Method for preparing wheat humidity-sensitive male sterile material and related gene thereof

Abstract

The invention relates to the technical field of biology, in particular to a method for preparing a wheat humidity-sensitive male sterility material and a related gene of the wheat humidity-sensitive male sterility material. The method comprises the following steps: reducing the activity of protein in wheat, reducing the content of protein in wheat, inhibiting the expression of coding genes of protein in wheat or knocking out the coding genes of protein in wheat to obtain humidity-sensitive male sterile wheat; the protein is TaUGT-A, TaUGT-B and TaUGT-D. The amino acid sequence of the TaUGT-A is as shown in SEQ ID NO: 4, the amino acid sequence of the TaUGT-B is as shown in SEQ ID NO: 5, and the amino acid sequence of the TaUGT-D is as shown in SEQ ID NO: 6. The humidity-sensitive male sterile wheat is sterile in a natural environment and can recover fertility in a high-humidity environment, so that the humidity-sensitive male sterile wheat has a good application prospect in wheat two-line method crossbreeding.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a method for preparing a moisture-sensitive male sterile material of wheat and related genes thereof. Background Art

[0002] As the world's population continues to grow, the need to increase food production has become increasingly urgent. As the third largest food crop, wheat production is insufficient to meet future food demand under the current planting model. The use of hybrid vigor is the key to increasing its production, and male sterility is the ultimate way to use hybrid vigor.

[0003] Male sterility includes cytoplasmic male sterility and nuclear male sterility. Cytoplasmic male sterility can be developed into a three-line hybrid production system, but due to the cytoplasmic homogeneity of the sterile line and the narrow genetic resources of the restorer line, the genetic diversity of the seeds is low, and they are easily infected by pests and diseases during production and suffer losses. Stable nuclear male sterility-related genes can be used for hybrid production through genetic engineering and molecular manipulation using SPT (Seed production technology), but this technology is subject to transgenic supervision and hybrid screening depends on the seed sorting system. The fertility of some nuclear male sterile plants is affected by environmental changes, such as light-sensitive male sterility and temperature-sensitive male sterility. The environmentally sensitive type is an ideal male sterile material and is the application basis of the two-line method, but the current system is easily affected by light and temperature fluctuations, which makes the purity of hybrid seeds low and poses a safety hazard to seed production.

[0004] Therefore, an economical, efficient and stable two-line method is the key to achieve hybrid production, but the current genetic resources of cloned GMS-related genes in wheat are still not rich enough to meet future breeding needs. Humidity-sensitive male sterility was first discovered in rice. Its main feature is that pollen loses water and becomes inactivated rapidly in a normal humidity environment, resulting in male sterility. However, when pollen is pollinated in a high humidity environment, its fertility can be restored. Compared with rice, wheat is a dryland crop, and its humidity-sensitive male sterility has greater utilization value. Gene editing can be used to knock out the target gene in the wheat genome to obtain wheat humidity-sensitive male sterile mutants, providing more germplasm resources for wheat hybrid breeding. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to prepare moisture-sensitive male sterile wheat.

[0006] In order to solve the technical problem, the present invention provides a method for preparing moisture-sensitive male sterile wheat, comprising: reducing the activity of protein in wheat, reducing the content of protein in wheat, inhibiting the expression of protein encoding genes in wheat or knocking out protein encoding genes in wheat to obtain moisture-sensitive male sterile wheat;

[0007] The proteins are TaUGT-A, TaUGT-B and TaUGT-D, wherein the amino acid sequence of TaUGT-A is as follows

[0008] The amino acid sequence of TaUGT-B is shown in SEQ ID NO:4, the amino acid sequence of TaUGT-B is shown in SEQ ID NO:5, and the amino acid sequence of TaUGT-D is shown in SEQ ID NO:6.

[0009] The TaUGT-A coding gene has the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having more than 90% identity with the nucleotide sequence shown in SEQ ID NO: 1; the TaUGT-B coding gene has

[0010] The nucleotide sequence shown in SEQ ID NO:2 or a nucleotide sequence with more than 90% identity to the nucleotide sequence shown in SEQ ID NO:2; the TaUGT-D encoding gene has the nucleotide sequence shown in SEQ ID NO:3 or a nucleotide sequence with more than 90% identity to the nucleotide sequence shown in SEQ ID NO:3.

[0011] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. The above 90% identity can be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more than 99% identity.

[0012] The method can be achieved by performing site-specific editing on the gene encoding the protein through the CRISPR gene editing system.

[0013] The CRISPR gene editing system may be a CRISPR-Cas9 system; the target sequence of the protein encoding gene used in the CRISPR-Cas9 system may be target sequence 1 or target sequence 2;

[0014] The target sequence 1 is as follows (a1), (a2) or (a3):

[0015] (a1) the nucleotide sequence shown in SEQ ID NO:7;

[0016] (a2) a nucleotide sequence derived from (a1) that has more than 90% identity with the nucleotide sequence defined in (a1);

[0017] (a3) a nucleotide sequence derived from (a1) that hybridizes to the nucleotide sequence defined in (a1) under stringent conditions;

[0018] The target sequence 2 is as follows (b1), (b2) or (b3):

[0019] (b1) the nucleotide sequence shown in SEQ ID NO:8;

[0020] (b2) a nucleotide sequence derived from (b1) that has more than 90% identity with the nucleotide sequence defined in (b1);

[0021] (b3) A nucleotide sequence derived from (b1) which hybridizes with the nucleotide sequence defined by (b1) under stringent conditions.

[0022] The stringent conditions may be hybridization and washing the membrane twice at 68°C in a solution of 2×SSC, 0.1% SDS, each for 5 min, and hybridization and washing the membrane twice at 68°C in a solution of 0.5×SSC, 0.1% SDS, each for 15 min.

[0023] The method can obtain moisture-sensitive male sterile wheat by introducing the coding gene of the sgRNA targeting the target sequence 1 and / or the target sequence 2 and the coding gene of Cas9 into wheat.

[0024] In the above method, the coding gene of the sgRNA can be achieved by introducing a recombinant vector containing the coding gene of the sgRNA into wheat.

[0025] The recombinant vector may be pBUE411-spacer1-spacer2, which is a recombinant vector obtained by inserting the target sequence 1 and the target sequence 2 between the BsaI restriction site of the pBUE411 plasmid. pBUE411-spacer1-spacer2 expresses Cas9, sgRNA1 and sgRNA2, wherein sgRNA1 contains an RNA sequence encoded by target sequence 1, and sgRNA2 contains an RNA sequence encoded by target sequence 2.

