mycoplasma penetrating, because it can adsorb host cells and penetrate into cells.

[0004] Mycoplasma fermentans can activate NF-κB through TLR1, TLR2 and Toll-like receptor 6 (TLR6), promote HIV replication, enhance HIV infection ability, and accelerate the progression of AIDS.

[0005] Mycoplasma pyri, Mycoplasma genitalium, Mycoplasma penetrating, and Mycoplasma fermentum have all been reported to be co-factors of human immunodeficiency virus (HIV) infection and predisposing factors for the onset of AIDS, also known as acquired immunodeficiency syndrome (AIDS). There are differences in the treatment plans for patients with HIV infection alone and those with combined urogenital mycoplasma infection. Accurate detection can guide doctors and patients to rationally choose drugs for treatment.

[0006] At present, there are three main types of detection methods for sexually transmitted disease microorganisms, namely culture methods, immunological methods, and molecular biological methods. Mycoplasma genitalium, Mycoplasma penetrans, Mycoplasma fermentum, and Mycoplasma pyri all grow slowly and are difficult to isolate and culture. Isolation and culture are not used as routine detection methods in clinical practice. In addition, serological detection of Mycoplasma genitalium often has antigenic cross-talk with certain pathogens, resulting in low sensitivity and specificity. There are currently no mature serological detection technologies for Mycoplasma penetrans, Mycoplasma fermentum, and Mycoplasma pyri at home and abroad. Therefore, the current detection methods for mycoplasmas that are difficult to culture in China mainly use the polymerase chain reaction (PCR) reported earlier abroad. Taqman fluorescent PCR is a new technology developed in the 1990s. Taqman PCR introduces a specific fluorescent probe that is homologous to a sequence on the inside of the PCR primer pair. The 5' end of the probe is labeled with a reporter fluorescence, while the 3' end is labeled with a quencher fluorescence. When the probe remains intact, the emission wavelength of the reporter fluorescence is absorbed by the excitation wavelength of the quencher fluorescence, and the fluorescence signal of the reporter fluorescence cannot be detected at this time; during the PCR process, the 5'-3' exonuclease activity of Taq DNA polymerase can cut the fluorescent probe into single bases, so that the reporter fluorescence is no longer affected by the quencher fluorescence, and the fluorescence signal of the reporter fluorescence can be detected and increases with the increase of the number of PCR cycles. Since the entire experimental process is run in a completely closed system, cross contamination is avoided, making the results more objective and true. At the same time, the hybridization of specific probes is combined during amplification, which further improves the sensitivity and specificity of the experiment. Real-time fluorescence PCR has obvious advantages in sensitivity, sensitivity and accuracy of sexually transmitted disease detection. It is a commonly used detection method at present, which can be used for large-scale sexually transmitted disease screening and detection and has been widely adopted. Therefore, if a primer probe combination and a real-time fluorescence quantitative PCR kit for detecting genital mycoplasma, penetrant mycoplasma, fermentation mycoplasma, and pear mycoplasma are provided, it will have important practical significance. Summary of the invention

[0007] In view of this, the present invention provides a primer probe set and a kit for detecting Mycoplasma genitalium, Mycoplasma penetrans, Mycoplasma fermentation and Mycoplasma pear. The use of the combination can realize the accurate detection of Mycoplasma genitalium, Mycoplasma penetrans, Mycoplasma fermentation and Mycoplasma pear individually or simultaneously in the same reaction system without the defect of mutual interference, reducing the operation time of the operator and reducing the detection cost.

[0008] Another object of the present invention is to provide at least one new target gene for detecting Mycoplasma genitalium, Mycoplasma penetrans, Mycoplasma fermentans, and Mycoplasma pears.

[0009] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0010] The present invention provides a set of target nucleic acids for detecting Mycoplasma genitalium, Mycoplasma penetrans, Mycoplasma fermentans, and Mycoplasma pears, wherein the sequences include at least one of the following:

[0011] (i), Mycoplasma genitalium rpmG gene, GenBank: L43967.2, positions 64400 to 64492;

[0012] (ii), rpoB gene of Mycoplasma penetrans, GenBank: FJ765338.1, positions 334 to 519;

[0013] (iii), unknown functional protein gene of Mycoplasma fermentans, GenBank: LR214966.1, positions 15460 to 15776;

[0014] (iv) 16S rRNA gene of Mycoplasma pyri, GenBank: AY757364.1, positions 169 to 267.

[0015] The present invention also provides the use of the sequence in the target nucleic acid as a target in designing a primer probe set or preparing a detection kit.

[0016] In some specific embodiments of the present invention, the above-mentioned application includes at least one of the following:

[0017] The use of i as a target in designing a primer probe set for detecting Mycoplasma genitalium or preparing a Mycoplasma genitalium detection kit;

[0018] Use of the above ii as a target in designing a primer probe set for detecting Mycoplasma penetrantis or preparing a Mycoplasma penetrantis detection kit;

[0019] The use of ii as a target in designing a primer probe set for detecting fermentation mycoplasma or preparing a fermentation mycoplasma detection kit;

[0020] The iv is used as a target in designing a primer probe set for detecting Mycoplasma pears or preparing a Mycoplasma pears detection kit.

