Engineering strain for expressing sialylated N-glycosylated recombinant protein as well as construction method and application of engineering strain

Abstract

The invention discloses an engineering strain for expressing sialylated N-glycosylated recombinant protein as well as a construction method and application of the engineering strain, and belongs to the technical field of gene engineering. According to the invention, lacZ gene in Escherichia coli W3110 is knocked out and knocked into an exogenous target gene containing a tetrasaccharide synthesis pathway to obtain Escherichia coli W3110 delta lacZ, then recA gene in Escherichia coli is knocked out and knocked into an exogenous gene containing an Ara promoter and a NeuBCA gene cluster to obtain Escherichia coli WL2 delta recA, and the recombinant Escherichia coli WL2 delta recA is obtained. And finally, transferring a recombinant vector containing a coding mode protein gene, sialic acid synthetase and sialic acid transferase into the escherichia coli to obtain an engineering strain for expressing the sialylated N-glycosylated recombinant protein. The Escherichia coli constructed by the invention can realize efficient sialylation modification of N-glycosylated sugar recombinant protein.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to an engineering strain expressing sialylated N-glycosylated recombinant protein, and a construction method and application thereof. Background Art

[0002] Sialic acid is a functional monosaccharide present on the surface of many biological cells and proteins. It carries a negative charge under physiological pH conditions. The terminal sialic acid modification of recombinant protein oligosaccharides can prolong their serum half-life and improve the stability of biotherapeutics. N-glycosylated recombinant proteins modified with terminal sialic acid have received widespread attention in therapeutic applications.

[0003] At present, most recombinant protein drugs are produced in eukaryotic expression systems, among which CHO cells are the most commonly used. The production of recombinant proteins in mammalian expression systems has the limitations of high production costs, long cycles, and complex production processes. At the same time, incomplete N-glycosylation modification and low sialic acid modification efficiency are also the main problems of this system. In order to improve the homogeneity of sialic acid-modified N-glycosylated recombinant proteins, Meuris and his colleagues developed a "sugar deficiency" pathway in human embryonic kidney (HEK 293)-derived cells. This pathway shortens the sugar chain structure used for glycosylation modification and ultimately produces terminal sialylated trisaccharide (Neu5Ac-α-2,3-Gal-β-1,4-GlcNAc-) N-glycosylated recombinant proteins with a sialic acid modification efficiency of approximately 75%. Although this strategy improves the homogeneity of sialic acid-modified N-glycosylated recombinant proteins expressed in eukaryotic systems, the sugar chain structure used for modification by this system is shorter than the sugar chain existing in the human body (a single antenna consists of at least 7 sugars), which may cause steric hindrance and affect its function. At the same time, the system has defects such as high cost and long cycle, which makes it still unable to meet the requirements of industrial production. Summary of the invention

[0004] In order to solve the problems existing in the prior art, the purpose of the present invention is to provide an engineered strain expressing sialylated N-glycosylated recombinant protein and a construction method and application thereof. The present invention uses the Escherichia coli CRISPR / Cas9 dual plasmid system pEcCas / pEcgRNA to transform the W3110ΔlacZ genome respectively, so that it can construct a sialic acid synthesis pathway, and then construct an engineered strain expressing sialylated N-glycosylated recombinant protein.

[0005] To achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides a method for constructing an engineered strain for expressing sialylated N-glycosylated recombinant protein, comprising the following steps:

[0007] (1) The lacZ gene in Escherichia coli W3110 was knocked out by using the CRISPR / Cas9 dual plasmid system pEcCas / pEcgRNA, and an exogenous target gene containing the PlacUV5-Ptac promoter and the tetrasaccharide synthesis pathway pglB-ΔWecA-pglK-lsgCDEF was knocked in to obtain Escherichia coli W3110ΔlacZ;

[0008] (2) Using the CRISPR / Cas9 dual plasmid system pEcCas / pEcgRNA, the recA gene in Escherichia coli W3110ΔlacZ was knocked out and an exogenous gene containing the Ara promoter and the neuBCA gene cluster was knocked in to obtain Escherichia coli WL2ΔrecA;

[0009] (3) The recombinant vector containing the double expression frame encoding the model protein gene, sialic acid synthase and sialyltransferase was transferred into Escherichia coli WL2ΔrecA to obtain an engineered strain expressing sialylated N-glycosylated recombinant protein.

[0010] Based on the above technical solution, further, the nucleotide sequence of the exogenous target gene described in step (1) is shown as SEQ ID NO.3.

