A Lepidoptera insect Caspase-5 gene and its application

Abstract

The present invention provides a Lepidoptera insect Caspase-5 gene and its application in enhancing the insecticidal virulence of baculovirus against Lepidoptera pests. The nucleotide sequence of the open reading frame of the gene is SEQ ID NO:1, and the amino acid sequence of the encoded protein is SEQ ID NO:2. The screened SeCaspase-5 of the present invention has an apoptosis-promoting function and can enhance the insecticidal virulence of viral polyhedron OB against Spodoptera exigua. Therefore, by constructing a recombinant virus bacmid carrying the SeCaspase-5 gene and transfecting insect cells, the obtained progeny virus polyhedron OB is further fed to Spodoptera exigua larvae, which can enhance the insecticidal virulence of the recombinant virus against pests.

Description

Technical Field

[0001] The present invention belongs to the technical field of bio-agriculture and related industries, and particularly relates to a Lepidoptera insect Caspase-5 gene and its application. Background Art

[0002] Most species of Lepidoptera insects are important pests in agriculture and forestry. Among them, Spodoptera exigua is a representative species widely distributed worldwide and causing serious damage. Spodoptera exigua has a very wide range of food preferences. It is reported that it can feed on more than 170 kinds of plants in up to 35 families. It can not only damage vegetable crops such as peppers, sweet peppers, and tomatoes, but also damage food crops such as corn and peanuts. For many years, it has been recorded that Spodoptera exigua has broken out in more than half of the provinces, municipalities, and autonomous regions in China, continuously and seriously affecting the agricultural development and agricultural economic level in China. At present, the control of Lepidoptera pests mainly still uses chemical insecticides. However, chemical insecticides are prone to problems such as environmental pollution, pesticide residues, and the easy generation of pest resistance, seriously affecting the environment and the health of humans and livestock. Therefore, the biological control of pests, as a green prevention and control strategy, has attracted much attention.

[0003] Baculoviruses are natural microorganisms that only infect invertebrates. Therefore, they are safe for humans and livestock and friendly to the environment. They have been developed as safe insecticides and widely used in the biological control of Lepidoptera pests. However, baculovirus insecticides also have disadvantages such as a narrow host range, slow insecticidal speed, and low field virulence, so they are not easily accepted by farmers, which severely limits the application of baculoviruses. Summary of the Invention

[0004] The purpose of the present invention is to provide a Lepidoptera insect Caspase-5 gene and its application, namely a Spodoptera exigua Caspase-5 (SeCaspase-5) gene, and its application in improving the insecticidal virulence of baculoviruses against Lepidoptera pests.

[0005] The present invention provides a Spodoptera exigua SeCaspase-5 gene; the nucleotide sequence of the open reading frame (ORF) of this gene is SEQ ID NO:1, and the amino acid sequence of the encoded protein is SEQ ID NO:2.

[0006] Another aspect of the present invention provides a shuttle plasmid bacmid of a virus, which is constructed by inserting the nucleic acid fragment of the above Spodoptera exigua SeCaspase-5 gene into the viral genome;

[0007] As a specific record of the embodiment, the virus is a baculovirus;

[0008] The present invention also provides another use of the above-mentioned Spodoptera exigua SeCaspase-5 gene, which is its application in enhancing the insecticidal toxicity of viruses against Lepidoptera pests;

[0009] Another aspect of the present invention also provides a method for enhancing the insecticidal toxicity of viruses against Lepidoptera pests, and the method is to increase the expression level of the above-mentioned Spodoptera exigua SeCaspase-5 gene in host cells;

[0010] As a specific record of the example, increasing the expression level of the above-mentioned Spodoptera exigua SeCaspase-5 gene in host cells is to transfer the above-mentioned shuttle plasmid bacmid into host cells.