[0021] The present invention also provides a primer probe set, including at least one of primer probe set 1, primer probe set 2, primer probe set 3, and primer probe set 4;

[0022] The primer probe set 1 comprises primer 1, primer 2 and probe 1;

[0023] The primer probe set 2 includes primer 3, primer 4 and probe 2;

[0024] The primer probe set 3 includes primer 5, primer 6 and probe 3;

[0025] The primer probe set 4 includes primer 7, primer 8 and probe 4;

[0026] The primer 1 has:

[0027] (1), the nucleotide sequence shown in SEQ ID NO: 1; or

[0028] (2) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (1), and having the same or similar function as (1); or

[0029] (3) a nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (1) or (2);

[0030] The primer 2 has:

[0031] (4) the nucleotide sequence shown in SEQ ID NO: 2; or

[0032] (5) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as (4); or

[0033] (6) a nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (4) or (5);

[0034] The probe 1 has:

[0035] (7), the nucleotide sequence shown in SEQ ID NO:9; or

[0036] (8) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (7), and having the same or similar function as (7); or

[0037] (9) a nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (7) or (8);

[0038] The primer 3 has:

[0039] (10), the nucleotide sequence shown in SEQ ID NO: 3; or

[0040] (11) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (10), and having the same or similar function as (10); or

[0041] (12) A nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (10) or (11);

[0042] The primer 4 has:

[0043] (13), the nucleotide sequence shown in SEQ ID NO: 4; or

[0044] (14) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (13), and having the same or similar function as (13); or

[0045] (15) A nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (13) or (14);

[0046] The probe 2 has:

[0047] (16), the nucleotide sequence shown in SEQ ID NO: 10; or

[0048] (17) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (16), and having the same or similar function as (16); or

[0049] (18) A nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (16) or (17);

[0050] The primer 5 has:

[0051] (19), the nucleotide sequence shown in SEQ ID NO: 5; or

[0052] (20) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (19), and having the same or similar function as (19); or

[0053] (21) a nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (19) or (20);

[0054] The primer 6 has:

[0055] (22), the nucleotide sequence shown in SEQ ID NO: 6; or

[0056] (23) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (22), and having the same or similar function as (22); or

[0057] (24) a nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (22) or (23);

[0058] The probe 3 has:

[0059] (25), the nucleotide sequence shown in SEQ ID NO: 11; or

[0060] (26) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (25), and having the same or similar function as (25); or

[0061] (27) A nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (25) or (26);

[0062] The primer 7 has:

[0063] (28), the nucleotide sequence shown in SEQ ID NO:7; or

[0064] (29) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (28), and having the same or similar function as (28); or

[0065] (30) A nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (28) or (29);

[0066] The primer 8 has:

[0067] (31), the nucleotide sequence shown in SEQ ID NO: 8; or

[0068] (32) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (31), and having the same or similar function as (31); or

[0069] (33) A nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (31) or (32);

[0070] The probe 4 has:

[0071] (34), the nucleotide sequence shown in SEQ ID NO: 12; or

[0072] (35) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (34), and having the same or similar function as (34); or

[0073] (36) a nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (34) or (35);

[0074] The plurality is 2 to 5.

[0075] In some specific embodiments of the present invention, the probe 1, probe 2, probe 3, and probe 4 of the primer probe set are independently connected to a fluorescent group and a quenching group respectively;

[0076] The fluorescent groups include: FAM, HEX, ROX, VIC, Cy5 or CY5.5;

[0077] The quencher group includes BHQ1 or BHQ2.

[0078] The present invention also provides a primer-probe combination, comprising at least two of the primer-probe group 1, the primer-probe group 2, the primer-probe group 3, and the primer-probe group 4 in the above-mentioned primer-probe group.

[0079] The present invention also provides the use of the primer-probe combination in detecting at least one of Mycoplasma genitalium, Mycoplasma penetrantum, Mycoplasma fermentum and Mycoplasma pears.

[0080] The present invention also provides the use of the primer probe set or primer probe combination in preparing a reagent or a kit for detecting at least one of Mycoplasma genitalium, Mycoplasma penetrans, Mycoplasma fermentans, and Mycoplasma pears.

[0081] The present invention also provides a reagent, including the above primer-probe set or primer-probe combination.

[0082] In some specific embodiments of the present invention, the above reagents further include a bifunctional DNA polymerase, uracil DNA glycosylase, dNTP, a PCR amplification enhancer, and an enzyme activator;

[0083] The PCR amplification enhancer includes DMSO, Tween20 and glycerol.

[0084] In some specific embodiments of the present invention, the enzyme activator comprises a magnesium ion enzyme activator, a manganese ion activator, or a combination thereof.

[0085] In some specific embodiments of the present invention, the bifunctional DNA polymerase in the above reagent is Tth DNA polymerase.

[0086] The present invention also provides a kit, comprising the above primer-probe set or primer-probe combination.

[0087] In some specific embodiments of the present invention, the above-mentioned kit comprises the above-mentioned reagents.

[0088] In some specific embodiments of the present invention, the above-mentioned kit includes a PCR reaction solution, a positive quality control product and a negative quality control product;

[0089] The PCR reaction solution includes the above-mentioned primer probe set or primer probe combination.

[0090] The present invention also provides a detection method, including detection based on the above primer probe set or primer probe combination.

[0091] In some specific embodiments of the present invention, the above-mentioned detection method includes detection based on the above-mentioned reagent.

[0092] In some specific embodiments of the present invention, the above detection method includes detection based on the above kit.

[0093] The marker, primer probe set or primer probe combination and kit of the present invention have the following effects:

[0094] Mycoplasma genitalium, Mycoplasma penetrantum, Mycoplasma fermentum, and Mycoplasma pear have high nutritional requirements and are difficult to culture, and the culture time is long, which may delay the diagnosis and is not suitable for clinical rapid diagnosis. In contrast, the target gene and primer probe set provided by the present invention can quickly and accurately detect Mycoplasma genitalium, Mycoplasma penetrantum, Mycoplasma fermentum, and Mycoplasma pear, and can achieve single and multiple detection, thereby improving the detection efficiency. The present invention can detect samples such as urogenital tract secretions and urine, and the sampling is convenient, and the sample coverage range is wide. The problem of painful sampling caused by only adapting to the genital swab sample type can be avoided. The kit provided by the present invention can be stored at 2 to 8 ° C, and is easy to operate, has good specificity, strong repeatability, and the detection method is less time-consuming, which provides a reliable molecular diagnosis basis for auxiliary diagnosis of mycoplasma infection related to reproductive tract diseases and AIDS-related mycoplasma infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0095] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0096] Figure 1 The results of the present invention for detecting positive samples of Mycoplasma genitalium, Mycoplasma penetrantum, Mycoplasma fermentum and Mycoplasma pyri are shown;