[0011] Based on the above technical scheme, further, the specific process of step (1) is: the exogenous target gene containing PlacUV5-Ptac promoter and tetrasaccharide synthesis pathway pglB-ΔWecA-pglK-lsgCDEF and the pEcgRNA-N20 plasmid are co-transformed into the Escherichia coli W3110 competent cells containing the pEcCas plasmid, the positive single clones are picked, and the recombinant bacteria containing only the pEcgRNA-N20 plasmid and the pEcCas plasmid are eliminated to obtain Escherichia coli W3110ΔlacZ.

[0012] Based on the above technical scheme, further, the process of eliminating the recombinant bacteria containing only the pEcgRNA-N20 plasmid and the pEcCas plasmid in step (1) is: the positive monoclonal clones are inoculated into LB medium containing Kan+rhamnose and LB medium containing sucrose for culture.

[0013] Based on the above technical solution, further, the nucleotide sequence of N20 described in step (1) is shown as SEQ ID NO.2.

[0014] Based on the above technical solution, further, the transfer method described in step (1) is an electrical conversion method with a voltage of 1500-2000V and a time of 3-10ms.

[0015] Based on the above technical solution, further, the nucleotide sequence of the exogenous gene described in step (2) is shown as SEQ ID NO.5.

[0016] Based on the above technical scheme, further, the specific process of step (2) is: the exogenous gene containing the Ara promoter and the neuBCA gene cluster and the pEcgRNA-N20 plasmid are co-transfected into the Escherichia coli W3110ΔlacZ competent cells containing the pEcCas plasmid, the positive single clones are picked, and the recombinant bacteria containing only the pEcgRNA-N20 plasmid and the pEcCas plasmid are eliminated to obtain Escherichia coli WL2ΔrecA.

[0017] Based on the above technical scheme, further, the process of eliminating the recombinant bacteria containing only the pEcgRNA-N20 plasmid and the pEcCas plasmid in step (2) is: the positive monoclonal clones are inoculated into LB medium containing Kan+rhamnose and LB medium containing sucrose for culture.

[0018] Based on the above technical solution, further, the nucleotide sequence of N20 described in step (2) is shown as SEQ ID NO.4.

[0019] Based on the above technical solution, further, the transfer method described in step (2) is an electrical conversion method with a voltage of 1500-2000V and a time of 3-10ms.

[0020] Based on the above technical solution, further, the model protein described in step (3) is Fn3 3.4.4.

[0021] Based on the above technical solution, further, the recombinant vector described in step (3) comprises Amp, colE1 replication region, repressor protein gene lacI, Plac-model protein Fn3 3.4.4-terminator expression frame and P-sialyltransferase plst6-terminator expression frame.

[0022] Based on the above technical solution, further, the nucleotide sequence of the sialyltransferase plst6 gene in the recombinant vector described in step (3) is as shown in SEQ ID NO.1.

[0023] Another aspect of the present invention provides an engineered strain expressing sialylated N-glycosylated recombinant protein obtained by the above construction method.

[0024] The present invention also provides the use of the engineered strain expressing sialylated N-glycosylated recombinant protein in producing sialylated N-glycosylated recombinant protein.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The sialic acid-modified N-glycosylated recombinant protein pathway constructed by the present invention imitates the humanized sialic acid terminal part (Neu5Ac-α-2,6-Gal-β-1,4-GlcNAc), and synthesizes sialylated pentasaccharide (Neu5Ac-α-2,6-Gal-β-1,4-GlcNAc-β-1,3-Gal-β-1,3-GlcNAc-) by co-expressing the glycosyltransferase LsgCDEF from Haemophilus, the NeuBCA enzyme from Campylobacter jejuni, and the α-2,6-sialyltransferase from Photorhabdus in Escherichia coli. The terminal sialylated polysaccharide is transferred under the action of Campylobacter jejuni oligosaccharyltransferase PglB, and then connected to the glycosyl recognition sequence of the receptor protein, thereby completing the pathway of sialic acid-modified N-glycosylated recombinant protein, and exploring the efficiency of sialyltransferase in synthesizing sialylated N-glycoprotein in Escherichia coli strains. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for describing the embodiments are briefly introduced below.

[0028] Figure 1 The map of the pIG6-Fn3 3.4.4-plst6Δn vector constructed in the present invention.

[0029] Figure 2 The present invention is a roadmap for the biosynthetic pathway of sialylated N-glycosylated recombinant protein in Escherichia coli.

[0030] Figure 3 The results of knocking out the recA site in the Escherichia coli W3110ΔlacZ genome; M represents 10000maker, and 1-7 represents knocking out the recA site and knocking in the promoter and neuBCA gene cluster by colony PCR identification.

