Construction of miRNA competitive binding inhibitor and application of miRNA competitive binding inhibitor in treatment of drug resistance of bemisia tabaci

Abstract

The invention provides a method for inhibiting miRNA expression of bemisia tabaci and application of the method in imidacloprid resistance treatment of the bemisia tabaci. The insect miRNA competitive binding inhibitor disclosed by the invention comprises short tandem target simulation and molecular sponge construction. The invention further discloses an application method of the novel-miR-1557 competitive binding inhibitor in treatment of drug resistance of bemisia tabaci, and the novel-miR-1557 competitive binding inhibitor is used for reducing the resistance of the bemisia tabaci to imidacloprid, so that the prevention and treatment effect of an insecticide is improved. The specific contention binding inhibitor is constructed and prepared aiming at a specific target novel-miR-1557, can be applied to production prevention and control of bemisia tabaci, and particularly provides application guidance for pest drug resistance treatment and insecticide consumption reduction.

Description

Technical Field

[0001] The present invention relates to the construction of a miRNA competitive binding inhibitor and its application in pest control, belonging to the field of plant protection, and specifically to a Bemisia tabaci novel-miR-1557 competitive binding inhibitor and its application in the control of Bemisia tabaci resistance to imidacloprid. Background Art

[0002] MicroRNAs (miRNAs) are endogenous non-coding RNAs with a length of about 22 nt. They are numerous and are important post-transcriptional regulatory elements. In medical research, miRNAs play an important role as diagnostic biomarkers and therapeutic targets for various cancers and infectious diseases, and more and more drugs acting on specific miRNAs have been successfully developed. In insects, miRNAs are involved in almost all biological processes such as growth and development, reproduction, metabolism, immunity, and drug resistance. miRNAs play an important regulatory role in the formation of insect resistance, for example, Plutellaxylostella miR-2b-3p regulates CYP9F2 to participate in resistance to chlorantraniliprole; Spodoptera frugiperda miR-190-5p regulates CYP6K2 to participate in resistance to chlorantraniliprole; Sitobion miscanthismi-miR-278 and smi-miR-316c regulate acetylcholine receptor and CYP4CJ6 to participate in resistance to imidacloprid; Bemisia tabaci miR-276-3p participates in resistance to cyantraniliprole by regulating CYP6CX3. In view of the above, miRNAs have great potential as new targets in the development of efficient and green insecticides and pest control, and the development of pest resistance control technology targeting miRNAs has application value.

[0003] Bemisia tabaci is an insect belonging to the family Aleyrodidae in the order Hemiptera. It is an important agricultural pest with a worldwide distribution, and has the characteristics of small size, wide feeding range, strong reproductive ability, ability to spread a variety of plant viruses, and easy to develop resistance to pesticides. For a long time, the control of Bemisia tabaci in agricultural production has mainly relied on chemical pesticides. However, due to the unscientific application of pesticides, the resistance of Bemisia tabaci has become increasingly serious, and it has occurred frequently around the world, causing huge economic losses. In particular, the resistance of Bemisia tabaci to imidacloprid is particularly prominent and has attracted widespread attention. Therefore, it is urgent to control the resistance of Bemisia tabaci to imidacloprid, reduce the use of pesticides, extend the life of pesticides and improve the control effect. Summary of the invention

[0004] The present invention aims to provide a construction of a miRNA competitive binding inhibitor and its application in pest control, and specifically relates to the application of Bemisia tabaci miRNA novel-miR-1557 in the management of imidacloprid resistance, which has a significant effect.

[0005] The invention provides an application of a miRNA competitive binding inhibitor in pest control, which is an application of a specific competitive binding inhibitor acting on novel-miR-1557 in the control of resistance of Bemisia tabaci to imidacloprid.

[0006] Specifically, the sequence of novel-miR-1557 is: 5'-UGCCGGACACGGGAGCUGUC-3' (SEQ ID NO: 1).

[0007] Preferably, the novel-miR-1557 competitive binding inhibitor used is STTM1557 or SP1557 (7×);

[0008] >STTM1557 (SEQ ID NO: 2)

[0009] GAGCTCTGCCGGACACGGGAGCTGTCGTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTTAAATATGGTC

[0010] TAAAGAAGAAGAATATGGTCTAAAGAAGAAGAATTGCCGGACACGGGAGCTGTCCTCGAG

[0011] >SP1557 (7×) (SEQ ID NO: 3)

[0012] GAGCTCGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAG

[0013] CTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCG GCACTCGAG.