[0097] Figure 2 The results of the present invention for detecting Mycoplasma genitalium (concentration 100 copies / mL), Mycoplasma penetrans (concentration 100 copies / mL), Mycoplasma fermentans (concentration 100 copies / mL), and Mycoplasma pyri (concentration 100 copies / mL) samples are shown;

[0098] Figure 3 The amplification curves of the sample with a concentration 10 times the detection limit (1000 copies / mL) after the kit of the present invention was stored at 2-8°C for 6 months and 24 months;

[0099] Figure 4The amplification curves of the samples with a concentration of 200 copies / mL when the kit of the present invention is stored at 2-8°C for 6 months and 24 months;

[0100] Figure 5 The results of the present invention for detecting high-risk human papillomavirus type 16, high-risk human papillomavirus type 18, herpes simplex virus type 2, varicella-zoster virus, human cytomegalovirus, Epstein-Barr virus, Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum, Mycoplasma hominis, Mycoplasma pneumoniae, group B Streptococcus, Candida albicans, Candida glabrata, Staphylococcus aureus, and inactivated strains of Trichomonas vaginalis are shown;

[0101] Figure 6 The results of the present invention for detecting samples with added interfering drugs are shown. DETAILED DESCRIPTION

[0102] The present invention discloses a primer probe set and a kit for simultaneously detecting Mycoplasma genitalium, Mycoplasma penetrantum, Mycoplasma fermentum, and Mycoplasma pear. A person skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve the same. It should be particularly noted that all similar substitutions and modifications are obvious to a person skilled in the art, and they are all considered to be included in the present invention. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application described herein without departing from the content, spirit and scope of the present invention to realize and apply the technology of the present invention.

[0103] The PCR-based methods of the present invention include: real-time fluorescence quantitative PCR, melting curve method, loop-mediated isothermal amplification technology, multiplex PCR technology, digital PCR technology, nested PCR, POCT, etc. New target genes such as the rpmG gene of Mycoplasma genitalium, the rpoB gene of Mycoplasma penetrantum, and the unknown functional protein gene of Mycoplasma fermentans are detected. Probes and primers are designed for the conserved regions in the rpmG gene of Mycoplasma genitalium, the rpoB gene of Mycoplasma penetrantum, the unknown functional protein gene of Mycoplasma fermentans, and the 16SrRNA gene of Mycoplasma pear.

[0104] Probes and primers were designed based on the conserved regions of the rpmG gene of Mycoplasma genitalium (GenBank: L43967.2, >L43967.2:64400-64492), the rpoB gene of Mycoplasma penetrans (GenBank: BA000026.2, >FJ765338.1:334-519), the unknown functional protein gene of Mycoplasma fermentans (GenBank: AP009608.1, >LR214966.1:15460-15776) and the 16SrRNA gene of Mycoplasma pear (GenBank: AY757364.1) reported in the NCBI database. All of the above target genes can be queried on NCBI, and the probe types are all TaqMan probes.

[0105] The present invention provides a primer-probe composition for detecting Mycoplasma genitalium, including a target gene primer-probe composition; the target gene primer-probe composition includes:

[0106] Primer 1 (upstream): 5′-GCACTGCTTGCAGTACTTGTTG-3′ (SEQ ID NO: 1);

[0107] Primer 2 (downstream): 5′-GTCTGTCAAGACTGTTTAAGTCG-3′ (SEQ ID NO: 2);

[0108] Probe 1: 5'-GATAAGTCGCTGCAAAGGTTGTTTTGTTCACCG-3' (SEQ ID NO: 9);

[0109] Target sequence: 5'-GCACTGCTTGCAGTACTTGTTGATGATAAGTCGCTGCAAAGGTTGT TTTGTTCACCGTTTTACATAGTTACGACTTAAACAGTCTTGACAGAC-3' (SEQ ID NO: 13);

[0110] The present invention provides a primer-probe composition for detecting mycoplasma penetrantum, including a target gene primer-probe composition; the target gene primer-probe composition comprises:

[0111] Primer 3 (upstream): 5′-AGGCATGTCTTCAACTGGAAC-3′ (SEQ ID NO: 3);

[0112] Primer 4 (downstream): 5′-GAAGGAACGGTTGCAATGG-3′ (SEQ ID NO: 4);

[0113] Probe 2: 5'-CCCTTTGTTTCCATGACGTCCAGCC-3' (SEQ ID NO: 10);

[0114] Target sequence: 5'-AGGCATGTCTTCAACTGGAACAATTTTAGAAATAATCCCTTTGTTTC CATGACGTCCAGCCATCTTATCACCAATTTGGATTTTTCTTTTTGTACAACATAAACT TTAATTTGTTCAATTACATCAGCATTCAATTCATAGTCATCTTCAACTTTGAATCTTTTT ACCATTGCAACCGTTCCTTC-3' (SEQ ID NO: 14);

[0115] The present invention provides a primer-probe composition for detecting fermentation mycoplasma, including a target gene primer-probe composition; the target gene primer-probe composition includes:

[0116] Primer 5 (upstream): 5′-CTTCAGAACAAGAAAGTTCACTTG-3′ (SEQ ID NO: 5);

[0117] Primer 6 (downstream): 5′-GTTGGTCTATACAATTTTGTTGG-3′ (SEQ ID NO: 6);

[0118] Probe 3: 5′-GGTTTAAAAGCTTTGCAACAACTTGATGGTGG-3′ (SEQ ID NO: 11);

[0119] Target sequence: 5'-CTTCAGAACAAGAAAGTTCACTTGTTTTTTGCAAAAAATGAAATGAA TGCAATTAAAAAATGATCAAATTTCTAAATTAGATAGTGAAGGTTTAAAAGCTTTGCAACAACTTGATGGTGGTGTTGATTTTACAAATAATGATTTAATTAAAAATTATTTAGAAAATGATTATTTATCAGCTGTTAAAGATTTAAGAGAATATTTCTTAAACAAACTAATTTACTTATTACATGAAAAATTTAATTATGGTGATGTATACTGATCTCCAACAAAATTGTATAGACCAAC-3'(SEQ ID NO:15);