[0026] In the above method, the water loss rate of the pollen of the humidity-sensitive male-sterile wheat is higher than that of the pollen of the wild-type wheat; the fertility of the humidity-sensitive male-sterile wheat can be restored by artificial moist pollination.

[0027] The water loss rate may be a water loss rate under a humidity condition of 65%≥RH≥30%.

[0028] The present invention also provides a product for regulating wheat fertility, which is used to reduce the activity of proteins TaUGT-A, TaUGT-B and TaUGT-D in wheat, reduce the content of proteins TaUGT-A, TaUGT-B and TaUGT-D in wheat, inhibit the expression of genes encoding proteins TaUGT-A, TaUGT-B and TaUGT-D in wheat, or knock out genes encoding proteins TaUGT-A, TaUGT-B and TaUGT-D in wheat.

[0029] The product may be the reagents and / or instruments required for site-specific editing of the coding genes of the proteins TaUGT-A, TaUGT-B and TaUGT-D using the CRISPR / Cas9 system.

[0030] The reagent may be reagent 1, reagent 2, reagent 3, reagent 4 or reagent 5;

[0031] The reagent 1 is R1) or R2):

[0032] R1) sgRNA targeting the target sequence 1;

[0033] R2) sgRNA targeting the target sequence 2;

[0034] The reagent 2 is a combination of the reagent 1 and Cas9;

[0035] The reagent 3 is a recombinant vector containing the coding gene of R1) and / or R2);

[0036] The reagent 4 is a composition consisting of the reagent 3 and a recombinant vector containing a gene encoding Cas9;

[0037] The reagent 5 is a recombinant vector containing the coding gene of R1) and / or R2) and the coding gene of Cas9.

[0038] The use of the proteins TaUGT-A, TaUGT-B and TaUGT-D or their encoding genes in regulating wheat fertility also falls within the protection scope of the present invention.

[0039] The application of the moisture-sensitive male sterile wheat with the deposit number of CGMCC No.46083 in wheat breeding also falls within the protection scope of the present invention.

[0040] In the above application, the method for restoring or improving the fertility of the humidity-sensitive male sterile wheat is: during the flowering period of the humidity-sensitive male sterile wheat, the relative humidity of the environment where the flower spike is located is maintained at not less than 90%.

[0041] The invention also provides a method for restoring or improving wheat fertility, comprising: during the flowering period of wheat, maintaining the relative humidity of the environment where the flower spike is located at not less than 90%; the wheat is humidity-sensitive male sterile wheat, and its preservation number is CGMCC No.46083.

[0042] The present invention obtains a wheat moisture-sensitive male sterile material by controlling the expression of wheat TaUGT-A, TaUGT-B and TaUGT-D. When the relative humidity of the environment is 45%-65%, the pollen of the CRISPR homozygous triple mutant taugt-aabbdd of wheat TaUGT-A, TaUGT-B and TaUGT-D begins to dehydrate and shrivel immediately after release, and all pollens are completely shriveled within 1 minute; while the pollen grains of the wild-type wheat Fielder, the single mutant (taugt-aaBBDD, taugt-AAbbDD, taugt-AABBdd) and double mutant (taugt-aabbDD, taugt-aaBBdd, taugt-AAbbdd) of the TaUGT gene begin to partially lose water and shrivel only 5 minutes after release, and it takes about 35 minutes (15 minutes) for all pollens to be completely shriveled. Figure 4 and Figure 5 ). Under natural environment (relative humidity of 30%-60%), after the plants matured, the triple mutant taugt-aabbdd hardly set seeds, with an average of 5.63 seeds per ear, showing male sterility; while the average number of seeds per ear for the single and double mutants of the wild-type wheat Fielder and TaUGT genes was 43.17-45.04 ( Figure 6 ). The triple mutant taugt-aabbdd was artificially pollinated with moist air. In an environment with a relative humidity of not less than 90%, the fruiting capacity of the triple mutant taugt-aabbdd could be restored ( Figure 7 ). Therefore, the moisture-sensitive male sterile material of wheat prepared by the method of the present invention is sterile or has very low fruiting property under natural environment, but can restore fertility under high humidity environment, and has good application prospect in wheat two-line hybrid breeding.

[0043] In the taugt-aaBBDD, taugt-AAbbDD, taugt-AABBdd, taugt-aabbDD, taugt-aaBBdd, taugt-AAbbdd and taugt-aabbdd mutants described in this article, the lowercase letters a, b, d after taugt- indicate that the TaUGT gene of the subgenome has mutated, and the uppercase letters A, B, D after taugt- indicate that the TaUGT gene of the subgenome has not mutated. In this article, a single mutant refers to a TaUGT gene mutation in only one of the three subgenomes A, B, and D, a double mutant refers to a TaUGT gene mutation in two of the three subgenomes A, B, and D, and a triple mutant refers to a TaUGT gene mutation in all three subgenomes A, B, and D.

[0044] The patent deposit information of the moisture-sensitive male sterile wheat provided by the present invention is as follows:

[0045] Biomaterial: taugt-aabbdd

[0046] Classification and nomenclature: Wheat Triticum aestivum

[0047] Deposit number: CGMCC No.46083

[0048] Deposit date: July 9, 2024

[0049] Depository: China General Microbiology Center (CGMCC)

[0050] Deposit address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 This is the physical map of the plant cell vector pCBC-MT1T2.

[0052] Figure 2 This is the physical map of the plant cell vector pBUE411.

[0053] Figure 3 The genotype of the taugt-aabbdd mutant, where L represents different strains of the T2 generation; A represents the A subgenome genotype, B represents the B subgenome genotype, and D represents the D subgenome genotype; "+" represents insertion (blue font), "-" represents deletion (red font), and "W" represents that the site is consistent with the base sequence of the wheat Fielder wild type; sgRNA-1 represents target sequence 1, and sgRNA-2 represents target sequence 2.

[0054] Figure 4 The results of pollen dehydration observation of taugt mutant and wild type, where all pollen were collected from fresh pollen at the moment of anther release, the ambient temperature was 23-27℃, and the relative humidity was 45-65%; 0s, 1min, 5min, 35min represent the time after pollen grains were released from anthers; the scale is 100μm; Fielder is wild type; taugt-aaBBDD, taugt-AAbbDD, taugt-AABBdd, taugt-aabbDD, taugt-aaBBdd, taugt-AAbbdd and taugt-aabbdd are Figure 3 Combinations of mutants in different subgenomes of L401.