[0031] Figure 4Figure 2 is the expression of the recombinant plasmid pIG6-Fn3 3.4.4-plst6Δn in the recombinant engineering bacteria in Escherichia coli, wherein A is the expression result of plst6Δn sialyltransferase in Escherichia coli detected by SDS-PAGE stained with Coomassie Brilliant Blue. B is the results of Western blot and lectining blot detection of plst6Δn sialyltransferase expression in Escherichia coli; in the figure, M represents 10-180kDa, negative represents negative unmodified protein, positive represents positive control N-glycosylated protein, and plst6Δn represents sialylated N-glycosylated protein induced by recombinant plasmid pIG6-Fn3 3.4.4-plst6Δn; Figure a is Western blotting using anti-flag M1 antibody, Figure b is detection using Gal-β-1,4-GlcNac-specific ECA lectin, and Figure c is lectin blotting using Neu5Ac-α-2,6-Gal / GalNAc-specific SNA to detect the effect of α2,6-siaT (α2,6 sialyltransferase) on the biosynthesis of humanized sialylated glycosylation.

[0032] Figure 5 Mass spectrometry results of the recombinant plasmid pIG6-Fn3 3.4.4-plst6Δn expressed in Escherichia coli WL2△recA. DETAILED DESCRIPTION

[0033] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solution of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments. Unless otherwise specified, the experimental equipment, materials, reagents, etc. involved in the present invention can be obtained from commercial channels.

[0034] Example 1: Construction of metabolic pathways linking sialic acid synthesis and oligosaccharide chain modification

[0035] Using pIG6-Fn3 3.4.4-plst6 vector (including Amp, colE1 replication region, repressor protein gene lacI, Plac-model protein Fn3 3.4.4-terminator expression frame and P-sialyltransferase plst6-neuBCA-terminator expression frame) as a template, EcoNI and AvaI restriction endonucleases were used for digestion at 37°C for 15h, the neuBCA gene fragment was cut off, and the linearized vector was obtained after gel cutting and recovery. Then, the ends of the DNA fragments were smoothed (linearized vector 6.32μl, 10×T4 DNA Polymerase Buffer 1μl, 0.1% BSA 1μl, 1.77mM dNTP Mixture 0.68μl, 70℃ reaction for 5min followed by 37℃ reaction for 5min, followed by adding 1μl T4 DNA Polymerase, react at 37℃ for 5min, shake vigorously to inactivate the enzyme, and finally connect overnight for 16h to obtain the recombinant vector pIG6-Fn3

[0036] 3.4.4-plst6Δn (including Amp, colE1 replication region, repressor protein gene lacI, Plac-model protein Fn33.4.4-terminator expression frame and P-sialyltransferase plst6-terminator expression frame), the nucleotide sequence of the sialyltransferase plst6 gene in the vector is shown in SEQ ID NO.1.

[0037] Example 2 Construction of a stable engineering strain for the tetrasaccharide synthesis pathway of Escherichia coli (refer to Example 2 of invention patent CN118360304A)

[0038] 1) Designing the target N20 specifically includes: designing the CRISPR target N20 sequence as ctgacaatggcagatcccag (shown in SEQ ID NO.2), designing N20-F (tagtctgacaatggcagatcccag) and N20-R (aaacctgggatctgccattgtcag), and synthesizing them.

[0039] 2) Mix 10 μL N20-F with 10 μL N20-R and anneal to prepare the N20 target linker at 95°C for 5 min; then reduce at 5°C / min to 16°C for 10 min.

[0040] 3) Construction of pEcgRNA-N20-lacZ vector: The pEcgRNA vector was digested with BsaⅠ restriction endonuclease, and the band at about 2000 bp was recovered by agarose gel electrophoresis and connected with the N20 target linker by T4. The system is as follows:

[0041] 10x T4 DNA ligase buffer 1μL, pEcgRNA BsaⅠ digested vector recovery fragment 50-100ng, N20 target linker 1μL, T4 DNA ligase 1μL, ddH2O to 10μL, react at 16℃ for 1h.