[0014] The invention provides a method for controlling the resistance of Bemisia tabaci to imidacloprid, which comprises the steps of introducing a novel-miR-1557 competitive binding inhibitor into a plant by constructing a recombinant vector.

[0015] Specifically, the sequence of novel-miR-1557 is: 5'-UGCCGGACACGGGAGCUGUC-3' (SEQ ID NO: 1).

[0016] Preferably, the novel-miR-1557 competitive binding inhibitor is STTM1557 or SP1557(7×);

[0017] >STTM1557 (SEQ ID NO: 2)

[0018] GAGCTCTGCCGGACACGGGAGCTGTCGTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTTAAATATGGTC

[0019] TAAAGAAGAAGAATATGGTCTAAAGAAGAAGAATTGCCGGACACGGGAGCTGTCCTCGAG

[0020] >SP1557 (7×) (SEQ ID NO: 3)

[0021] GAGCTCGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAG

[0022] CTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCG GCACTCGAG.

[0023] In particular, the plant is a host plant of Bemisia tabaci.

[0024] More preferably, the plant is tomato or tobacco.

[0025] In a specific embodiment, the gene silencing is achieved by constructing a recombinant viral plasmid and infecting plants with virus-induced gene silencing.

[0026] The following examples further illustrate the present invention and are not to be construed as limiting the scope of the present invention or the specific methods described herein.

[0027] The experiment showed that when resistant whiteflies fed on tomatoes containing novel-miR-1557 competitive binding inhibitors STTM1557 and SP1557 (7×), and were treated with 200 mg / L imidacloprid, the mortality rate of whiteflies was significantly increased compared with the control group, indicating that the novel-miR-1557 competitive binding inhibitor reduced the resistance of whiteflies to imidacloprid and improved the control effect of imidacloprid. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Analysis of the expression level of novel-miR-1557 in field Bemisia tabaci populations and its correlation with the resistance level to imidacloprid.

[0029] Figure 2 Changes in novel-miR-1557 expression levels after whiteflies fed on the above-mentioned analogs and inhibitors and determination of their sensitivity to imidacloprid.

[0030] Figure 3 Schematic diagram of the competitive binding inhibitors of novel-miR-1557 in Bemisia tabaci and SP1557 (7×).

[0031] Figure 4 The recombinant viral vector pTRV2-STTM396a was identified by sequencing.

[0032] Figure 5 The recombinant viral vector pTRV2-STTM1557 was identified by sequencing.

[0033] Figure 6 The recombinant viral vector pTRV2-SP1557 (7×) was identified by sequencing.

[0034] Figure 7 After tomatoes were infected with the mixed solution, STTM396a, STTM1557 and SP1557 (7×) were detected.

[0035] Figure 8 Detection of novel-miR-1557 expression level in tomatoes successfully infected by whitefly feeding mixture.

[0036] Fig. 9 Schematic diagram of the imidacloprid bioassay method after Bemisia whitefly fed on tomato plants containing STTM1557 and SP1557(7×).

[0037] Fig.10 Imidacloprid bioassay after Bemisia tabaci fed on STTM1557 and SP1557 (7×) tomatoes. DETAILED DESCRIPTION

[0038] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation to the scope of the present invention.

[0039] It should be understood by those skilled in the art that the details and forms of the technical solutions of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements are within the protection scope of the present invention.

[0040] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0041] Unless otherwise specified, the materials and reagents used in the following examples were obtained from commercial sources.

[0042] The insecticides in the following examples are all imidacloprid.

[0043] Imidacloprid technical: active ingredient content 95%, purchased from Shanghai Yuanye Biotechnology Co., Ltd.

[0044] The above-mentioned imidacloprid original drug is a powdered solid.

[0045] The above-mentioned imidacloprid technical drug was diluted to 1000 mg / L using acetone as a solvent as a mother solution.

[0046] The novel-miR-1557 analogs and inhibitors in the following examples were purchased from Shanghai Jima Pharmaceutical Co., Ltd.

[0047] The novel-miR-1557 analogs and inhibitors are dry powders stored at low temperatures.