[0055] Figure 5 for Figure 4Analysis results of pollen water loss rate of taugt mutants and wild type. The wild type of wheat Fielder, taugt single mutant (taugt-aaBBDD, taugt-AAbbDD, taugt-AABBdd), taugt double mutant (taugt-aabbDD, taugt-aaBBdd, taugt-AAbbdd) were biologically replicated three times, and taugt-aabbdd was biologically replicated 30 times. The horizontal axis is the time after the pollen grains are released from the anther.

[0056] Figure 6 The results of the taugt-aabbdd mutant fruiting analysis; A and B show the ear fruiting and corresponding grain traits of the wheat Fielder wild type and all taugt mutants in the natural environment, with a scale of 2 cm; C shows the statistical analysis results of single ear fruiting of the wheat Fielder wild type and all taugt mutants, where taugt-aabbdd had 156 biological replicates, and the other mutants and wild types had 56 biological replicates. The number of ears analyzed for each material is expressed as the mean ± standard deviation, and the significance analysis was performed by Student's t-test, **** represents p < 0.0001; Fielder is the wild type; taugt-aaBBDD, taugt-AAbbDD, taugt-AABBdd, taugt-aabbDD, taugt-aaBBdd, taugt-AAbbdd and taugt-aabbdd are Figure 3 Combinations of mutants in different subgenomes of L401.

[0057] Figure 7 The results of the fertility recovery experiment of taugt-aabbdd; (A) After heading, the relative humidity of the environment was maintained at not less than 90% through the plastic shed; (B) The ear fruiting of taugt-aabbdd after moisturizing using the method shown in Figure A; taugt-aabbdd is Figure 3 The L401 triple mutant (the TaUGT genes in the three subgenomes A, B, and D all underwent corresponding homozygous mutations). DETAILED DESCRIPTION

[0058] The present invention is further described below in conjunction with examples. It should be understood that the following examples are only used as explanations and illustrations of the present invention and do not limit the scope of the present invention in any way.

[0059] The wheat variety Fielder used in the following examples is described in “Ishida Y, Tsunashima M, Hiei Y, et al. Wheat (Triticum aestivum L.) Transformation Using Immature Embryos [J]. methods mol biol [2024-08-09]. DOI: 10.1007 / 978-1-4939-1695-5_15.” The public can be obtained from the applicant and is only used to verify the present invention.

[0060] The plant cell vectors pCBC-MT1T2 and pBUE411 used in the following examples are both commercially available vectors.

[0061] If not otherwise specified, the reagents used in the following examples are all conventional reagents in the art, which can be obtained commercially or prepared according to conventional methods in the art; the experimental methods and conditions used are conventional experimental methods and conditions in the art, and reference can be made to relevant experimental manuals, known documents or manufacturer specifications. If not otherwise specified, the quantitative tests in the following examples are set up for three repeated experiments, and the results are averaged. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by ordinary technicians in the field to which the present invention belongs.

[0062] Example 1: Obtaining Wheat Moisture-Sensitive Male Sterile Material

[0063] 1. Acquisition of TaUGT-A / B / D target gene sequences

[0064] The three genes TaUGT-A / B / D were obtained from the Chinese Spring (Chinese Reference, CS) genome annotation file IWGSC RefSeq v1.1, among which the gene number corresponding to TaUGT-A is TraesCS4A02G055100, the gene number corresponding to TaUGT-B is TraesCS4B02G249500, and the gene number corresponding to TaUGT-D is TraesCS4D02G249900.

[0065] The experimental material used in this study was the wheat variety Fielder, and the corresponding TaUGT-A / B / D gene sequences in the wheat Fielder genome were obtained simultaneously by Blast. Since the three genes are highly conserved with each other and there are only SNP and Indel differences between the sequences, it is difficult to design specific primers for each gene. Therefore, 500bp of the 5' and 3' flanks of the gene were selected to design specific primers for amplifying the full length of the gene, and verified using NCBI primer 3. The specific primers used to amplify the full-length fragment of TaUGT-A are chr4A-1948-F / R, the specific primers used to amplify the full-length fragment of TaUGT-B are chr4B-1992-F / R, and the specific primers used to amplify the full-length fragment of TaUGT-D are chr4D-1875-F / R. The primer sequences are as follows:

[0066]

[0067] Using wheat Fielder genomic DNA as template, PCR was performed using primers for amplifying the full-length fragments of the three genes TaUGT-A / B / D. Due to the high GC content of the TaUGT gene sequence, PCR was performed using TOYOBO's high success rate PCR enzyme KOD FX (Code No. KFX-101) according to the product instructions.

[0068] The reaction system is: 2x PCR buffer for KOD FX, 12.5 μl; 2 mM dNTPs, 5 μl; forward primer F (10 μM), 0.8 μl; reverse primer R (10 μM), 0.8 μl; wheat Fielder genomic DNA, 2 μl (~200 ng);

[0069] KOD FX (1.0 U / μl), 0.5 μl; ddH2O is added to make up to 25 μl.

[0070] The reaction procedure was as follows: preliminary denaturation at 94°C for 2 min; denaturation at 98°C for 10 s, extension at 68°C for 2 min (amplification efficiency was 1 kb / min), 32 cycles; and final extension at 68°C for 2 min.

[0071] All PCR products were sent to Sangon Biotech Co., Ltd. for first-generation sequencing after the target bands were detected by agarose gel electrophoresis. chr4A-1948-F / R, chr4B-1992-F / R and chr4D-1875-F / R were used for sequencing, and all sequencing results were analyzed using Snapgene or DNAMAN. The results showed that in wheat Fielder, the coding sequence of the TaUGT-A gene was shown in SEQ ID NO:1, and the amino acid sequence of the protein TaUGT-A encoded by it was shown in SEQ ID NO:4; the coding sequence of the TaUGT-B gene was shown in SEQ ID NO:2, and the amino acid sequence of the protein TaUGT-B encoded by it was shown in SEQ ID NO:5; the coding sequence of the TaUGT-D gene was shown in SEQ ID NO:3, and the amino acid sequence of the protein TaUGT-D encoded by it was shown in SEQ ID NO:6.