[0011] The present invention has identified the DNA sequence and protein sequence of the SeCaspase-5 gene, constructed a genomic bacmid of a recombinant Autographa californica multiple nucleopolyhedrovirus (AcMNPV) carrying the SeCaspase-5 gene, and successfully obtained recombinant virus occlusion bodies (OBs) of the corresponding spliceosome by transfecting cells. SeCaspase-5 has an apoptosis-promoting function, can promote cell apoptosis during the process of AcMNPV infecting cells, and can enhance the insecticidal toxicity of virus occlusion bodies OBs against Spodoptera exigua. Therefore, by constructing a recombinant virus bacmid carrying the SeCaspase-5 gene and transfecting insect cells, and further feeding the obtained progeny virus occlusion bodies OBs to Spodoptera exigua larvae, the insecticidal toxicity of the recombinant virus against pests can be enhanced. The present invention enriches the understanding of Lepidoptera insect Caspase-5 and its participation in regulating baculovirus-induced apoptosis, and also provides an effective way to enhance the insecticidal toxicity of baculoviruses, which is of great significance for the efficient utilization of baculoviruses for biological control of Lepidoptera pests. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1Alignment of the amino acid sequences of SeCaspase-5 and Caspase-5 from other Lepidoptera insects and analysis of the protein functional domains. The results showed that SeCaspase-5 contains a pro-domain at the N-terminus, which is separated from the C-terminus of the protein by the first cleavage site. The pro-domain contains a CARD (caspase recruitment domain) domain that has the function of recruiting other caspases. The C-terminus of the protein contains a large subunit and a small subunit, which are separated by the second cleavage site. The large subunit contains a substrate binding site with the motif "SSHG" and an active site with the motif "QMCRG", while the small subunit contains a substrate binding site with the motif "RDGKLG".

[0013] Figure 2 Figure for the construction and identification analysis of the recombinant virus bacmid of SeCaspase-5, where Figure 2 A is a schematic diagram of the construction of the recombinant virus bacmid of SeCaspase-5. After fusing GFP (green fluorescent tag) to the C-terminus of SeCaspase-5, it was cloned into the genomic bacmid of AcMNPV. Figure 2 B is the PCR identification analysis of the recombinant virus bacmid of SeCaspase-5. Using the universal primer M13 / pUCR and the upstream primer of the SeCaspase-5 gene, the bacmid carrying SeCaspase-5 was amplified by PCR, and a GFP fragment with a size of 2476 bp (control) and a SeCaspase-5 with a size of 3835 bp were obtained respectively, indicating that the bacmid was constructed correctly.

[0014] Figure 3 Effect of overexpression of SeCaspase-5 on apoptosis induced by the recombinant virus AcMNPV infection. The results showed that no apoptosis was observed in the cells transfected with the recombinant bacmid carrying GFP from 24 to 96 hours post transfection (h p.t.), and virus polyhedra OB (indicated by the red arrow) were produced in all cells. However, apoptosis was observed in all cells transfected with the recombinant bacmid carrying SeCaspase-5 (indicated by the black arrow), and a small amount of virus polyhedra OB were observed in a small number of cells at 72 hours post transfection.

[0015] Figure 4To study the effect of SeCaspase-5 on the insecticidal virulence of the recombinant virus AcMNPV, 3rd instar larvae of Spodoptera exigua were fed with recombinant virus OBs carrying GFP (control) or SeCaspase-5, with 1×10 6 OBs per larva. After the larvae had finished feeding on the virus-containing diet, the number of dead Spodoptera exigua larvae was counted daily and the survival rate was calculated. The results showed that the survival rate of the larvae fed with recombinant virus polyhedra OBs of SeCaspase-5 was significantly lower than that of the larvae fed with recombinant virus polyhedra OBs of GFP (analysis of significant differences showed that P < 0.0001). Specific implementation mode

[0016] Baculoviruses can be used to construct recombinant baculoviruses carrying foreign genes or lacking specific genes, so as to achieve the purpose of improving the yield and virulence of recombinant viruses. However, the inherent gene characteristics and infection mechanism of baculoviruses currently affect their insecticidal virulence.

[0017] The Spodoptera exigua SeCaspase-5 gene screened in the present invention has the function of promoting apoptosis of Spodoptera exigua cells. The SeCaspase-5 gene was cloned into the genomic shuttle plasmid bacmid of the polyhedrosis virus AcMNPV and transfected into Spodoptera exigua Se-3 cells. Analysis of apoptosis showed that overexpression of SeCaspase-5 could induce apoptosis of Spodoptera exigua Se-3 cells and, to a certain extent, delay the production of virus polyhedra OBs. The yield of virus polyhedra OBs in the cells was collected and measured. The results showed that overexpression of SeCaspase-5 reduced the yield of virus polyhedra OBs. Further, virus polyhedra OBs were fed to 3rd instar larvae of Spodoptera exigua, and the survival rate of the infected larvae was counted. The results showed that SeCaspase-5 increased the insecticidal virulence of its recombinant virus polyhedra OBs.