[0048] Table 1. Novel-miR-1557 analogs and inhibitor sequences

[0049]

[0050]

[0051] In the above table, mimic 1557 indicates novel-miR-1557 analog, mimic control indicates novel-miR-1557 analog control; inhibitor 1557 indicates novel-miR-1557 inhibitor, and inhibitor control indicates novel-miR-1557 inhibitor control.

[0052] In the following examples, tomato miR396a short tandem target mimic STTM396a was used as a control for STTM1557 and SP1557 (7×).

[0053] The sequences of novel-miR-1557 competitive binding inhibitors STTM1557 and SP1557 (7×) and the control STTM396a sequence used in the following examples are as follows:

[0054] >STTM1557

[0055] GAGCTCTGCCGGACACGGGAGCTGTCGTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTTAAATATGGTC

[0056] TAAAGAAGAAGAATATGGTCTAAAGAAGAAGAATTGCCGGACACGGGAGCTGTCCTCGAG

[0057] >SP1557(7×)

[0058] GAGCTCGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAG

[0059] CTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCG

[0060] GCACTCGAG

[0061] >STTM396a

[0062] GAGCTCCAGTTCAAGAACTTAGCTGTGGAAGTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTTAAATAT GGTCTAAAGAAGAAGAATATGGTCTAAAGAAGAAGAATCAGTTCAAGAACTTAGCTGTGGAACTCGAG.

[0063] Agrobacterium GV3101: purchased from Beijing Qingke Biotechnology Co., Ltd., product number TSC-A01.

[0064] Test insects: Indoor imidacloprid sensitive (S #1 ) and resistance (R #1 ) whitefly population and 8 field whitefly populations (S #2 ,R #2 -R #8 ).

[0065] Insecticide bioassay method: The sensitivity of the above-mentioned whitefly resistant population to imidacloprid was determined by feeding method. Specifically: 1) The imidacloprid mother solution was diluted with feeding solution (containing 30% sucrose + 5% yeast extract) into 6-7 series of concentration gradient solutions. 2) First, use Parafilm to pull a thin film to cover the tube mouth at one end of the glass test tube, take 60μL of the solution on the film, cover the second layer of Parafilm and flatten it. 3) Use an insect sucker to take about 20 whitefly adults into the test tube, cover the other end of the tube mouth with a layer of Parafilm and pierce fine holes for ventilation. 4) Put the glass test tube into a black tube sleeve with an open end (the drug-containing layer faces up to the light source), and then put it into an artificial intelligence greenhouse (14:10L / D; 24-26℃; 65-75% RH). 5) After 48h, check the survival of the test insects.

[0066] Example 1: Detection of resistance level of Bemisia tabaci to imidacloprid

[0067] The mortality rate of each treatment group was calculated, and the lethal concentration (LC) was calculated using POLO software. 50 , the resistance multiple is determined by the LC of the resistant population 50 With sensitive populations (S #2 )LC 50 Ratio calculation.

[0068] Table 2. Resistance level of Bemisia tabaci to imidacloprid

[0069]

[0070] In the above table: N represents the total number of insects tested, FL (fiducial limit) represents the confidence interval, χ 2 RR indicates chi-square value and RR indicates resistance multiple.

[0071] The results in Table 2 show that: #2 ), the whitefly populations in the test fields developed different degrees of resistance to imidacloprid.

[0072] Example 2: Detection of novel-miR-1557 expression level in field Bemisia tabaci population and analysis of its correlation with resistance level to imidacloprid

[0073] The whitefly population in the field is (S #2 ,R #2 -R #8 ).

[0074] Real-time fluorescence quantitative qPCR was used to detect the expression level of novel-miR-1557 in the above-mentioned field whitefly population.

[0075] Figure 1A shows the expression level of novel-miR-1557 in different field populations of Bemisia tabaci, and B shows the expression level of novel-miR-1557 in different field populations of Bemisia tabaci and the LC of imidacloprid 50 Correlation analysis between values.

[0076] qPCR analysis revealed that the imidacloprid-sensitive population (S #2 ), novel-miR-1557 was significantly upregulated in all five imidacloprid-resistant populations. The expression level of novel-miR-1557 was compared with the corresponding imidacloprid LC 50 The results showed that the expression level of novel-miR-1557 was significantly positively correlated with the resistance of Bemisia tabaci to imidacloprid.

[0077] Example 3: Determination of the sensitivity of Bemisia tabaci to imidacloprid after feeding novel-miR-1557 analogs or inhibitors

[0078] Test insects: Indoor whitefly, imidacloprid-sensitive (S #1 ) and resistant population (R #1 ).