[0072] The method for extracting wheat Fielder genomic DNA is as follows:

[0073] 1) Add a steel ball to a 2 mL centrifuge tube, take 200 mg of wheat leaves and place them in the EP tube, freeze them in liquid nitrogen and grind them into powder using a ball mill at an amplitude of 30 Hz for 30 seconds, then add 1 mL of 2×CTAB solution (100 mM Tris-HCl pH 8.0, 20 mM EDTA pH 8.0, 1.4 M NaCl, 2% CTAB, 2% polyvinyl pyrrolidone, 2% β-mercaptoethanol), shake well, place in a 65℃ oven, incubate for 45min-1h, and shake slowly every 15min; 2) After lysis, take out the sample and cool it to room temperature, centrifuge at 12,000rpm for 10min, transfer the supernatant (400-600μL) to a new 2mL centrifuge tube, add an equal volume of chloroform: isoamyl alcohol (v:v=24:1) extractant, and slowly extract for 20min; 3) Centrifuge at 4℃, 12,000rpm for 10min, take 600μL of supernatant to a new 1.5mL centrifuge tube, add 2 / 3 volume of isopropanol (isopropanol was pre-cooled in a -20℃ refrigerator for 20min), and mix well; 4) Centrifuge at room temperature at 12,000rpm for 5min-10min, discard the supernatant, and wash the precipitate twice with 70% ethanol; 5) Dry the precipitate at room temperature, add 20μL Dissolve in TE buffer with 200 ng / mL RNase A, incubate at 37°C for 30 min to remove RNA, and store in a -20°C refrigerator for later use.

[0074] 2. Creation of TaUGT-A / B / D gene mutant materials

[0075] (1) Target design

[0076] Use the CRISPR-P website ( http: / / crispr.hzau.edu.cn / CRISPR2 / ) TaUGT-A / B / D target sites were designed. Two conservative targets were designed at the 5' end of these three genes and the PSPG conserved domain, and their sequences are as follows.

[0077] Target sequence 1: GACATCGAGCGCGCCACGGC CGG (SEQ ID NO:7),

[0078] Target sequence 2: GTGCTGAGGCACGCGGCTGT TGG (SEQ ID NO:8),

[0079] The underlined part is the PAM motif.

[0080] (2) Vector construction

[0081] The primers TaUGT_MT1T2-F0 and TaUGT_MT1T2-R0 containing target sequence 2 and target sequence 1 were synthesized respectively. The primers TaUGT_MT1T2-F and TaUGT_MT1T2-R containing BsaI restriction enzyme cleavage site were synthesized respectively. Figure 1 ) as a template, and use these four primers to amplify the gRNA sequence containing target sequence 1 and target sequence 2 by PCR. The nucleotide sequences of the four primers are as follows:

[0082] TaUGT_MT1T2-F:aataat ggtctc aagcGTGCTGAGGCACGCGGCTGT;

[0083] TaUGT_MT1T2-F0:GTGCTGAGGCACGCGGCTGTgttttagagctagaaatagc;

[0084] TaUGT_MT1T2-R0:GCCGTGGCGCGCTCGATGTCgcttcttggtgcc;

[0085] TaUGT_MT1T2-R:attatt ggtctc taaacGCCGTGGCGCGCTCGATGT.

[0086] First, the above four primer solutions were mixed so that the concentration of TaUGT_MT1T2-F and TaUGT_MT1T2-R in the primer mixture was 10 μM, and the concentration of TaUGT_MT1T2-F0 and TaUGT_MT1T2-R0 was 0.5 μM.

[0087] The PCR reaction system was: 2x PhantaMax Master Mix (Novozyme, P525-01), 25 μL; primer mixture of four primers, 2.0 μL; vector pCBC-MT1T2, 0.5 μL; ddH2O was added to 50 μL.

[0088] The PCR reaction program was as follows: pre-denaturation at 95°C for 30 s; 36 cycles (denaturation at 95°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 60 s); and extension at 72°C for 5 min.

[0089] After the reaction, the target gRNA fragment amplified by PCR was recovered using a common agarose gel DNA recovery kit (Tiangen Biochemical Technology Co., Ltd., DP209).

[0090] The above target fragment gRNA was combined with the plant cell vector pBUE411 ( Figure 2 ) to construct the final gene editing vector. The connection system is: pBUE411 vector, 2.0μL; target fragment gRNA, 2.0μL; Bsa I enzyme (NEB, R3733S), 1.0μL; T4 DNA ligase (NEB, M0202T), 1.0μL; T4 DNA ligase buffer, 1.5μL; 10×BSA (bovine serum albumin), 1.5μL; ddH2O is supplemented to 15μL. The reaction process is: 37℃, 5h; 50℃, 5min; 80℃, 10min.

[0091] The obtained ligation product was transformed into the Escherichia coli DH5α strain by the heat shock method. The transformation method is as follows: take the competent cells and place them on ice, add the ligation product to the just melted competent cell suspension, flick to mix, and let it stand in an ice bath for 30 minutes; place the centrifuge tube in a 42°C water bath for 90 seconds, and then quickly transfer the tube to an ice bath to cool the cells for 2-3 minutes. Do not shake the centrifuge tube during this process; add 400-1000 μL of sterilized liquid LB culture medium (10 g / L tryptone, 5 g / L yeast extract, 5 g / L sodium chloride) without antibiotics to each centrifuge tube, invert to mix, and place it in a 37°C shaker at 150 rpm for 45 minutes to revive the bacteria; mix the contents of the centrifuge tube, take 100 μL of the transformed competent cells and evenly spread them on a plate containing 100 μg / mL Kan (kanamycin) on solid LB medium (plate), place the plate at room temperature until the liquid is absorbed, and then invert the plate at 37 ° C for 12-16 hours. Pick a single colony into 500 μL of liquid LB medium containing 100 μg / mL kanamycin, and shake and culture at 37 ° C, 200 rpm for 3-5 hours. Take the bacterial liquid as a template and use the universal primer M13-F / R for PCR identification.

[0092] The PCR reaction system was: 2x Taq mix (CW0682L, Kangwei Reagent), 5 μL; M13-F / R, 0.4 μL each; bacterial solution, 1 μL; ddH2O was added to 10 μL.

[0093] The PCR reaction program was as follows: pre-denaturation at 95°C for 30 s; 36 cycles (denaturation at 95°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 60 s); and extension at 72°C for 5 min.

[0094] After the reaction, the band size was detected by 1% agarose gel electrophoresis. 3-6 monoclones containing the target band were selected for sequencing. The plasmid of the positive clone with the correct sequencing result was extracted using QuickPure Plasmid Mini Kit (CW2619M, Kangwei Reagents) to obtain the recombinant plasmid pBUE411-spacer1-spacer2.

