Application of CmTCP1 gene in creation of muskmelon without tendrils

Abstract

The invention provides application of a CmTCP1 gene in creation of a muskmelon without tendrils, and belongs to the technical field of plant gene editing and plant character improvement. According to the invention, the CmTCP1 gene of the muskmelon is edited mainly by using a CRISPR / Cas9 gene editing technology, so that the function of promoting the formation of tendrils by the protein generated by the expression of the CmTCP1 gene is destroyed or weakened, the development of the tendrils of the muskmelon is inhibited, the tendril character of the muskmelon is changed, the germplasm of the muskmelon without tendrils is created, the new improved muskmelon variety without tendrils is cultivated, the plant type management in the cultivation process of the muskmelon can be simplified, and the yield of the muskmelon is increased. Manpower and material resource consumption is reduced, and melon planting benefits are improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant gene editing and plant trait improvement, and specifically relates to a CmTCP1 The application of genes in creating tendrilless melon. Background Art

[0002] Tendrils are the locomotor organs of Cucurbitaceae plants, enabling them to climb to heights. Melon, a Cucurbitaceae fruit crop with important nutritional and economic value, is widely cultivated in my country and serves as a model plant for studying sexual differentiation and tendril tactile movement. Tendrils form at almost every node of the melon plant. In the wild, these tendrils enable the plant to climb upward, achieving optimal light and temperature conditions. However, under current protected cultivation methods, melons grow primarily through artificial vine hanging and vine traction, eliminating the need for tendrils to provide climbing support. Furthermore, the growth of tendrils consumes additional nutrients, and the abnormal entanglement of tendrils increases the difficulty of plant management, requiring additional manpower and resources to remove the tendrils. Therefore, cultivating tendril-free melon varieties has become an important direction in melon breeding.

[0003] Research on genes regulating tendril growth and development in plants has made some progress. Calonje et al. cloned two MADS-box genes, VFUL-L and VAP1, from grapes and found that they are expressed throughout tendril development, demonstrating that grape tendrils are homeotic organs of flowers. CN 116715739 A (Beijing Academy of Agricultural and Forestry Sciences) discloses a method for creating tendril-free cucumber germplasm by site-directed mutagenesis. This method involves mutating the gene encoding the CsLFY protein in tendril-bearing cucumber varieties. Oizumi et al. reported a tendril-free melon material, ChibaTL, and Mizuno et al. subsequently determined that melon tendrils are modified structures of lateral branches.

[0004] However, there is currently a lack of tendril-free melon germplasm materials in China, which hinders the genetic improvement of the melon tendril trait. Summary of the Invention

[0005] In view of this, the present invention is committed to providing a method for creating tendril-free melons using gene editing technology, which can be used to cultivate new tendril-free melon varieties, reduce the consumption of manpower and material resources in the melon cultivation process, and increase the income of melon cultivation.

[0006] A first aspect of the present invention provides a CmTCP1 Application of genes in creating tendril-free melons, wherein the application is editing melons CmTCP1 Gene, destroying or weakening the function of CmTCP1 protein in maintaining tendril formation to produce tendril-free melon materials.

[0007] The "tendril-free muskmelon" of the present invention refers to a muskmelon material in which no tendrils are formed or in which the tendrils are transformed into a modified side branch structure containing flowers and leaves and lose the winding function.

[0008] Among them, in the present invention, " CmTCP1 The gene "is in the melon genome DHL92 v4 with the gene ID MELO3C022091. CmTCP1 The nucleotide sequence of a gene consists of any of the following: 1) The nucleotide sequence shown in SEQ ID NO. 1; 2) The homologous sequence of the nucleotide sequence shown in SEQ ID NO. 1 in melon.

[0009] Among them, the homologous sequence of the nucleotide sequence shown in SEQ ID NO.1 in melon is preferably a nucleotide sequence derived from different melon materials and has 90% or more, 92% or more, 94% or more, 95% or more, 96% or more, 98% or more, 99% or more, 99.5% or more, or 99.9% or more identity with the nucleotide sequence shown in SEQ ID NO.1, and has the same function of promoting tendril formation as SEQ ID NO.1.

[0010] The second aspect of the present invention provides a method for changing the tendril traits of melon, comprising editing the melon CmTCP1 gene, making the CmTCP1 The gene-expressed protein CmTCP1 is inactivated or has reduced activity.

[0011] Further, the gene knockout method was used to edit the CmTCP1 Gene, which makes CmTCP1 The gene cannot produce the protein that promotes tendril formation or the function of the protein produced is weakened, even if the CmTCP1 The function of the protein produced by the gene to promote tendril formation is destroyed or weakened, thereby achieving the purpose of creating tendril-free melon germplasm and cultivating tendril-free melon varieties. CmTCP1 Gene.