[0079] Method for using the novel-miR-1557 analogs, inhibitors and controls: dilute the novel-miR-1557 analogs, inhibitors and controls to 20 μM with RNase-free water, and then dilute them to a working solution with a concentration of 4 μM with feeding solution.

[0080] The method for determining the sensitivity of whiteflies to imidacloprid after feeding with the novel-miR-1557 analog or inhibitor is as follows: the novel-miR-1557 analog and the inhibitor working solution are fed to whiteflies using the above-mentioned bioassay glass tube feeding method, and 12 hours later, the surviving whiteflies are transferred to a bioassay glass tube containing imidacloprid at a concentration of 10 mg / L, and 48 hours later, the mortality rates of whiteflies in the experimental group and the control group are counted.

[0081] Figure 2 A in the middle shows Bemisia tabaci (S #1 ) 12 hours after feeding on the analog, the expression level of novel-miR-1557 increased significantly by 148.8 times. B shows that the whitefly (R #1 ) fed the inhibitor for 12 hours, the expression level of novel-miR-1557 decreased significantly by 27.3%. C shows that the expression level of novel-miR-1557 in whitefly (S #1 ) The sensitivity to imidacloprid was significantly reduced after the expression level of novel-miR-1557 was increased, and the mortality rate was reduced by 39.0%. D shows that the whitefly (R #1) The sensitivity to imidacloprid increased significantly after the expression level of novel-miR-1557 was reduced, and the mortality rate increased by 2.4 times, indicating that novel-miR-1557 was significantly correlated with imidacloprid resistance.

[0082] Example 4: Application of novel-miR-1557 competitive binding inhibitors STTM1557 and SP1557 (7×) in the management of imidacloprid resistance in Bemisia tabaci

[0083] The following whitefly test population is the above-mentioned indoor imidacloprid-resistant population (R #1 ).

[0084] Figure 3 (1) The sequence and structure of the whitefly novel-miR-1557 short tandem target mimic STTM1557, (2) the sequence and structure of the novel-miR-1557 molecular sponge SP1557 (7×).

[0085] General Biotech (Anhui) Co., Ltd. was commissioned to construct the above STTM396a, STTM1557 and SP1557 (7×) sequences into the pTRV2 vector to construct the recombinant viral vectors pTRV2-STTM396a, pTRV2-STTM1557 and pTRV2-SP1557 (7×).

[0086] The recombinant viral vectors pTRV2-STTM396a, pTRV2-STTM1557 and pTRV2-SP1557 (7×) plasmids were transformed into Agrobacterium GV3101, and statically cultured on LB medium containing antibiotics (28°C, 48 hours), and positive clones were screened by PCR. Figure 4 The recombinant viral vector pTRV2-STTM396a was sequenced and identified. Figure 5 The recombinant viral vector pTRV2-STTM1557 was sequenced and identified. Figure 6 The recombinant viral vector pTRV2-SP1557 (7×) was identified by sequencing.

[0087] Tomato materials were prepared by soaking and germinating tomato seeds and then sowing them in a culture tray containing a mixed matrix and culturing them in an intelligent artificial greenhouse under the conditions of 25°C, 60% relative humidity, and 10h (dark) / 14h (light) photoperiod. Tomato seedlings that were flattened at midnight and whose true leaves had just emerged were used for inoculation with Agrobacterium.

[0088] Preparation of Agrobacterium infection solution and Agrobacterium infection method: 1) Add 1 mL of pTRV1, pTRV2-STTM396a, pTRV2-STTM1557, pTRV2-SP1557 (7×) Agrobacterium glycerol culture to 5 mL of LB liquid medium (50 μg / mL Rif, 100 μg / mL Kan), 28°C, 220 rpm, overnight activation. 2) Prepare 50 mL of LB liquid medium containing Rif (50 μg / mL), Kan (100 μg / mL), MES (10 mM), acetosyringone (100 μM), add 1 mL of activated culture solution, 220 rpm, 28°C, culture for 5-6 hours until OD600 = 0.5-0.6, 6000 rpm, 5 minutes, discard the supernatant, and wash twice with sterile water. 3) Prepare a resuspension containing MES (10mM), MgCl2 (10mM), and acetosyringone (100μM) (10mL sterile water plus 20μL acetosyringone, 100μL MgCl2 and 100μL MES), resuspend the bacteria and adjust OD600 = 0.8-1.0. 4) Mix the pTRV2-STTM396a, pTRV2-STTM1557 and pTRV2-SP1557 (7×) resuspensions with the pTRV1 resuspension in a volume ratio of 1:1, and let stand in the dark for 3h at room temperature. Select cotton seedlings in the two cotyledon period, use a syringe to scratch the back of the cotyledon, and be careful not to penetrate. Use a 1mL syringe to absorb the mixed solution in step