[0018] The eggs of Spodoptera exigua used in the examples of the present invention were purchased from Keyun Company, and the larvae were hatched and propagated by the Sino-US Invertebrate Cell Culture and Cell Engineering Cooperative Research Center of Shandong Province and the Shandong Provincial Key Laboratory of Integrated Pest Management of Plants and Diseases. Spodoptera exigua Se-3 cells were constructed and preserved by the laboratory where the inventors are located; the Escherichia coli competent cell DH10Bac containing the AcMNPV genomic shuttle plasmid bacmid was purchased from Invitrogen. The pMD18-T vector and the restriction endonucleases BamHI and EcoRI were purchased from Takara; the transfection reagent Cellfection II was purchased from Invitrogen; 6-well and 12-well cell culture plates were purchased from NEST Biotechnology Co., Ltd.; primer synthesis and gene sequencing were provided by Shanghai Sangon Biotech Co., Ltd.

[0019] The present invention will be described below in conjunction with specific embodiments and the accompanying drawings.

[0020] Example 1: Cloning and Identification of SeCaspase-5

[0021] 1. Gene Cloning of SeCaspase-5

[0022] By analyzing the genome of Spodoptera exigua SeCaspase-5, gene-specific full-length primers were designed, and cDNA of Spodoptera exigua Se-3 cells was used as a template for PCR amplification. The sequences of the PCR primers used are as follows:

[0023] 5′-AAT GGATCC ATGCAGAGAGAACACAGAGAAGC-3′(BamHI),

[0024] 5′-AAT GAATTC TTACTCGTAGAGGCCAGGGTG-3′(EcoRI).

[0025] After separation of the PCR product by agarose gel electrophoresis, a gene fragment of about 1350 bp in size was obtained. After gel extraction, it was double-digested with restriction enzymes BamHI and EcoRI and ligated into the vector pMD18-T. After screening of the clones and DNA sequencing, the complete ORF of the SeCaspase-5 gene was obtained, with a size of 1362 bp.

[0026]

[0027] The amino acid sequence of its encoded protein is as follows (SEQ ID NO:2): MQREHREAIRSNFTSLVERTDLDSVVTALYEKGVFSEQMIEPFRNNSELERDRKRRLYMDVTRRGPHAFAHLVDALGELGYWDLVRDLDPDSPFSFSSQQRFNPIPQPTTRTRTADNDNFHSLSTSNRPRAEPNRNSTQLQSAPPPPPPAVDNDNSPEKVTAPPFIVKKSTKFMEDDDTKDLKLYRTRGRNRGILLDFTYTEFDNNIEEFRNGVDVDCNNLKYLFDELGFRRLGYLNLTKTETMETLKSLNNVLVNIESVFIVVSSHGYERPHSSDTDVRCKDGQLISLYDIMTYFNNRNMPALIGVPKVFIFQMCRGSSADYAWQSSSAHAPAQMPMPAGDVVYDGQPMAPASAATSALHLYDRPRQTPLYSDILIAHSTLPGLVAHRDGKLGSWYIQALCEVFAARAHDCHVEKLFTLVDKRMQDKFKVQTSSVDRWGFNKRLYLHPGLYE.

[0028] 2. Phylogenetic analysis of SeCaspase-5

[0029] Using the amino acid sequence of SeCaspase-5 as a template, search for and download the amino acid sequences of Caspase-5 from other Lepidoptera insects and Dronc from Drosophila on the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). Use the Mega 5.0 software to perform phylogenetic analysis on SeCaspase-5 and Caspase-5 from other Lepidoptera insects and Dronc from Drosophila, and construct a phylogenetic tree. The results show that the similarity between SeCaspase-5 and Caspase-5 from other Lepidoptera insects is only above 70%.

[0030] 3. Amino acid sequence alignment of SeCaspase-5 and prediction of protein functional domains

[0031] Furthermore, the amino acid sequences of SeCaspase-5 and other Lepidoptera insect Caspase-5 were aligned and analyzed using the ClustalOmega website (https: / / www.ebi.ac.uk / jdispatcher / msa / clustalo) and GeneDoc software. The protein functional domains of SeCaspase-5 were predicted using the SWISS-MODEL website (https: / / swissmodel.expasy.org / interactive), and the results are as Figure 1 shown. SeCaspase-5 contains a total of 453 amino acid residues, including an N-terminal pro-domain, a C-terminal large subunit and a small subunit, which are separated by two cleavage sites. A caspase activation and recruitment domain (CARD) was predicted in the pro-domain of this protein. The large subunit contains a binding site with the motif "SSHG" and an active site with the motif "QMCRG", while the small subunit contains a binding site with the motif "RDGKLG".