[0042] S1, amplification of exogenous target gene fragments, which specifically includes the following steps:

[0043] Using the pC15-Ara-pglB-ΔWecA-pglK-lsgCDEF vector (reference patent CN115181752A) as a template, the tetrasaccharide synthesis pathway pglB-ΔWecA-pglK-lsgCDEF was amplified, and then based on the vectors pIG6-FRT-Kan-FRT-Sia and pIG6-FRT-Kan-FRT-PlacUV5-Ptac-Sia constructed in the laboratory (based on pIG6-FRT-Kan-FRT-Sia, the promoter PlacUV5-Ptac was inserted between FRT and Sia, and the nucleotide sequence of PlacUV5-Ptac is (tttacactttatgcttccggctcgtataatgtgtggttgacaattaatcatcggctcgtataatg), homology arm primers were designed respectively, and finally overlapping PCR was performed.

[0044] Upstream homology arm F1: tcggtagtgggatacgacgataccgaagacagct

[0045] Upstream homology arm R1:catatggtgtaggctggagctgcttcagctgtttcctgtgtgaaattgttatccgc

[0046] Promoter F2:gcggataacaatttcacacaggaaacagctgaagcagctccagcctacaccatatg

[0047] Promoter R2: gggttttttaaatactcttttttcaacatggtatatctccttcttaaagttaaac

[0048] Tetrasaccharide synthesis pathway F3:gtttaactttaagaaggagatataccatgttgaaaaaagagtatttaaaaaaccc

[0049] Tetrasaccharide synthesis pathway

[0050] R3:cgaaatacgggcagacatggcctgcccggttattatttacgtaaaaaagtttgataaag

[0051] Lower homology arm F4:ctttatcaaacttttttacgtaaataataaccgggcaggccatgtctgcccgtatttcg

[0052] Lower homology arm R4: atggtgaacatgatgccgacaatcgaggcac

[0053] After amplification, the amplified product was recovered using a DNA gel recovery kit, followed by overlapping PCR, using the upper and lower homologous arms, PlacUV5-Ptac promoter and tetrasaccharide as templates for amplification, and then the amplified product was recovered using a DNA gel recovery kit to obtain an exogenous target gene fragment (nucleotide sequence as shown in SEQ ID NO.3).

[0054] S2. Preparation of Escherichia coli competent cells

[0055] The pEcCas plasmid was transferred into the wild Escherichia coli W3110 to obtain Escherichia coli (W3110 / pEcCas) colonies containing the pEcCas plasmid, and further to obtain Escherichia coli (W3110 / pEcCas) competent cells containing the pEcCas plasmid;

[0056] Among them, the process of preparing competent cells and transferring pEcCas plasmids was completed according to the Molecular Cloning Experiment Guide (Green, MR, Sambrook. Molecular Cloning Experiment Guide: 4th Edition [M]. Science Press, 2013. p138);

[0057] Preparation of Escherichia coli (W3110 / pEcCas) competent cells containing pEcCas plasmid specifically comprises the following steps:

[0058] ① Pick a single colony of Escherichia coli containing the pEcCas plasmid and inoculate it into 10 mL of LB liquid medium, and culture it overnight at 37°C and 220 rpm;

[0059] ② Take 4 mL of fresh bacterial solution and inoculate it into 400 mL of LB liquid medium, and culture it at 37°C and 220 rpm until the OD 600 to about 0.2, and L-Ara with a final concentration of 10 mmol / L was added to induce pEcCas to express homologous recombinase;

[0060] ③ Waiting for OD 600When the concentration reaches about 0.5, collect the bacterial solution in a pre-cooled centrifuge tube and place it on ice for 15 minutes.

[0061] Centrifuge at 4000 rpm for 8 min at 4°C;

[0062] ④Discard the supernatant, resuspend the cells with 50 mL of 4°C pre-cooled ultrapure water, place on ice for 15 min, and centrifuge at 4°C, 5000 rpm for 8 min;

[0063] ⑤Repeat step ④;

[0064] ⑥Discard the supernatant and resuspend the cells in 50 mL of 10% glycerol precooled at 4°C. Place on ice for 15 minutes and centrifuge at 4°C, 5000 rpm for 8 minutes.

[0065] ⑦Repeat step ⑥;

[0066] ⑧Discard the supernatant, resuspend the cells with 400 μL of 10% glycerol precooled at 4°C, dispense into 100 μL / tube, and store at -80°C.