[0120] The present invention provides a primer-probe composition for detecting Mycoplasma pear, comprising a target gene primer-probe composition; the target gene primer-probe composition comprises:

[0121] Primer 7 (upstream): 5′-CATGACCAAAATAAATGTTGACATC-3′ (SEQ ID NO: 7);

[0122] Primer 8 (downstream): 5′-CACCTTATTACAATATTGGTGTTAA-3′ (SEQ ID NO: 8);

[0123] Probe 4: 5′-GCTTTGCGATGGGTTTTAACATTTAAATTGG-3′ (SEQ ID NO: 12);

[0124] Target sequence: 5'-CACCTTATTACAATATTGGTGTTAATAATTTTAAAATCCAATTTAAAT GTTAAAACCCATCGCAAAGCAAATTTGATGTCAACATTTATTTTGGTCATG-3' (SEQ ID NO: 16);

[0125] The present invention provides a nucleic acid detection kit capable of simultaneously detecting Mycoplasma genitalium, Mycoplasma penetrans, Mycoplasma fermentans, and Mycoplasma pear, comprising a PCR reaction solution, a positive quality control product, and a negative quality control product. The PCR reaction solution comprises the primer probe set, a bifunctional DNA polymerase, uracil DNA glycosylase, dNTP, a PCR amplification enhancer, and manganese ions.

[0126] The bifunctional DNA polymerase is Tth DNA polymerase, the uracil DNA glycosylase is UDG enzyme, the dNTP is a combination of dATP, dGTP, dCTP, and dUTP, and the PCR amplification enhancer is composed of DMSO, Tween20, and glycerol.

[0127] The concentration of the upstream primer and downstream primer used for target nucleotide amplification was 0.2-1.0 μmol / L; the concentration of the detection probe was 0.2-1.0 μmol / L. The positive quality control (used to set the positive control) was a 1:1:1:1 mixture of four target plasmids: the rpmG gene of Mycoplasma genitalium (GenBank: L43967.2, >L43967.2:64400-64492), the rpoB gene of Mycoplasma penetrans (GenBank: BA000026.2, >FJ765338.1:334-519), the unknown functional protein gene of Mycoplasma fermentans (GenBank: AP009608.1, >LR214966.1:15460-15776), and the 16SrRNA gene of Mycoplasma pear (GenBank: AY757364.1). The negative quality control (used to set the negative control) was normal saline.

[0128] In the method described in the present invention, the system of real-time fluorescence quantitative PCR includes:

[0129] Table 1: PCR reaction solution composition

[0130]

[0131]

[0132] Table 2: Composition of PCR reaction solution 2

[0133] PCR reaction solution 2 Amount per person <![CDATA[Mn(OAc)2(pH 6.0)]]> 0.1~0.4mmol / L Sodium Azide 0.0005~0.0015g / L <![CDATA[H2O]]> Make up to 15 μL

[0134] Table 3: Amplification procedure of the real-time fluorescence quantitative PCR in the method described in the present invention:

[0135]

[0136] In fact, the present application is not limited to separate detection, and can realize the detection of one, two, three, or four pathogens in a single tube.

[0137] Unless otherwise specified, the raw materials, reagents, consumables and instruments involved in the present invention are all common commercial products and can be purchased from the market.

[0138] The present invention will be further described below in conjunction with the embodiments.

[0139] Example 1

[0140] This embodiment is a nucleic acid detection kit that can simultaneously detect Mycoplasma genitalium, Mycoplasma penetrantum, Mycoplasma fermentum, and Mycoplasma pear, including the following components:

[0141] (1) 15 μL PCR reaction solution 1

[0142] The concentrations of the components of PCR reaction solution 1 are as follows:

[0143] 0.2 μmol / L primer 1, 0.2 μmol / L primer 2, 0.1 μmol / L probe 1;

[0144] 0.2 μmol / L primer 3, 0.2 μmol / L primer 4, 0.1 μmol / L probe 2;

[0145] 0.2 μmol / L primer 5, 0.2 μmol / L primer 6, 0.1 μmol / L probe 3;

[0146] 0.2 μmol / L primer 7, 0.2 μmol / L primer 8, 0.1 μmol / L probe 4;

[0147] Among them, the fluorescent group of probe 1 is FAM, and the quencher group is BHQ1; the fluorescent group of probe 2 is HEX, and the quencher group is BHQ1; the fluorescent group of probe 3 is ROX, and the quencher group is BHQ2; the fluorescent group of probe 4 is Cy5, and the quencher group is BHQ2.

[0148] 0.5U / μL Tth DNA polymerase, 0.05U / μL UDG enzyme, 0.2mmol / L dATP, 0.2mmol / L dGTP, 0.2mmol / L dCTP, 0.4mmol / L dUTP, 0.001g / L preservative - sodium azide.

[0149] 50mmol / L tris(hydroxymethyl)methylglycine (pH 8.3), 100mmol / L potassium acetate;

[0150] 0.08g / L DMSO, 0.0005g / L Tween20, 0.002g / L glycerol.

[0151] (2) 15 μL PCR reaction solution 2

[0152] The concentrations of the components in PCR reaction solution 2 are:

[0153] 0.3mmol / L Mn(OAc)2, 0.001g / L preservative - sodium azide.

[0154] Positive quality control: The final concentration of each plasmid of the four target sequences of Mycoplasma genitalium, Mycoplasma penetrantum, Mycoplasma fermentum, and Mycoplasma pear is 1×10 5 copies / mL;

[0155] Negative control: sterile saline.