[0032] Example 2: Effect of SeCaspase-5 on the infection of baculovirus AcMNPV

[0033] 1. Construction of the SeCaspase-5 recombinant virus bacmid

[0034] The pMD18-T vector plasmid of SeCaspase-5 was double digested with restriction enzymes BamHI and EcoRI, and a green fluorescent protein tag (GFP) was fused to its C-terminus. The obtained gene fragment was then ligated into the donor plasmid pFastBac of the Bac-to-Bac system (Invitrogen). Subsequently, the donor plasmid was transformed into DH10Bac competent cells containing the AcMNPV genome bacmid, and a recombinant virus bacmid was constructed by homologous recombination (the schematic diagram of bacmid construction is as Figure 2 shown in Figure A). Then, according to the instructions of the Bac-to-Bac system, the recombinant virus bacmid was extracted and used as a template. The universal primer M13 / pUCR (5’–CGCCAGGGTTTTCCCAGTCAC–3’) provided by this system and the gene-specific full-length primer of SeCaspase-5 (5’–AAT GGATCCPCR amplification was performed with (ATGCAGAGAGAACACAGAGAAGC–3’) to identify whether the constructed recombinant virus bacmid was correct. At the same time, the recombinant virus bacmid carrying the GFP gene was used as a control. The results of PCR product electrophoresis analysis were as Figure 2 shown in B. GFP fragments with a size of 2476 bp and gene fragments of SeCaspase-5-GFP with a size of 3835 bp were obtained respectively, indicating that the recombinant virus genome bacmid of SeCaspase-5 was correctly constructed. The correctly identified recombinant virus genome SeCaspase-5 bacmid.

[0035] 2. Analysis of apoptosis induction by transfection of SeCaspase-5 recombinant virus bacmid

[0036] Spodoptera exigua Se-3 cells were inoculated into 6-well cell culture plates, with 1×10 6 cells per well. After the cells adhered, the correctly constructed recombinant virus bacmids of GFP and SeCaspase-5 were transfected into the cells using the transfection reagent Cellfectin II. 4 μg of bacmid DNA was transfected into each well. At different time points after transfection (24, 48, 72, 96 hours post transfection, h p.t.), the fluorescence expression, cell morphology, and the production of recombinant virus polyhedra OB in the cells were observed under a fluorescence microscope, and photos were taken. The results were as Figure 3 shown. From 24 to 96 hours after transfection, green fluorescence was expressed in the cells transfected with GFP bacmid, and there was no apoptosis phenomenon. Moreover, the production of virus polyhedra OB (indicated by red arrows) in the cells could be observed, and the number of OB increased with the extension of the infection time. In the cells transfected with SeCaspase-5 bacmid, apoptosis of the cells (indicated by black arrows) could be observed from 24 to 72 hours after transfection, and a small amount of virus polyhedra OB was observed in a small number of cells 72 hours after transfection. It shows that the expression of SeCaspase-5 induced apoptosis.

[0037] 3. Analysis of the insecticidal toxicity of SeCaspase-5 recombinant virus

[0038] At 96 hours after transfection of the above SeCaspase-5 recombinant virus bacmid, the cell precipitate was collected and the cells were disrupted by ultrasonic waves to completely release the virus polyhedra OB in them. The yields of different truncated recombinant virus OB were counted using a hemocytometer. Then, using the GFP recombinant virus polyhedra OB as a control, the 3rd instar larvae of Spodoptera exigua were fed, with 1×10 6A number of OBs were used to count the number of dead Spodoptera exigua larvae every day and calculate the survival rate. The results are as Figure 4 shown. The survival rate of larvae fed with recombinant virus polyhedra OBs of SeCaspase-5 was significantly lower than that of larvae fed with GFP recombinant virus polyhedra OBs.

[0039] Based on the above results, it is indicated that the overexpression of SeCaspase-5 can induce apoptosis during the infection process of AcMNPV, which provides an effective way to improve the insecticidal virulence of baculovirus during the production process.

Claims

1. Application of SeCaspase-5 gene in the preparation of a preparation for improving the insecticidal toxicity of a virus to beet armyworm, wherein the amino acid sequence of the protein encoded by the SeCaspase-5 gene is SEQ ID NO: 2; The preparation is a shuttle plasmid of baculovirus, and the shuttle plasmid is constructed by inserting the nucleic acid fragment of SeCaspase-5 gene into the viral genome.

2. The use according to claim 1, characterized in that The SeCaspase-5 gene has a nucleic acid fragment sequence of SEQ ID NO:1.

Images