[0067] S3, Escherichia coli lac Z gene knockout, PlacUV5-Ptac promoter and tetrasaccharide synthesis pathway knock-in

[0068] S31, transferring the above-mentioned exogenous target gene fragment and pEcgRNA N20 into competent cells of Escherichia coli containing pEcCas plasmid to obtain recombinant Escherichia coli, comprising the following steps:

[0069] ① Mix 100 μl of W3110 Escherichia coli competent cells containing pEcCas plasmid with 100 ng of pEcgRNA N20 and 400 ng of exogenous target gene fragment, i.e., donor DNA; place on ice for 20 min and pre-cool the electroporation cup;

[0070] ② Transfer the competent cell culture containing pEcgRNA N20 and donor DNA to a 1 mm electric shock cup precooled to 0°C, and pulse electric shock (voltage of 1800V) for 5ms;

[0071] ③After the electroporation is completed, immediately add 1 ml of SOC medium to the electroporation cup, gently blow and mix, and transfer to a clean 1.5 ml EP tube;

[0072] ④ Place the EP tube containing the mixture in an air shaker at 37°C and 220 rpm for 1 hour;

[0073] ⑤ Centrifuge and discard the supernatant, resuspend the bacteria in 200μL SOC, spread on Kan+Spec LB solid medium, and culture at 37℃ overnight.

[0074] Pick the single colony obtained in the previous step and resuspend it in 20 μL ultrapure water, heat and lyse at 99℃ for 10 minutes, centrifuge at 8000rpm for 2 minutes, and transfer the supernatant to a new tube as a PCR template. After the reaction is completed, agarose gel electrophoresis is performed to detect the size of the target band and preliminarily determine the knockout result. Figure 3 Column 2. Then, the gene knock-out and knock-in were finally confirmed by sequencing to ensure that the knocked-in gene fragment had no mutation or other problems and that the lac Z gene sequence was successfully knocked out.

[0075] In order to eliminate the recombinant bacteria containing only pEcCas and pEcgRNA-N20 plasmids, pick the positive clones in LB liquid medium (containing 50 μg / mL Kan, 10 mM rhamnose), culture at 37°C and 220 rpm for about 6 h, aspirate 20 ul of bacterial solution, add it to 1.5 ml LB medium, culture at 37°C and 220 rpm for 1.5 h, spread it on a sucrose (10 g / L) plate, and culture it at 37°C overnight to eliminate pEcCas.

[0076] Spot the plate on Kan, Spec and LB empty plates respectively. If the cell grows only on the LB empty plate but not on the other two plates, the two plasmids have been eliminated and a non-resistant recombinant Escherichia coli is obtained, which is named Escherichia coli W3110ΔlacZ (WL2).

[0077] Example 3 Construction of a stable engineered strain of Escherichia coli sialic acid synthesis pathway

[0078] 1) Designing the target N 2 0 specifically includes: designing a CRISPR target N 2 0 sequence of cgaaaacaaacagaaagcgt (shown in SEQ ID NO. 4), designing N 2 0-F (tagtcgaaaacaaacagaaagcgt) and N20-R (aaacacgctttctgtttgttttcg), and synthesizing them.

[0079] 2) Mix 10 μL N20-F with 10 μL N20-R and anneal to prepare the N20 target linker at 95°C for 5 min; then reduce at 5°C / min to 16°C for 10 min.

[0080] 3) Construction of pEcgRNA-N20 vector: The pEcgRNA vector was digested with BsaⅠ restriction endonuclease, and the band at about 2000 bp was recovered by agarose gel electrophoresis and connected with the N20 target linker by T4. The system is as follows:

[0081] 10x T4 DNA ligase buffer 1μL, pEcgRNA BsaⅠ digested vector recovery fragment 50-100ng, N20 target linker 1μL, T4 DNA ligase 1μL, ddH2O to 10μL, react at 16℃ for 1h.

[0082] S1, amplification of exogenous target gene fragments, which specifically includes the following steps:

[0083] First, the neuBCA gene cluster from Campylobacter jejuni was amplified, and then the Ara promoter was amplified based on the pC15-Ara-pglB-ΔWecA-pglK-lsgCDEF vector (reference patent CN115181752A) as a template, and homology arm primers were designed on both sides of the Ara promoter, respectively:

[0084] Upstream homology arm F1: tagcgaaagtgattaccgatattgcc

[0085] Upstream homology arm R1:gaaaaagtgaatgatgtagccgtcaattttactcctgtcatgccgggtaataccggata promoter F2:tatccggtattacccggcatgacaggagtaaaattgacggctacatcattcactttttc

[0086] Promoter R2:ctttatgattatattttgtatttttatttctttcatcatatgtaattcctcctgttagcc

[0087] neuBCA F3:ggctaacaggaggaattacatatgatgaaagaaataaaaatacaaaatataatcataag

[0088] neuBCA R3:cgcagatgcgacccttgtgtatcaaacaagacgattattttttccatatctgttcaacc

[0089] Downstream homology arm

[0090] F4:ggttgaacagatatggaaaaaataatcgtcttgtttgatacacaagggtcgcatctgcg

[0091] Downstream homology arm R4:cacgatagagcagaaaacgctggatc

[0092] After amplification, the amplified product was recovered using a DNA gel recovery kit. After recovery, overlapping PCR was performed to obtain a gene fragment in which the upstream and downstream homology arms were connected to the Ara promoter and the neuBCA gene cluster. The gene sequence is shown in SEQ ID NO.5. The amplified product was then recovered using a DNA gel recovery kit.