[0156] Example 2

[0157] The present invention is used to detect nucleic acids of Mycoplasma genitalium, Mycoplasma penetrans, Mycoplasma fermentans, and Mycoplasma pyri. In this embodiment, the kit prepared in Example 1 is used to detect nucleic acids of Mycoplasma genitalium, Mycoplasma penetrans, Mycoplasma fermentans, and Mycoplasma pyri in samples such as genital tract secretions, urethral secretions, and urine.

[0158] (1) Reagent preparation

[0159] According to the number of samples to be tested, negative controls and positive controls, take the corresponding amount of PCR reaction solution 1 and PCR reaction solution 2 in proportion (15 μL / person PCR reaction solution 1 + 15 μL / person PCR reaction solution 2), mix them thoroughly to form a PCR-MIX mixed solution, and centrifuge it for standby use.

[0160] (2) Sample processing

[0161] 1. Rinse a urogenital tract swab sample to be tested (a sample with positive sequencing results for Mycoplasma genitalium, Mycoplasma penetrantum, Mycoplasma fermentum, or Mycoplasma pyri) with 1 mL of normal saline for 5 to 10 times, and keep the liquid for later use;

[0162] One urine positive sample was collected and reserved (sequencing confirmed it to be a positive sample). After digital PCR determination, the concentrations of the corresponding pathogens in the urogenital swab sample and urine sample were adjusted to be consistent using the corresponding dilution matrix (Mycoplasma genitalium: 600 copies / mL, Mycoplasma penetrantum 600 copies / mL, Mycoplasma fermentum 600 copies / mL, and Mycoplasma pyri 300 copies / mL);

[0163] 2. Take 200 μL of swab positive samples and 200 μL of urine positive samples, respectively, and use the magnetic bead nucleic acid extraction reagent of Zhengzhou Antu Bioengineering Co., Ltd. (Medical Device Registration Certificate Number / Product Technical Requirements Number: Yu Zheng Xie Bei 20180037) to extract the nucleic acids of Mycoplasma genitalium, Mycoplasma penetrantum, Mycoplasma fermentum, and Mycoplasma pear in the samples to be tested for later use;

[0164] 3. Take several PCR reaction tubes, add 30 μL of PCR-MIX mixed solution, and then add 20 μL of the extracted nucleic acid of the sample to be tested and 20 μL of the nucleic acid product of the negative / positive quality control respectively. Each sample has 3 replicate wells and centrifuge for 10 seconds.

[0165] (3) Fluorescence PCR reaction

[0166] 1. Place the PCR reaction tube into the sample slot of the thermal amplification instrument and set the names of the samples to be tested in the corresponding order;

[0167] 2. Fluorescence detection channel selection: select FAM channel, HEX channel, ROX channel, CY5 channel detection; set the reference fluorescence to none;

[0168] 3. The specific PCR reaction procedure is: 50°C for 2 min; 95°C for 2 min; (95°C for 10 s, 60°C for 22 s, 45 cycles); 40°C for 10 s.

[0169] (4) Results analysis

[0170] After the PCR reaction is completed, the test results are determined based on the Ct value. The intersection of the amplification curve and the threshold line is called the Ct value (i.e., Cycle threshold, which refers to the number of cycles experienced when the fluorescent signal in the PCR reaction tube reaches the set threshold); the instrument software can determine the test results based on the Ct value of each sample. For samples with a Ct value of ≤38.00, the report is positive; for samples with a Ct value of 40≥>38, the report is less than the detection limit; for samples with no Ct value, the report is negative; if the Ct value is 45≥>40, the sample is tested repeatedly.

[0171] The results are as follows Figure 1 As shown in Table 4, it is proved that this kit can be used to detect Mycoplasma genitalium, Mycoplasma penetrantum, Mycoplasma fermentum, and Mycoplasma pear nucleic acid, and there is no interference between the four targets. There is no difference in the test results between urogenital tract swab samples and urine samples, as shown in Table 4.

[0172] Table 4

[0173]

[0174] Example 3

[0175] In this example, the kit prepared in Example 1 was used to detect nucleic acids of Mycoplasma genitalium, Mycoplasma penetrantum, Mycoplasma fermentum, and Mycoplasma pyri in urogenital tract secretion samples to verify the detection effect of the present invention.

[0176] (1) The urogenital tract secretion samples of Mycoplasma genitalium, Mycoplasma penetrans, Mycoplasma fermentans, and Mycoplasma pyri with known concentrations (digital PCR values) (the final concentration of each target in the sample is 100 copies / mL) were subjected to nucleic acid extraction according to Example 2 and then fluorescent PCR reaction detection was performed according to Example 2.

[0177] (2) Results Analysis

[0178] The results were analyzed according to Example 2. Figure 2 As shown, it can be seen that the kit can stably detect when the sample concentration is 100 copies / mL, and the sensitivity is high.

[0179] Example 4

[0180] The kit of the present invention can be stored at 2-8°C. According to the number of samples to be tested, negative controls and positive controls, corresponding amounts of PCR reaction solution 1 and PCR reaction solution 2 stored at 2-8°C for 0 days are taken in proportion (15 μL / person PCR reaction solution 1 + 15 μL / person PCR reaction solution 2), fully mixed to form a PCR-MIX mixed solution, and then centrifuged instantly for use.

[0181] (1) The urogenital tract positive samples and the target sample concentrations were 2 times the detection limit (200 copies / mL) and 10 times the detection limit (1000 copies / mL), respectively, and mixed for later use;

[0182] (2) Take 200 μL of the sample to be tested, the negative control and the positive control, and use the magnetic bead nucleic acid extraction reagent of Zhengzhou Antu Biotechnology Co., Ltd. to extract the nucleic acid in the sample to be tested, and set aside;

[0183] (3) Take several PCR reaction tubes, add 30 μL of PCR-MIX mixed solution, and then add 20 μL of the extracted nucleic acid products of the sample to be tested and the negative / positive quality control product, respectively, and centrifuge for 10 seconds;

[0184] (4) Place the PCR reaction tube into the sample slot of the thermal amplification instrument and set the names of the samples to be tested in the corresponding order;

[0185] (5) Fluorescence detection channel selection: select FAM channel, HEX channel, ROX channel, and CY5 channel for detection; set the reference fluorescence to none;

[0186] (6) The specific PCR reaction procedure was: 50°C for 2 min; 95°C for 2 min; (95°C for 10 s, 60°C for 22 s, 45 cycles); 40°C for 10 s.