[0012] design CmTCP1 gene editing targets using the CRISPR / Cas9 system CmTCP1 Gene editing to CmTCP1 Insertion or deletion of several nucleotides at specific positions of genes CmTCP1 The gene-expressed protein CmTCP1 is inactivated or has reduced activity.

[0013] In one embodiment of the present invention, the target site sequence of the CRISPR / Cas9 system comprises or consists of any of the following sequences: 1) The nucleotide sequence shown in SEQ ID NO. 2, i.e., positions 917 to 935 of the nucleotide sequence shown in SEQ ID NO. 1; 2) A homologous sequence of the nucleotide sequence shown in SEQ ID NO.2 in melon; preferably, the homologous sequence is a nucleotide sequence that is about 90% or more, 92% or more, 94% or more, 95% or more, 96% or more, 98% or more, 99% or more, 99.5% or more, or 99.9% or more identical to the nucleotide sequence shown in SEQ ID NO.2.

[0014] Further, edit CmTCP1 Genetic material includes at least one of the following: (a) an expression cassette and / or vector into which the CRISPR / Cas9 system is introduced; (b) A microorganism into which the expression cassette and / or vector described in (a) has been introduced.

[0015] In one embodiment of the present invention, the expression cassette, vector, or expression cassette and vector introduced with the CRISPR / Cas9 system are applied to gene editing of melon, which can be used for CmTCP1 Genes are edited to inhibit the development of melon tendrils, thereby changing the characteristics of melon tendrils.

[0016] There is no specific limitation on the type of vector, as long as it can be introduced into melons with the aid of engineered bacteria and function properly with the CRISPR / Cas9 system. Specifically, vectors include but are not limited to pBSE402, pKSE401, pZHW512G, or pGH-CR.

[0017] In one embodiment of the present invention, the expression cassette and / or vector is introduced into a microorganism. Here, "microorganism" refers to the expression cassette and / or vector introduced into the CRISPR / Cas9 system, and also includes the progeny of such microorganism carrying the expression cassette and / or vector.

[0018] The microorganism can be any prokaryotic or eukaryotic cell organism, including but not limited to Agrobacterium, Bacillus subtilis, Bacillus subtilis, Escherichia coli, lactic acid bacteria, or other microorganisms commonly used by those skilled in the art as suitable host cells. Preferably, the microorganism is Agrobacterium tumefaciens, specifically including but not limited to Agrobacterium EHA105, Agrobacterium LBA440, Agrobacterium EHA101 or Agrobacterium GV3101.

[0019] In one embodiment of the present invention, the microorganism is Escherichia coli DH5a.

[0020] In one embodiment of the present invention, an expression cassette and / or vector comprising a CRISPR / Cas9 system is used to develop improved tendril-free melon material.

[0021] In one embodiment of the present invention, the microorganism is included for cultivating improved tendril-free melon material.

[0022] In one embodiment of the present invention, the CRISPR / Cas9 system is used to knock out the 932nd A base in the nucleotide sequence shown in SEQ ID NO.1, thereby destroying CmTCP1 The function of the gene is to suppress the tendrils of melons to form tendril-free melon materials.

[0023] In one embodiment of the present invention, the CRISPR / Cas9 system is used to knock out 60 bases from position 887 to position 946 of the nucleotide sequence shown in SEQ ID NO.1, thereby destroying the melon CmTCP1 The function of the encoded protein is to inhibit the tendrils of melons, forming tendril-free melon materials.

[0024] A third aspect of the present invention provides a method for changing the tendril trait of muskmelon, the use of the expression cassette and / or vector, or the microorganism in preparing tendril-free muskmelon material.

[0025] A fourth aspect of the present invention provides a melon breeding method, wherein the melon material obtained by the above method for changing the melon tendril trait is self-pollinated or hybridized with other melon varieties to obtain melon material offspring that have lost their tendrils.

[0026] In one embodiment of the present invention, the melon breeding method is to hybridize a diploid melon material without tendrils with other diploid melon varieties to obtain offspring of the diploid melon material without tendrils.

[0027] Therefore, the present invention is to edit the melon CmTCP1 Gene, inhibits the development of melon tendrils, changes the melon tendril traits, creates tendril-free melon germplasm, and cultivates new improved melon varieties without tendrils. It can promote the genetic improvement of melon tendril traits, simplify plant management during melon cultivation, reduce manpower and material resources consumption, and increase the income from melon cultivation. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 For the wild type WT and mutant in Example 3 Cmtcp1-1 and mutants Cmtcp1-2 middle CmTCP1 Gene sequence alignment diagram.

[0029] Figure 2 For the wild type WT and mutant in Example 3 Cmtcp1-1and mutants Cmtcp1-2 Phenotype diagram of melon plants. DETAILED DESCRIPTION

[0030] The technical solution of the present invention is further described in detail below through specific implementation methods.

[0031] Unless otherwise specified, the terms used in this invention are commonly used in the relevant field. The technical means used in the examples, such as preparation methods and testing methods, are conventional means well known to those skilled in the art. The reagents and products used are commercially available. The sources and trade names of the reagents used, as well as their components, are indicated upon their first appearance, where necessary.