[0093] S2. Preparation of Escherichia coli competent cells

[0094] The pEcCas plasmid was transferred into the above-mentioned Escherichia coli W3110ΔlacZ (WL2) to obtain Escherichia coli (WL2 / pEcCas) colonies containing the pEcCas plasmid, and further to obtain Escherichia coli (WL2 / pEcCas) competent cells containing the pEcCas plasmid;

[0095] Among them, the process of preparing competent cells and transferring pEcCas plasmids was completed according to the Molecular Cloning Experiment Guide (Green, MR, Sambrook. Molecular Cloning Experiment Guide: 4th Edition [M]. Science Press, 2013. p138);

[0096] Preparation of Escherichia coli (WL2 / pEcCas) competent cells containing pEcCas plasmid specifically comprises the following steps:

[0097] ① Pick a single colony of Escherichia coli containing the pEcCas plasmid and inoculate it into 10 mL of LB liquid medium, and culture it overnight at 37°C and 220 rpm;

[0098] ② Take 4 mL of fresh bacterial solution and inoculate it into 400 mL of LB liquid medium, and culture it at 37°C and 220 rpm until the OD 600 to about 0.2, and L-Ara with a final concentration of 10 mmol / L was added to induce pEcCas to express homologous recombinase;

[0099] ③ Waiting for OD 600 When the concentration reaches about 0.5, collect the bacterial solution in a pre-cooled centrifuge tube and place it on ice for 15 minutes.

[0100] Centrifuge at 4000 rpm for 8 min at 4°C;

[0101] ④Discard the supernatant, resuspend the cells with 50 mL of 4°C pre-cooled ultrapure water, place on ice for 15 min, and centrifuge at 4°C, 5000 rpm for 8 min;

[0102] ⑤Repeat step ④;

[0103] ⑥Discard the supernatant and resuspend the cells in 50 mL of 10% glycerol precooled at 4°C. Place on ice for 15 minutes and centrifuge at 4°C, 5000 rpm for 8 minutes.

[0104] ⑦Repeat step ⑥;

[0105] ⑧Discard the supernatant, resuspend the cells with 400 μL of 10% glycerol precooled at 4°C, dispense into 100 μL / tube, and store at -80°C.

[0106] S3, Escherichia coli recA gene knockout, Ara promoter and neuBCA gene cluster knock-in

[0107] S31, transferring the exogenous target gene fragment (i.e., the gene fragment connected to the upstream and downstream homology arms, the Ara promoter, and the neuBCA gene cluster) and pEcgRNA N20 into the Escherichia coli WL2 / pEcCas competent cells to obtain recombinant Escherichia coli, comprising the following steps:

[0108] ① Mix 100 μl of pEcCas-containing Escherichia coli competent cells with 100 ng of pEcgRNA N20 and 400 ng of exogenous target gene fragment, i.e., donor DNA; place on ice for 20 min and pre-cool the electroporation cuvette;

[0109] ② Transfer the competent cell culture containing pEcgRNA N20 and donor DNA to a 1 mm electric shock cup precooled to 0°C, and pulse electric shock (voltage of 1800V) for 5ms;

[0110] ③After the electroporation is completed, immediately add 1 ml of SOC medium to the electroporation cup, gently blow and mix, and transfer to a clean 1.5 ml EP tube;

[0111] ④ Place the EP tube containing the mixture in an air shaker at 37°C and 220 rpm for 1 hour;

[0112] ⑤ Centrifuge and discard the supernatant, resuspend the bacteria in 200μL SOC, spread on Kan+Spec LB solid medium, and culture at 37℃ overnight.

[0113] Pick the single colony obtained in the previous step and resuspend it in 20 μL ultrapure water, heat and lyse at 99℃ for 10 minutes, centrifuge at 8000rpm for 2 minutes, and transfer the supernatant to a new tube as a PCR template. After the reaction is completed, agarose gel electrophoresis is performed to detect the size of the target band and preliminarily determine the knockout result. Figure 3 Columns 1 to 7 of the sequence. Then, the gene knock-out and knock-in were finally confirmed by sequencing to ensure that the knocked-in gene fragment had no mutation or other problems and that the recA gene sequence was successfully knocked out.