[0095] (3) Agrobacterium transformation

[0096] The Agrobacterium strain EHA105 stored in a -80℃ refrigerator was streaked on a YEB+Rif solid medium and cultured in a 28℃ incubator for 36h; a single clone was picked and inoculated into 750μL YEB+Rif liquid medium and cultured at 28℃ and 200rpm for 36h; 200μL of bacterial solution was cultured in 200mL YEB+Rif liquid medium and cultured at 28℃ and 200rpm until OD 600nm The value is between 0.5 and 1.0; use 50mL centrifuge tubes to fill the cultured bacterial solution and ice bath for 30 minutes; centrifuge at 4℃ 6000rpm for 5 minutes, and discard the supernatant; suspend the bacteria with 25mL of 10% glycerol in an ice bath, centrifuge at 4℃ 6000rpm for 5 minutes, collect the bacteria, and discard the supernatant; suspend the bacteria with 4mL of 10% glycerol in an ice bath, centrifuge at 4℃ 6000rpm for 5 minutes, collect the bacteria, and discard the supernatant; suspend the bacteria with 4mL of 10% glycerol in an ice bath, centrifuge at 4℃ 6000rpm for 5 minutes, collect the bacteria, and discard the supernatant; suspend the bacteria with 2.5mL of 10% glycerol in an ice bath to obtain EHA105 competent cells, and then distribute them into 1.5mL centrifuge tubes, 100μL per tube, and store them at -80℃ for use after quick freezing with liquid nitrogen.

[0097] Soak the inside of the electroporation cup with 1% hydrochloric acid solution for 10 minutes, then rinse with distilled water, and then soak in 70% ethanol for 5 minutes, and place it in the air to dry; after ice bathing the electroporation cup, add 100ng of recombinant plasmid pBUE411-spacer1-spacer2 to 100μL Agrobacterium EHA105 competent cells, gently blow and aspirate 2-3 times, then transfer to the electroporation cup and cover the cup; 1800V electric shock, after hearing two "drops", take out the electroporation cup, quickly add 750μL YEB liquid culture medium, and culture at 28℃ 200rpm shaking table for 2-3h; take 100μL of the cultured bacterial solution and spread it on the YEB+Rif+Kan solid culture medium, invert and culture in a 28℃ constant temperature box for 36h; pick out the grown single clone and inoculate it in the YEB+Rif+Kan liquid culture medium, and culture at 28℃ The cells were cultured at 200 rpm in a shaking incubator for 36 h. The positive clones were identified using universal primers M13-F / R to obtain recombinant Agrobacterium EHA105 / pBUE411-spacer1-spacer2.

[0098] YEB medium formula: yeast extract, 4g / L; mannitol, 10g / L; sodium chloride, 0.1g / L; magnesium sulfate heptahydrate, 0.2g / L; potassium dihydrogen phosphate, 0.5g / L. The above YEB+Rif solid medium or liquid medium contains Rif (rifampicin) at a concentration of 25μg / mL. The above YEB+Rif+Kan solid medium or liquid medium contains Rif (rifampicin) at a concentration of 25μg / mL and Kan (kanamycin) at a concentration of 50μg / mL.

[0099] (4) Genetic transformation of wheat embryos

[0100] Preparation of Agrobacterium suspension: inoculate the recombinant Agrobacterium EHA105 / pBUE411-spacer1-spacer2 in 10 mL MG / L medium (mannitol, 5 g / L; L-glutamic acid, 1 g / L; potassium dihydrogen phosphate, 250 mg / L; sodium chloride, 100 mg / L; magnesium sulfate heptahydrate, 100 mg / L; tryptone, 5 g / L; yeast extract, 2.5 g / L, biotin, 1 μg / L), and culture overnight at 28°C with shaking at 200 rpm; collect the cells by centrifugation and resuspend them in WLS-inf medium to A. 660nm is 0.4, and a recombinant Agrobacterium suspension is obtained.

[0101] Preparation of young embryos: Collect immature seeds about 14 days after powdering, and use tweezers to remove the husks; treat the immature seeds with 70% ethanol for 1 minute, then treat with 1% sodium hypochlorite for 10 minutes, and then wash with sterile water three times; separate the immature embryos from the immature seeds under a stereomicroscope; transfer the immature embryos to a 2.0 ml centrifuge tube containing 2.0 ml WLS-liq medium and store at room temperature.

[0102] Pretreatment and co-cultivation: Centrifuge the immature embryos at 20,000 g for 10 minutes at 4°C; remove the culture medium and add 1 mL of the above-mentioned recombinant Agrobacterium EHA105 / pBUE411-spacer1-spacer2 suspension to the centrifuge tube; oscillate the centrifuge tube at room temperature for 30 seconds and incubate for 5 minutes; transfer the immature embryos to WLS-AS solid culture medium with the endosperm side facing up and incubate in the dark at 23°C for 2 days.

[0103] Dormant culture: Use a scalpel and forceps to remove the embryonic axis; transfer the immature embryos with the embryonic axis removed to WLS-Res solid medium; and culture in the dark at 25°C for 5 days.

[0104] Glyphosate resistance screening, regeneration and rooting culture: Immature embryos were transferred to WLS-P5 solid medium and cultured in the dark at 25°C for 2 weeks; each embryo was cut into two pieces, transferred to WLS-P10 solid medium, and cultured in the dark at 25°C for 3 weeks; the proliferated tissues were transferred to LSZ-P5 solid medium and cultured in the light at 25°C for 2 weeks; the regenerated plants were transferred to LSF-P5 solid medium and cultured in the light at 25°C for 2 weeks.

[0105] Transplantation: The rooted plants are transplanted to the greenhouse culture room for further cultivation for 3-4 months, and the seeds of the next generation are harvested (the daytime temperature is 24-30℃, the nighttime temperature is 10-22℃, and the light time is not less than 12h); about 150 seeds can be harvested from each transgenic plant. Subsequent generations can continue to be cultivated in the greenhouse.

[0106] Buffer required for transformation:

[0107] LS salt solution (10x): Dissolve 19.0 g potassium nitrate, 16.5 g ammonium nitrate, 4.4 g calcium chloride, 3.7 g magnesium sulfate and 1.7 g potassium dihydrogen phosphate in 900 ml distilled water, make up to 1000 ml and store at 4°C.

[0108] FeEDTA solution (100x): Dissolve 2.78 g ferrous sulfate in 900 ml hot distilled water, add 3.73 g disodium ethylenediaminetetraacetate, cool and dilute to 1000 ml, store at 4°C.

[0109] LS trace element solution (100x): Dissolve 2.23 g manganese sulfate, 1.06 g zinc sulfate, 620 mg boric acid, 83 mg potassium iodide, 25 mg sodium molybdate, 2.5 mg copper sulfate and 2.5 mg cobalt chloride in 900 ml distilled water, make up to 1000 ml with distilled water and store at 4°C.