[0187] (7) After the kit has been stored at 2-8°C for 6 months and 24 months, repeat the above steps and compare the differences before and after;

[0188] The results are as follows Figure 3 , Figure 4 As shown in Table 5, the CT value and amplification height after 6 and 24 months of storage were not significantly changed compared with the control group, indicating that storage at 2-8°C had no effect on the test results of the kit provided by the present invention, and the reagents could be stored at 2-8°C. As shown in Table 5, the difference in CT value between the real-time and control groups was no higher than 0.33 CT, which met the difference requirements.

[0189] Table 5

[0190]

[0191] Example 5

[0192] This example verifies the specificity of the kit of the present invention. According to the number of samples to be tested, negative controls, and positive controls, corresponding amounts of PCR reaction solution 1 and PCR reaction solution 2 are taken in proportion (15 μL / person PCR reaction solution 1 + 15 μL / person PCR reaction solution 2), and the mixture is fully mixed to form a PCR-MIX mixed solution, which is centrifuged instantaneously and set aside.

[0193] (1) High-risk human papillomavirus type 16, high-risk human papillomavirus type 18, herpes simplex virus type 2, varicella-zoster virus, human cytomegalovirus, Epstein-Barr virus, Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum, Mycoplasma hominis, Mycoplasma pneumoniae, group B Streptococcus, Candida albicans, Candida glabrata, Staphylococcus aureus, inactivated strains of Trichomonas vaginalis, and other pathogens that may have cross-contamination are added to the negative samples of urogenital tract swabs at concentrations shown in Table 6, and mixed for later use;

[0194] Table 6

[0195] Pathogens Add concentration High-risk human papillomavirus type 16 <![CDATA[4.3×10 6 genomic copies / mL]]> High-risk human papillomavirus type 18 <![CDATA[4.3×10 6 genomic copies / mL]]> Herpes simplex virus type 2 <![CDATA[2.27×10 5 TCID50 / mL]]> Varicella-zoster virus <![CDATA[2.5×10 5 TCID50 / mL]]> Human cytomegalovirus <![CDATA[1.00×10 5 IU / mL]]> Epstein-Barr virus <![CDATA[1.00×10 5 IU / mL]]> Chlamydia trachomatis <![CDATA[7.83×10 6 CFU / mL]]> Neisseria gonorrhoeae <![CDATA[3.20×10 6 CFU / mL]]> Ureaplasma urealyticum <![CDATA[1.23×10 6 copies / mL]]> Mycoplasma hominis <![CDATA[1.30×10 6 CFU / mL]]> Mycoplasma pneumoniae <![CDATA[1.80×10 6 CFU / mL]]> Group B Streptococcus <![CDATA[2.00×10 6 CFU / mL <!-- 11 -->]]> Candida albicans <![CDATA[3.00×10 6 CFU / mL]]> Candida glabrata <![CDATA[7.87×10 6 CFU / mL]]> Staphylococcus aureus <![CDATA[7.52×10 6 CFU / mL]]> Trichomonas vaginalis <![CDATA[3.14×10 5 pcs / ml]]>

[0196] (2) Take 200 μL of the sample to be tested, negative quality control and positive quality control, and use the magnetic bead nucleic acid extraction reagent (medical device registration certificate number / product technical requirement number: Yu Zheng Xie Bei 20180037) produced by Zhengzhou Antu Biotechnology Co., Ltd. to extract the nucleic acid in the sample to be tested for later use;

[0197] (3) Take several PCR reaction tubes, add 30 μL of PCR-MIX mixed solution, and then add 20 μL of the extracted nucleic acid products of the sample to be tested and the negative / positive quality control product, respectively, and centrifuge for 10 seconds;

[0198] (4) Place the PCR reaction tube into the sample slot of the thermal amplification instrument and set the names of the samples to be tested in the corresponding order;

[0199] (5) Fluorescence detection channel selection: select FAM channel, HEX channel, ROX channel, and CY5 channel for detection; set the reference fluorescence to none;

[0200] (6) The specific PCR reaction procedure was: 50°C for 2 min; 95°C for 2 min; (95°C for 10 s, 60°C for 22 s, 45 cycles); 40°C for 10 s.

[0201] The results are as follows Figure 5As shown, the kit provided by the present invention can detect nucleic acids of Mycoplasma genitalium, Mycoplasma penetrantum, Mycoplasma fermentum, and Mycoplasma pyri, but cannot detect nucleic acids of high-risk human papillomavirus type 16, high-risk human papillomavirus type 18, herpes simplex virus type 2, varicella-zoster virus, human cytomegalovirus, Epstein-Barr virus, Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum, Mycoplasma hominis, Mycoplasma pneumoniae, group B Streptococcus, Candida albicans, Candida glabrata, Staphylococcus aureus, and inactivated strains of Trichomonas vaginalis. The kit has no cross reaction with the above pathogens.

[0202] Example 6

[0203] This example verifies the anti-interference ability of the kit in Example 1. According to the number of samples to be tested, negative controls and positive controls, corresponding amounts of PCR reaction solution 1 and PCR reaction solution 2 are taken in proportion (15 μL / person PCR reaction solution 1 + 15 μL / person PCR reaction solution 2), and the mixture is fully mixed into a PCR-MIX mixed solution, which is centrifuged instantaneously and set aside.