[0072] , inject the cotyledon, and allow the mixed solution to infiltrate the entire cotyledon, and culture in the dark for 48h. 5) After the dark treatment, the injected cotton seedlings were cultured at a temperature of 25° C., a photoperiod of 10 h (darkness) / 14 h (light), and a relative humidity of 60%.

[0089] Figure 7 It is shown that 20 days after the tomatoes were infected with the mixed solution by syringe injection, STTM396a, STTM1557 and SP1557(7×) were detected by PCR. The results showed that STTM396a (lanes 1-2), STTM1557 (lanes 3-4) and SP1557(7×) (lanes 5-6) had been successfully transferred into tomato plants.

[0090] Figure 8 The expression level of novel-miR-1557 was detected by qPCR 5 days after the whiteflies successfully infect tomatoes with the mixed solution. Compared with STTM396a, the expression level of novel-miR-155 decreased by 61.4% and 32.9% after whiteflies fed on tomatoes containing STTM1557 and SP1557 (7×), respectively.

[0091] Fig. 9The following is a bioassay method for imidacloprid after whiteflies fed on STTM1557 and SP1557 (7×) tomatoes: 50 mL of imidacloprid with a concentration of 200 mg / L was poured into tomatoes tested to contain STTM1557 and SP1557 (7×) and treated for 48 hours. After that, 15-20 whiteflies were placed in feeding cages, which were then clamped on tomato leaves for whiteflies to suck juice. The number of dead whiteflies in the feeding cages was counted every 24 hours.

[0092] Imidacloprid bioassay after Bemisia tabaci fed on tomatoes containing STTM1557 and SP1557 (7×) Fig.10 ). The experimental results showed that after whiteflies fed on tomatoes containing STTM1557 and SP1557 (7×), the mortality rate of whiteflies was significantly increased by applying 200 mg / L imidacloprid. The above results indicate that STTM1557 and SP1557 (7×) can reduce the resistance level of whiteflies to imidacloprid and improve the control effect of imidacloprid.

Claims

1. Application of a miRNA competitive binding inhibitor in pest control, characterized in that: Application of specific competitive binding inhibitors acting on novel-miR-1557 in the management of resistance of Bemisia tabaci to imidacloprid.

2. The use according to claim 1, characterized in that The sequence of novel-miR-1557 is: 5'-UGCCGGACACGGGAGCUGUC-3'.

3. The use according to claim 1 or 2, characterized in that: The competitive binding inhibitors of novel-miR-1557 used were STTM1557 or SP1557 (7×); >STTM1557 GAGCTCTGCCGGACACGGGAGCTGTCGTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAATATGGTCTAAAGAAGAAGAATTGCCGGACACGGGAGCTGTCCTCGAG >SP1557(7×) GAGCTCGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACTCGAG.

4. A method for controlling the resistance of Bemisia tabaci to imidacloprid, characterized in that: The method comprises the steps of introducing the novel-miR-1557 competitive binding inhibitor into plants by constructing a recombinant vector.

5. The method according to claim 4, characterized in that The sequence of novel-miR-1557 is: 5'-UGCCGGACACGGGAGCUGUC-3'.

6. The method according to claim 4, characterized in that The novel-miR-1557 competitive binding inhibitor is STTM1557 or SP1557 (7×); >STTM1557 GAGCTCTGCCGGACACGGGAGCTGTCGTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAATATGGTCTAAAGAAGAAGAATTGCCGGACACGGGAGCTGTCCTCGAG >SP1557(7×) GAGCTCGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACCGGGACAGCTCCGGGTCCGGCACTCGAG.

7. The method according to claim 4, characterized in that The plant is a host plant for Bemisia tabaci.

8. The method according to claim 7, characterized in that The plant is tomato or tobacco.

9. The method according to claim 4, characterized in that This is achieved by constructing a recombinant viral plasmid and infecting plants with virus-induced gene silencing.

Images