[0110] MS vitamin solution (100x): Dissolve 10 g inositol, 0.2 g glycine, 100 mg thiamine hydrochloride, 50 mg pyridoxine hydrochloride and 50 mg niacin in 900 ml distilled water, make up to 1000 ml with distilled water and store at 4°C.

[0111] LS modified vitamin solution (100x): Dissolve 10 g inositol, 100 mg thiamine hydrochloride, 50 mg pyridoxine hydrochloride and 50 mg niacin in 900 ml distilled water, make up to 1000 ml with distilled water and store at 4°C.

[0112] 2,4-Dichlorophenoxyacetic acid solution (2,4-D, 100 mg / L): Add 1 g / L NaOH dropwise to 100 mg 2,4-D until completely dissolved, make up to 1000 ml with distilled water, and store at 4°C.

[0113] Pilosamide solution (100 mg / L): Add 1 g / L NaOH dropwise to 100 mg of pilosamide until completely dissolved, add distilled water to make up to 1000 ml, and store at 4°C.

[0114] Zeatin solution (100 mg / L): Add 1 g / L NaOH dropwise to 100 mg zeatin until completely dissolved, add distilled water to make up to 1000 ml, and store at 4°C.

[0115] Indole-3-butyric acid solution (IBA, 100 mg / L): Add 1 g / L NaOH dropwise to 100 mg of indole-3-butyric acid until completely dissolved, add distilled water to make up to 1000 ml, and store at 4°C.

[0116] 6-Benzyl adenine solution (6BA, 100 mg / L): Add 1 g / L NaOH dropwise to 100 mg 6-benzyladenine until completely dissolved, make up to 1000 ml with distilled water, and store at 4°C.

[0117] Acetosyringone solution (AS, 100 mM): 392.4 mg of acetosyringone was dissolved in 10 ml of dimethyl sulfoxide, diluted with 10 ml of distilled water, sterilized with a 0.22 μm filter, and stored at 4°C.

[0118] Glyphosate solution (PPT, 20 mg / ml): Dissolve 400 mg of glyphosate in 20 ml of distilled water, sterilize with a 0.22 μm filter, and store at -20°C.

[0119] Hygromycin solution (50 mg / ml): Add 1 g of hygromycin B solution to 10 ml of distilled water, make up to 20 ml with distilled water, sterilize with a 0.22 μm filter, and store at 4°C.

[0120] Vitamin C solution (10 mg / ml): Dissolve 2 g of vitamin C in 200 ml of distilled water, sterilize with a 0.22 μm filter, and store at 4°C.

[0121] Carbenicillin solution (250 mg / ml): Dissolve 5 g of carbenicillin in 10 ml of distilled water, make up to 20 ml with distilled water, sterilize with a 0.22 μm filter, and store at 4°C.

[0122] Cefotaxime solution (250 mg / ml): Dissolve 5 g of cefotaxime in 10 ml of distilled water, make up to 20 ml with distilled water, sterilize with a 0.22 μm filter, and store at 4°C.

[0123] Transformation medium required:

[0124] Embryo collection medium (WLS-liq): Add 10 ml 10x LS salt solution, 1 ml 100x FeEDTA solution, 1 ml 100x LS trace element solution, 1 ml 100x MS vitamin solution, 10 g glucose and 0.5 g MES to 700 ml distilled water, add distilled water to 1000 ml, adjust pH = 5.8, sterilize using a 0.22 μm filter, and store at 4°C.

[0125] Infection medium (WLS-inf): WLS-liq medium supplemented with 100 μM acetosyringone.

[0126] Co-culture medium (WLS-AS): 0.85 mg / L silver nitrate, 1.25 mg / L copper sulfate and 8 g / L agarose were added to WLS-inf medium.

[0127] Selection medium (WLS): Add 100 ml 10x LS salt solution, 10 ml 100xFeEDTA solution, 10 ml 100x LS trace element solution, 10 ml 100x MS vitamin solution, 5 ml 100 mg / L 2,4-D solution, 22 ml 100 mg / L piclopidine solution, 0.5 g glutamine, 0.1 g casein hydrolysate, 0.75 g magnesium chloride, 40 g maltose and 1.95 g MES to 700 ml distilled water, make up to 1000 ml with distilled water, adjust pH to 5.8, add 5 g agar, autoclave at 121°C for 15 minutes, cool to 50°C, add 100 mg / L vitamin C, 250 mg / L carbenicillin and 0.85 mg / L silver nitrate.

[0128] Dormancy medium (WLS-Res): WLS medium was sterilized by high pressure and 100 mg / L cefotaxime was added.

[0129] The first round of glyphosate resistance screening medium (WLS-P5): WLS medium was sterilized by high pressure and then 5 mg / L glyphosate was added.

[0130] The second round of glyphosate resistance screening medium (WLS-P10): WLS medium was sterilized by high pressure and then 10 mg / L glyphosate was added.

[0131] Regeneration medium (LSZ): Add 100 ml 10x LS salt solution, 10 ml 100xFeEDTA solution, 10 ml 100x LS trace element solution, 10 ml 100x LS modified vitamin solution, 50 ml 100 mg / L sucrose solution, 20 g sucrose, 0.5 g MES, 2.5 mg copper sulfate to 700 ml distilled water, add distilled water to 1000 ml, adjust pH = 5.8, add 8 g agar, autoclave at 121°C for 15 minutes, cool to 50°C, add 250 mg / L carbenicillin and 100 mg / L cefotaxime.

[0132] Glyphosate resistance post-screening regeneration medium (LSZ-P5): LSZ medium was sterilized by high pressure and then 5 mg / L glyphosate was added.

[0133] Rooting medium (LSF): Add 100 ml 10x LS salt solution, 10 ml 100xFeEDTA solution, 10 ml 100x LS trace element solution, 10 ml 100x LS modified vitamin solution, 2 ml 100 mg / L IBA solution, 15 g sucrose and 0.5 g MES to 700 ml distilled water, add distilled water to 1000 ml, adjust pH = 5.8, add 3 g plant gel, autoclave at 121°C for 15 minutes, cool to 50°C, and add 250 mg / L carbenicillin.

[0134] Rooting medium after glyphosate resistance screening (LSF-P5): 5 mg / L glyphosate was added to LSF medium.

[0135] (5) Genotype analysis of T1 plants

[0136] The three genes of T1 plants were amplified using chr4A-1948-F / R, chr4B-1992-F / R and chr4D-1875-F / R respectively. The PCR amplification was consistent with the full-length gene amplification method mentioned above. Primers TaUGT(ABD)-San-F(5'-CTCTCGGTGCAGCGGT-3') were used for sequencing. Since the physical distance between the two targets of sgRNA1 and sgRNA2 was close, universal primers were designed to perform Sanger sequencing only once to achieve the purpose of simultaneously detecting the genotypes of the two target sites.