[0114] In order to eliminate the recombinant bacteria containing only pEcCas and pEcgRNA-N20 plasmids, pick the positive clones in LB liquid medium (containing 50 μg / mL Kan, 10 mM rhamnose), culture at 37°C and 220 rpm for about 6 h, aspirate 20 ul of bacterial solution, add it to 1.5 ml LB medium, culture at 37°C and 220 rpm for 1.5 h, spread it on a sucrose (10 g / L) plate, and culture it at 37°C overnight to eliminate pEcCas.

[0115] Spot the plate on Kan, Spec and LB empty plates respectively. If the strain grows only on the LB empty plate but not on the other two plates, the two plasmids have been eliminated and the resulting non-resistant recombinant Escherichia coli is named WL2ΔrecA.

[0116] Example 4 Sialylation and glycosylation of recombinant proteins in Escherichia coli

[0117] The vector pIG6-Fn3 3.4.4-plst6Δn constructed in Example 1 was transferred into the Escherichia coli chassis cell WL2ΔrecA constructed in Example 2 to obtain a recombinant Escherichia coli strain carrying a sialylated N-glycosylated modified recombinant protein expression vector, and the positive Escherichia coli strains with successful protein expression were screened out as transformants. The transformants were inoculated onto a LB solid culture medium plate containing ampicillin (100 μg / mL) and cultured at 37°C for 12 hours. After screening out a single clone, it was inoculated into 3 mL LB liquid culture medium containing ampicillin (100 μg / mL) and cultured at 220 rpm and 37°C for 12 hours. Then, the bacterial liquid was inoculated into an LB liquid culture medium containing ampicillin (100 μg / mL) at a volume ratio of 1:100, and cultured at 220 rpm and 37°C until OD 600 The value was 0.6-0.8, IPTG was added, and samples were collected after induction for 16 hours. The cells were collected by centrifugation at 8000 rpm and 4°C, and the supernatant containing sialic acid-modified N-glycosylated recombinant protein was obtained by ultrasonic disruption, low-temperature high-speed centrifugation, etc.

[0118] The nickel column was equilibrated with equilibration buffer for 10 column volumes, and the supernatant obtained above was equilibrated and loaded onto the column at a low speed. After the sample was loaded onto the column, it was eluted with a buffer containing 20 mM imidazole for 20 column volumes, and then gradient eluted with buffers containing 40, 80, and 120 mM imidazole concentrations, respectively. The eluate was collected, and the separated and purified recombinant protein was the sialic acid-modified N-glycosylated recombinant protein. The results are shown in Figure 4 A.

[0119] Example 5 Detection of Escherichia coli WL2ΔrecA for efficient production of sialylated N-glycosylated recombinant proteins in vivo

[0120] Western Blotting detection used anti-FLAG M1 monoclonal antibody produced by Sigma as primary antibody and horseradish peroxidase-labeled goat anti-mouse IgG produced by Solarbio as secondary antibody. Unglycosylated recombinant protein Fn3 3.4.4 (the recombinant protein Fn3 3.4.4 gene carries a FLAG tag sequence at the 5' end and a DQNAT sequence encoding the pglB oligosaccharide transferase recognition site at the 3' end, and a 6-histidine tag sequence is introduced downstream) was used as a negative control. Plasmid-induced N-glycosylated recombinant protein (pIG6 as the vector backbone, "sialylation pathway" includes Lac promoter-ompA leader peptide-Fn3 3.4.4-DQNAT sequence-T7 terminator-regulatory region-plst6-ompA rbs-neuBCA) was used as a positive control to detect and analyze the sialylated N-glycosylated recombinant protein. The sialylation glycosylation of the recombinant protein was determined by comparing the molecular mobility and lectin detection. The results are shown in Figure 4 B. The molecular weight of the recombinant protein increased after sialylation N-glycosylation modification. Although the sialylation efficiency did not reach 100%, the yield of sialylated glycoprotein increased significantly. The protein obtained by transferring the pIG6-Fn33.4.4-plst6Δn recombinant vector into the strain WL2ΔrecA was detected by mass spectrometry (MALDI-TOF) and found that the protein produced by this strain had a high single sialic acid sugar epitope modification efficiency. Figure 5 Among them, 13239.005 corresponds to the protein modified by tetrasaccharide oligosaccharide chain Gal-β-1,4-GlcNAc-β-1,3-Gal-β-1,3-GlcNAc-N-glycosylation, and 13530.817 corresponds to the protein further modified by sialylation.