[0204] (1) Evaluate the impact of commonly used drugs for treating STDs on the test results, mainly penicillin sodium, azithromycin, levofloxacin hydrochloride, vancomycin, clindamycin, erythromycin, ampicillin, doxycycline hydrochloride, cefotaxime, minocycline hydrochloride, ciprofloxacin, nifuratel and nystatin. Add the above interfering substances to the weak positive samples (2 to 3 times the minimum detection limit concentration) and mix well for later use. The control group is the weak positive sample without the above interfering substances;

[0205] Table 7

[0206] Interfering drugs Interference concentration Penicillin Sodium 400 μg / mL Azithromycin 2 μg / mL Levofloxacin Hydrochloride 2 μg / mL Vancomycin 1500 μg / mL Clindamycin 8 μg / mL Erythromycin 7 μg / mL Ampicillin 17 μg / mL Doxycycline hydrochloride 2.5 μg / mL Ceftriaxone 4.6 μg / mL Minocycline Hydrochloride 5.1 μg / mL Ciprofloxacin 2.5 μg / mL Nifuratel Nystatin 1.35 μg / mL

[0207] (2) Take 200 μL of the sample to be tested, negative quality control and positive quality control, and use the magnetic bead nucleic acid extraction reagent (medical device registration certificate number / product technical requirement number: Yu Zheng Xie Bei 20180037) produced by Zhengzhou Antu Biotechnology Co., Ltd. to extract the nucleic acid in the sample to be tested for later use;

[0208] (3) Take several PCR reaction tubes, add 30 μL of PCR-MIX mixed solution, and then add 20 μL of the extracted nucleic acid products of the sample to be tested and the negative / positive quality control product, respectively, and centrifuge for 10 seconds;

[0209] (4) Place the PCR reaction tube into the sample slot of the thermal amplification instrument and set the names of the samples to be tested in the corresponding order;

[0210] (5) Fluorescence detection channel selection: select FAM channel, HEX channel, ROX channel, and CY5 channel for detection; set the reference fluorescence to none;

[0211] (6) The specific PCR reaction procedure was: 50°C for 2 min; 95°C for 2 min; (95°C for 10 s, 60°C for 22 s, 45 cycles); 40°C for 10 s.

[0212] The results are as follows Figure 6 As shown, common interfering drugs for STD pathogens have no effect on the test results of the kit provided by the present invention. Table 8 is the comparison result of CT value of the experimental group and the control group.

[0213] Table 8

[0214]

[0215]

[0216] Example 7

[0217] To further prove that the kit can specifically detect Mycoplasma genitalium, Mycoplasma penetrant, Mycoplasma fermentum, and Mycoplasma pear nucleic acid, this example verifies the detection of 50 collected clinical samples. According to the number of samples to be tested, negative controls, and positive controls, the samples are fully mixed in proportion (15 μL / person PCR reaction solution 1 + 15 μL / person PCR reaction solution 2) to form a PCR-MIX mixed solution, which is centrifuged instantly for use.

[0218] (1) The collected 55 clinical samples were rinsed with 1 mL of normal saline and mixed for later use;

[0219] (2) Take 200 μL of the sample to be tested, the negative control and the positive control, and use the magnetic bead nucleic acid extraction reagent of Zhengzhou Antu Biotechnology Co., Ltd. to extract the nucleic acid in the sample to be tested, and set aside;

[0220] (3) Take several PCR reaction tubes, add 30 μL of PCR-MIX mixed solution, and then add 20 μL of the extracted nucleic acid products of the sample to be tested and the negative / positive quality control product, respectively, and centrifuge for 10 seconds;

[0221] (4) Place the PCR reaction tube into the sample slot of the thermal amplification instrument and set the names of the samples to be tested in the corresponding order;

[0222] (5) Fluorescence detection channel selection: select FAM channel, HEX channel, ROX channel, and CY5 channel to detect the target; set the reference fluorescence to none;

[0223] (6) The specific PCR reaction procedure was: 50°C for 2 min; 95°C for 2 min; (95°C for 10 s, 60°C for 22 s, 45 cycles); 40°C for 10 s.

[0224] The test results of this kit were compared with the sequencing results. The results showed that the test results of this kit were consistent with the sequencing results. The results are shown in Table 9.

[0225] Table 9

[0226]

[0227]

[0228] Example 8

[0229] This example is an internal standard addition test to verify the reliability of experimental data. The internal standard genes for amplification detection include β-globin, RNase P gene, Actin or GAPDH. This example uses human β-globin gene as an example.

[0230] The internal standard primer probe composition includes:

[0231] Internal standard upstream primer: 5'-CAGGTTTAAGGAGACCAATAG-3' (SEQ ID NO: 17);

[0232] Internal standard downstream primer: 5′-GAGAGTCAGTGCCTATCAG-3′ (SEQ ID NO: 18);

[0233] Internal standard fluorescent probe: 5'-CTGGGCATGTGGAGACAGAGAAGA-3' (SEQ ID NO: 19).

[0234] The sequence of the internal standard: 5'-CAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAG AGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTC-3' (SEQ ID NO: 20).

[0235] This example verifies the detection of internal standards in clinical samples by this kit. According to the number of samples to be tested, negative controls and positive controls, the mixture is fully mixed into a PCR-MIX mixture in proportion (15 μL / person PCR reaction solution 1 + 15 μL / person PCR reaction solution 2), and then centrifuged for standby use.

[0236] Tube 1: Contains Mycoplasma genitalium primer probe, Mycoplasma penetrant primer probe, and internal standard primer probe (the 5' end of the internal standard fluorescent probe is labeled with the reporter fluorescent group Cy5, and the 3' end is labeled with the non-luminescent quencher group labeled BHQ2);

[0237] Tube 2: Contains primer probes for Mycoplasma fermentans, primer probes for Mycoplasma pear, and internal standard primer probes (the 5' end of the fluorescent probe is labeled with a reporter fluorescent group HEX, and the 3' end is labeled with a non-luminescent quencher group labeled 3'BHQ1).