[0137] Nine Cas9-positive surviving strains were obtained in the T1 generation through gene editing, of which seven strains were edited at different subgenome targets of TaUGT, among which Line 1 was not edited at target 1 of subgenome A, target 2 was edited, and other subgenomes were unknown; Line 2 was unknown in subgenome A, target 1 of subgenomes B and D was not edited, target 2 was edited, and subgenome B was a homozygous genotype; Line 3 was not edited in subgenome A, a large fragment was deleted between the two targets of subgenome B, target 1 of subgenome D was edited, and target 2 was unknown; Line 4 was not edited in subgenome A, a large fragment was deleted between the two targets of subgenome B, target 1 of subgenome D was edited, and target 2 was unknown; Target 1 of subgenome A was edited, target 2 was unknown, there was a large deletion between the two targets of subgenome B, target 1 of subgenome D was not edited, and target 2 was homozygous; Line5 was edited at both target 1 of subgenome A and D, and other sites were unknown; Line6 was edited at both target 1 of subgenome A and D, target 2 was unknown, and there was a large deletion between the two targets of subgenome B; Line7 was a large deletion between the two targets of subgenome A, target 1 of subgenome B was edited, target 2 was not edited, target 1 of subgenome D was not edited, and target 2 was edited. All T1 generation materials were self-crossed and used for T2 generation to separate taugt homozygous single, double and triple mutants.

[0138] A total of 461 seeds were harvested from the T1 generation, all of which were planted in the wheat culture room for additional generations. Since the TaUGT genes of the three subgenomes of Line4, Line6 and Line7 in the T1 generation were edited at the same time, the three lines can directly isolate homozygous triple mutants (taugt-aabbdd) or double mutants (taugt-aabbDD, taugt-aaBBdd, taugt-AAbbdd) in the T2 generation, while other lines can isolate single mutants (taugt-aaBBDD, taugt-AAbbDD, taugt-AABBdd). 420 individual plants in the T2 generation were identified, and 14 homozygous triple mutant (taugt-aabbdd) lines with different genotypes were obtained ( Figure 3 ).

[0139] like Figure 3 As shown, all mutations occurred near the third base upstream of the PAM motif, specifically: the main genotype types of subgenomic targets 1 and 2 in A were single-base T insertion and single-base T deletion, single-base C deletion and six-base CGCGGC deletion, wild-type W and single-base T insertion, 429 bp large fragment deletion, single-base A and single-base T insertion; the main genotype types of subgenomic targets 1 and 2 in B were single-base A insertion and 429 bp deletion, three-base CAC deletion and single-base C deletion, 429 bp large fragment deletion, single-base C insertion and three-base CAC deletion, two-base AC deletion and three-base CGG deletion, wild-type W and single-base T insertion; the main genotype types of subgenomic targets 1 and 2 in D were wild-type W and three-base GGC deletion, single-base T insertion and two-base TA insertion, single-base T insertion and single-base C deletion, 429 bp large fragment deletion, wild-type W and single-base A insertion. The above sequence differences occurring in the A, B, and D subgenomes all cause premature translation termination or frameshift mutations, resulting in loss of protein function.

[0140] choose Figure 3 The mutant combinations of different subgenomes of L401 shown in the table were subjected to the following pollen water loss rate analysis and field seed setting rate analysis.

[0141] 3. Analysis of water loss rate of wild type and mutant pollen

[0142] Usually wheat sheds more powder between 8-11 am and 4-6 pm. During this time period, L401 ( Figure 3)'s mutant combinations of different subgenomes (taugt-aaBBDD, taugt-AAbbDD, taugt-AABBdd, taugt-aabbDD, taugt-aaBBdd, taugt-AAbbdd, taugt-aabbdd) and wheat Fielder wild type fresh pollen were placed under an optical microscope equipped with an image sensor for real-time observation and photography. The judgment standard for fresh pollen was the pollen grains at the moment of anther dehiscence. The ambient humidity and temperature during the pollen observation period of each material were also recorded. Since the triple mutant (taugt-aabbdd) is a biological function loss mutant, its pollen grains shrivel up in a short time after release, which is easy to cause large errors. Therefore, 30 biological replicates were observed for this material. The wild type (WT) and single mutants (taugt-aaBBDD, taugt-AAbbDD, taugt-AABBdd) and double mutants (taugt-aabbDD, taugt-aaBBdd, taugt-AAbbdd) are all non-biological function loss mutants and the pollen dehydration process is long. In order to control a relatively stable or consistent experimental environment, only 3-5 biological replicates were observed each time. The percentage of the number of shrivelled pollen grains in the field of view at different time periods to the total number of pollen grains was calculated as the pollen dehydration rate for differential evaluation.

[0143] When the ambient temperature is 23-27°C and the relative humidity is 45%-65%, the taugt-aabbdd pollen begins to dehydrate and shrivel immediately after release, and all pollen is completely shriveled in less than 1 minute. Under the same conditions, the pollen morphology of the wheat Fielder wild type, L401 single mutant (taugt-aaBBDD, taugt-AAbbDD, taugt-AABBdd) and double mutant (taugt-aabbDD, taugt-aaBBdd, taugt-AAbbdd) did not change significantly within 5 minutes after release. From 5 minutes after release, some pollen gradually lost water and shriveled, and it took about 35 minutes until all pollen in the field of view was completely shriveled.

[0144] ( Figure 4 and Figure 5 ).

[0145] 4. Analysis of the field fruiting rate of wild type and mutants

[0146] On March 9, 2023, the wheat Fielder and L401 ( Figure 3) were planted in plots with different subgenome mutant combinations (taugt-aaBBDD, taugt-AAbbDD, taugt-AABBdd, taugt-aabbDD, taugt-aaBBdd, taugt-AAbbdd, taugt-aabbdd), with 4 rows sown in each plot, 25 cm row spacing, and 10 cm plant spacing. During the wheat powder shedding period, the field relative humidity was 30%-60%. The number of ears with a seed set of no less than 30 was counted in each plot, and a t-test or ANOVA was performed.