[0121] Proteins modified with Neu5Ac-α-2,6-Gal-β-1,4-GlcNAc-β-1,3-Gal-β-1,3-GlcNAc-oligosaccharide chains. This indicates that about 60%-70% of sialylated glycosylation exists in glycosylated proteins; α-2,6 sialic acid-modified glycoproteins and glycolipids can act as virus receptors, affecting viral invasion and replication, and therefore play an important role in resisting viral infection.

[0122] The embodiments of the present invention are not limited thereto. According to the above contents of the present invention, according to the common technical knowledge and general methods in the art, without departing from the above basic technical ideas of the present invention, the present invention may also have other embodiments. For example, other gene clusters expressing biosynthesis may be integrated into different Escherichia coli genomes for expression. Therefore, the present invention may also make other various forms of modification, replacement or change, all of which fall within the scope of the present invention.

Claims

1. A method for constructing an engineered strain expressing sialylated N-glycosylated recombinant protein, characterized in that: The steps include: (1) The lacZ gene in Escherichia coli W3110 was knocked out by using the CRISPR / Cas9 dual plasmid system pEcCas / pEcgRNA, and an exogenous target gene containing the PlacUV5-Ptac promoter and the tetrasaccharide synthesis pathway pglB-ΔWecA-pglK-lsgCDEF was knocked in to obtain Escherichia coli W3110ΔlacZ; (2) Using the CRISPR / Cas9 dual plasmid system pEcCas / pEcgRNA, the recA gene in Escherichia coli W3110ΔlacZ was knocked out and an exogenous gene containing the Ara promoter and the neuBCA gene cluster was knocked in to obtain Escherichia coli WL2ΔrecA; (3) The recombinant vector containing the double expression frame encoding the model protein gene, sialic acid synthase and sialyltransferase was transferred into Escherichia coli WL2ΔrecA to obtain an engineered strain expressing sialylated N-glycosylated recombinant protein.

2. The construction method according to claim 1, characterized in that: The nucleotide sequence of the exogenous target gene described in step (1) is shown in SEQ ID NO.

3.

3. The construction method according to claim 1, characterized in that: The specific process of step (1) is as follows: the exogenous target gene containing PlacUV5-Ptac promoter and tetrasaccharide synthesis pathway pglB-ΔWecA-pglK-lsgCDEF and the pEcgRNA-N20 plasmid are co-transfected into the competent cells of Escherichia coli W3110 containing the pEcCas plasmid, positive single clones are picked, and recombinant bacteria containing only the pEcgRNA-N20 plasmid and the pEcCas plasmid are eliminated to obtain Escherichia coli W3110ΔlacZ.

4. The construction method according to claim 3, characterized in that: The nucleotide sequence of N20 in step (1) is shown in SEQ ID NO.2; the transfer method is electroporation, with a voltage of 1500-2000V and a time of 3-10ms.

5. The construction method according to claim 1, characterized in that: The nucleotide sequence of the exogenous gene described in step (2) is shown in SEQ ID NO.

5.

6. The construction method according to claim 1, characterized in that: The specific process of step (2) is as follows: the exogenous gene containing the Ara promoter and the neuBCA gene cluster is co-transfected with the pEcgRNA-N20 plasmid into the Escherichia coli W3110ΔlacZ competent cells containing the pEcCas plasmid, positive single clones are picked, and recombinant bacteria containing only the pEcgRNA-N20 plasmid and the pEcCas plasmid are eliminated to obtain Escherichia coli WL2ΔrecA.

7. The construction method according to claim 6, characterized in that: The nucleotide sequence of N20 in step (2) is shown in SEQ ID NO.4; the transfer method is electroporation, with a voltage of 1500-2000V and a time of 3-10ms.

8. The construction method according to claim 1, characterized in that: The model protein described in step (3) is Fn33.4.4; the recombinant vector comprises Amp, colE1 replication region, repressor protein gene lacI, Plac-model protein Fn33.4.4-terminator expression frame and P-sialyltransferase plst6-terminator expression frame; the nucleotide sequence of the sialyltransferase plst6 gene in the recombinant vector is shown in SEQ ID NO.

1.

9. An engineered strain expressing sialylated N-glycosylated recombinant protein obtained by the construction method according to any one of claims 1 to 8.

10. Use of the engineered strain expressing sialylated N-glycosylated recombinant protein according to claim 9 in producing sialylated N-glycosylated recombinant protein.

Images