[0238] (1) Select 10 clinical samples positive for Mycoplasma genitalium and Mycoplasma penetrantum (tested in tube 1), 10 clinical samples positive for Mycoplasma fermentans and Mycoplasma pyri (tested in tube 2), and 10 clinical samples negative for Mycoplasma pyri (tested in tube 1 or 2), rinse with 1 mL of normal saline, mix well and set aside;

[0239] (2) Take 200 μL of the sample to be tested, the negative control and the positive control, and use the magnetic bead nucleic acid extraction reagent of Zhengzhou Antu Biotechnology Co., Ltd. to extract the nucleic acid in the sample to be tested, and set aside;

[0240] (3) Take several PCR reaction tubes, add 30 μL of PCR-MIX mixed solution, and then add 20 μL of the extracted nucleic acid products of the sample to be tested and the negative / positive quality control product, respectively, and centrifuge for 10 seconds;

[0241] (4) Place the PCR reaction tube into the sample slot of the thermal amplification instrument and set the names of the samples to be tested in the corresponding order;

[0242] (5) Fluorescence detection channel selection: Select FAM channel, HEX channel, ROX channel, and CY5 channel for detection; set the reference fluorescence to none.

[0243] The test results are shown in Table 10.

[0244] Table 10

[0245]

[0246]

[0247] It can be seen that the internal standards of both negative and positive samples can be stably detected.

[0248] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Target nucleic acid, It is characterized in that The sequence includes at least one of the following: (A1), Mycoplasma genitalium rpmG gene, GenBank: L43967.2, positions 64400 to 64492; (A2), rpoB gene of Mycoplasma penetrans, GenBank: FJ765338.1, positions 334 to 519; (A3), unknown functional protein gene of Mycoplasma fermentans, GenBank: LR214966.1, positions 15460 to 15776; (A4), 16S rRNA gene of Mycoplasma pyri, GenBank: AY757364.1, positions 169 to 267.

2. Use of the sequence in the target nucleic acid as claimed in claim 1 as a target in designing a primer probe set or preparing a detection kit.

3. Primer probe sets, including at least one of primer probe set 1, primer probe set 2, primer probe set 3, and primer probe set 4; The primer probe set 1 comprises primer 1, primer 2 and probe 1; The primer probe set 2 includes primer 3, primer 4 and probe 2; The primer probe set 3 includes primer 5, primer 6 and probe 3; The primer probe set 4 includes primer 7, primer 8 and probe 4; The primer 1 has: (1), the nucleotide sequence shown in SEQ ID NO: 1; or (2) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (1), and having the same or similar function as (1); or (3) a nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (1) or (2); The primer 2 has: (4) the nucleotide sequence shown in SEQ ID NO: 2; or (5) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as (4); or (6) a nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (4) or (5); The probe 1 has: (7), the nucleotide sequence shown in SEQ ID NO:9; or (8) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (7), and having the same or similar function as (7); or (9) a nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (7) or (8); The primer 3 has: (10), the nucleotide sequence shown in SEQ ID NO: 3; or (11) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (10), and having the same or similar function as (10); or (12) A nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (10) or (11); The primer 4 has: (13), the nucleotide sequence shown in SEQ ID NO: 4; or (14) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (13), and having the same or similar function as (13); or (15) A nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (13) or (14); The probe 2 has: (16), the nucleotide sequence shown in SEQ ID NO: 10; or (17) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (16), and having the same or similar function as (16); or (18) A nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (16) or (17); The primer 5 has: (19), the nucleotide sequence shown in SEQ ID NO: 5; or (20) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (19), and having the same or similar function as (19); or (21) a nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (19) or (20); The primer 6 has: (22), the nucleotide sequence shown in SEQ ID NO: 6; or (23) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (22), and having the same or similar function as (22); or (24) a nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (22) or (23); The probe 3 has: (25), the nucleotide sequence shown in SEQ ID NO: 11; or (26) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (25), and having the same or similar function as (25); or (27) A nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (25) or (26); The primer 7 has: (28), the nucleotide sequence shown in SEQ ID NO:7; or (29) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (28), and having the same or similar function as (28); or (30) A nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (28) or (29); The primer 8 has: (31), the nucleotide sequence shown in SEQ ID NO: 8; or (32) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (31), and having the same or similar function as (31); or (33) A nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (31) or (32); The probe 4 has: (34), the nucleotide sequence shown in SEQ ID NO: 12; or (35) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (34), and having the same or similar function as (34); or (36) a nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (34) or (35); The plurality is 2 to 5.

4. The primer probe set according to claim 1, It is characterized in that include: The probe 1, probe 2, probe 3, and probe 4 are independently connected to a fluorescent group and a quenching group respectively; The fluorescent group includes: FAM, HEX, ROX, VIC, Cy5 or CY5.5; the quenching group includes BHQ1 or BHQ2.

5. Use of the primer probe set according to claim 3 or 4 in any of the following: (B1) Detection of at least one of Mycoplasma genitalium, Mycoplasma penetrantum, Mycoplasma fermentum, and Mycoplasma pyri for non-diagnostic purposes; (B2) preparing a reagent or kit for detecting at least one of Mycoplasma genitalium, Mycoplasma penetrans, Mycoplasma fermentans, and Mycoplasma pears.

6. Reagents, It is characterized in that Comprising the primer probe set as described in claim 3 or 4.

7. The reagent according to claim 6, It is characterized in that It also includes DNA polymerase, dNTP, PCR amplification enhancer, and enzyme activator; The PCR amplification enhancer includes at least one of DMSO, Tween20 and glycerol.

8. Test kit, It is characterized in that include: (C1), a primer-probe set as described in claim 3 or 4; or (C2) The reagent according to claim 6 or 7.

9. The kit according to claim 8, It is characterized in that Including PCR reaction solution, positive quality control and negative quality control; The PCR reaction solution comprises the primer probe set as claimed in claim 3 or 4.

10. Testing methods for non-diagnostic purposes, It is characterized in that Based on any of the following tests: (D1), a primer-probe set as claimed in claim 3 or 4; (D2), a reagent as described in claim 6 or 7; (D3) A kit according to claim 8 or 9.

Images