[0147] After the plants matured, the L401 triple mutant (taugt-aabbdd) produced almost no seeds, with an average of 5.63 seeds per ear, indicating male sterility. Under the same conditions, the average number of seeds per ear of the wheat Fielder wild type, L401 single mutant (taugt-aaBBDD, taugt-AAbbDD, taugt-AABBdd) and double mutant (taugt-aabbDD, taugt-aaBBdd, taugt-AAbbdd) ranged from 43.17 to 45.04 ( Figure 6 ), which were significantly higher than the L401 triple mutant (taugt-aabbdd). Therefore, the triple mutant (taugt-aabbdd) showed stable low fruiting or male sterility in the natural environment (relative humidity of 30%-60%), and can be used as a new wheat male sterile germplasm resource to promote wheat hybrid breeding applications.

[0148] 5. Artificial Moisture Pollination of Mutants

[0149] In order to restore the fruit set of the triple mutant (taugt-aabbdd), after the mutant plants headed and before they shed pollen, a 2-3 square meter plot was selected and a plastic film shed was built to maintain the relative humidity of the plot environment at not less than 90%. After the pollen shed was completed, the plastic shed (such as Figure 7 A). When the seeds are mature, different genotypes ( Figure 3 ) materials were counted for fruit number, with no less than 20 ears for each material, to evaluate the recovery of mutant sports characteristics after moisturizing in the plot.

[0150] The results showed that the genotypes were L299 and L401 ( Figure 3 ) triple mutant (taugt-aabbdd) was treated with moisturizing treatment, and all ears were able to return to normal. In an environment with a relative humidity of not less than 90%, the average number of grains per ear of L299 triple mutant after moisturizing treatment was 41.42, and the average number of grains per ear of L401 triple mutant after moisturizing treatment was 43.85. Figure 7B shows the fertility recovery of the homozygous triple mutant (taugt-aabbdd) with the genotype L401. Therefore, by moisturizing the tagms-aabbdd mutant during the pollination period and maintaining the relative humidity of the environment at not less than 90%, its fruitfulness can be restored, solving the problem of mutant self-breeding.

[0151] The seeds of L401 triple mutant were sent to the General Microbiology Center of China Microbiological Culture Collection Administration

[0152] (CGMCC) for patent deposit, the deposit number is CGMCC No.46083.

Claims

1. A method for preparing moisture-sensitive male-sterile wheat, comprising: Reducing the activity of protein in wheat, reducing the content of protein in wheat, inhibiting the expression of protein-encoding genes in wheat or knocking out protein-encoding genes in wheat to obtain moisture-sensitive male sterile wheat; The proteins are TaUGT-A, TaUGT-B and TaUGT-D, wherein the amino acid sequence of TaUGT-A is shown in SEQ ID NO:4, the amino acid sequence of TaUGT-B is shown in SEQ ID NO:5, and the amino acid sequence of TaUGT-D is shown in SEQ ID NO:

6.

2. The method according to claim 1, characterized in that: The coding gene of TaUGT-A has the nucleotide sequence shown in SEQ ID NO:1 or a nucleotide sequence with more than 90% identity with the nucleotide sequence shown in SEQ ID NO:1; the coding gene of TaUGT-B has the nucleotide sequence shown in SEQ ID NO:2 or a nucleotide sequence with more than 90% identity with the nucleotide sequence shown in SEQ ID NO:2; the coding gene of TaUGT-D has the nucleotide sequence shown in SEQ ID NO:3 or a nucleotide sequence with more than 90% identity with the nucleotide sequence shown in SEQ ID NO:

3.

3. The method according to claim 2, characterized in that: The method is achieved by performing site-specific editing on the gene encoding the protein through the CRISPR gene editing system.

4. The method according to claim 3, characterized in that: The CRISPR gene editing system is a CRISPR-Cas9 system; the target sequence of the protein encoding gene used in the CRISPR-Cas9 system is target sequence 1 or target sequence 2; The target sequence 1 is as follows (a1), (a2) or (a3): (a1) the nucleotide sequence shown in SEQ ID NO:7; (a2) a nucleotide sequence derived from (a1) that has more than 90% identity with the nucleotide sequence defined in (a1); (a3) a nucleotide sequence derived from (a1) that hybridizes to the nucleotide sequence defined in (a1) under stringent conditions; The target sequence 2 is as follows (b1), (b2) or (b3): (b1) the nucleotide sequence shown in SEQ ID NO:8; (b2) a nucleotide sequence derived from (b1) that has more than 90% identity with the nucleotide sequence defined in (b1); (b3) A nucleotide sequence derived from (b1) which hybridizes with the nucleotide sequence defined by (b1) under stringent conditions.

5. The method according to claim 4, characterized in that: The method obtains moisture-sensitive male sterile wheat by introducing the coding gene of the sgRNA targeting the target sequence 1 and / or the target sequence 2 and the coding gene of Cas9 into wheat.

6. The method according to any one of claims 1 to 5, characterized in that: The moisture-sensitive male-sterile wheat has a higher water-loss rate in pollen than that in wild-type wheat; and the fertility of the moisture-sensitive male-sterile wheat can be restored by artificial moist pollination.

7. A product for regulating wheat fertility, the product being used to reduce the activity of the protein described in claim 1 in wheat, reduce the content of the protein described in wheat, inhibit the expression of the gene encoding the protein described in wheat, or knock out the gene encoding the protein described in wheat.

8. The product according to claim 7, characterized in that: The product is the reagent and / or instrument required for site-specific editing of the protein encoding gene using the CRISPR / Cas9 system.

9. The product according to claim 8, characterized in that: The reagent is reagent 1, reagent 2, reagent 3, reagent 4 or reagent 5; The reagent 1 is R1) or R2): R1) an sgRNA targeting the target sequence 1 of claim 4; R2) an sgRNA targeting the target sequence 2 of claim 4; The reagent 2 is a combination of the reagent 1 and Cas9; The reagent 3 is a recombinant vector containing the coding gene of R1) and / or R2); The reagent 4 is a composition consisting of the reagent 3 and a recombinant vector containing a gene encoding Cas9; The reagent 5 is a recombinant vector containing the coding gene of R1) and / or R2) and the coding gene of Cas9.

10. Use of the protein of claim 1 or the gene encoding the protein of claim 2 in regulating wheat fertility.

11. Application of moisture-sensitive male sterile wheat with a deposit number of CGMCC No.46083 in wheat breeding.

12. The use according to claim 11, characterized in that: The method for restoring or improving the fertility of the moisture-sensitive male sterile wheat is as follows: during the flowering period of the moisture-sensitive male sterile wheat, the relative humidity of the environment where the flower spike is located is maintained to be not less than 90%.

13. A method for restoring or improving wheat fertility, comprising: During the flowering period of wheat, the relative humidity of the environment where the flower spike is located is maintained at not less than 90%; the wheat is humidity-sensitive male sterile wheat, and its preservation number is CGMCC No.46083.

Images