[0032] The gene editing vector pBSE402 comes from the research group of Li Zheng of Northwest Agriculture and Forestry University. eGFP 、 Cas9 and sgRNA Expression cassette, when the vector is transformed into plant cells eGFP The expression cassette will express green fluorescent protein, which will emit green fluorescence under blue light and be used to screen positive transgenic individuals.

[0033] Agrobacterium tumefaciens strain GV3101 and Escherichia coli strain DH5α were purchased from Beijing Zhuangmeng International Biogene Technology Co., Ltd. All other materials and reagents whose sources were not mentioned were purchased.

[0034] Example 1. CmTCP1 Preparation of engineered bacteria containing gene editing vectors 1. [[ID= Gene editing target site design exist ​ A target site sequence was designed on the gene with a length of 19 bp. The nucleotide sequence of the target site was CAACCGTCGATGCCAACGC (SEQ ID NO. 2), located at positions 917-935 of the nucleotide sequence shown in SEQ ID NO. 1.

[0035] Based on the nucleotide sequence of the target site, the sgRNA sequence was designed as shown in SEQ ID NO.3.

[0036] 2. Construction of gene editing vector Based on the target site DNA sequence shown in SEQ ID NO.2, two DNA oligonucleotides were designed, as shown in SEQ ID NO.3 and SEQ ID NO.4, respectively: TCP1-TF: ATTGCAACCGTCGATGCCAACGC (SEQ ID NO.4); TCP1-TR: AAACGCGTTGGCATCGACGGTTG (SEQ ID NO.5).

[0037] Table 1 Sequence annealing reaction system The reaction system was prepared according to Table 1, and the two DNA oligonucleotides were annealed to form double-stranded fragments. The annealing conditions were: denaturation at 95°C for 4 min, with a gradient of -0.1°C / s, decreasing to 20°C.

[0038] The annealed double-stranded fragment was ligated with the pBSE402 vector by Golden Gate ligation. The resulting vector was named pBSE402-TCP1-T. The ligation system is shown in Table 2. The ligation reaction conditions were: 37°C, 5 h; 50°C, 5 min; 80°C, 10 min.

[0039] Table 2 Golden gate reaction system The ligation product was transformed into competent Escherichia coli DH5a, plated and cultured, and positive clones were identified by PCR and sequenced to confirm the sequence was correct, and then the pBSE402-TCP1-T plasmid was extracted.

[0040] 3. Agrobacterium transformation and activation The pBSE402-TCP1-T plasmid obtained above was transformed into the competent Agrobacterium tumefaciens GV3101 by heat shock method to obtain the engineered bacteria GV3101 / pBSE402-TCP1-T.

[0041] The engineered bacteria GV3101 / pBSE402-TCP1-T were placed in 2×YT liquid medium and cultured overnight until OD 600 The bacterial solution was centrifuged and the supernatant was discarded. The bacterial solution was resuspended in infection solution to an OD of 0.7-0.9. 600 is 0.1.

[0042] The infection solution was prepared as follows: 4.43 g of MS powder and 30 g of sucrose were dissolved in 1 L of ddH2O, the pH was adjusted to 5.8, and the solution was sterilized at 121°C for 20 min. The solution was then cooled to approximately 60°C, and 1 mL of 20 mg / mL acetosyringone, 0.5 mL of 125 mg / mL 2-morpholineethanesulfonic acid, and 200 μL of the surfactant Silwet-L77 were added in a clean bench.

[0043] Example 2 Obtaining Melon Plants Transformed with Gene Editing Vectors 1. Explant Preparation Explants were prepared from ungerminated melon seeds. Full, intact seeds were selected and soaked at 55°C for 30 minutes. The husks were removed. The seeds were disinfected in a cleanroom with 75% alcohol for 1 minute and 3% sodium hypochlorite for 15 minutes. The radicle and other parts were cut 2 mm from the proximal end of the cotyledon. The two cotyledons were then separated and used as explants.

[0044] 2. Agrobacterium infection The infection solution containing the engineered Agrobacterium GV3101 / pBSE402-TCP1-T in Example 1 was mixed with the explants and infected for 20 minutes. After infection, the bacterial solution on the explants was dried on sterile filter paper.

[0045] 3. Co-cultivation A piece of sterilized filter paper was spread on the co-cultivation medium, and the infected cotyledon explants were placed on the filter paper. The surface was sealed with medical tape and co-cultivated at 25°C in the dark for 5 days.

[0046] The co-culture medium was prepared by dissolving 4.43 g of MS powder in 1 L of ddH2O, adjusting the pH to 5.8, adding 8 g of agar, and autoclaving at 121°C for 20 min. Once the medium had cooled to approximately 60°C, the following sterilized reagents (filtered and sterilized) were added in a clean hood: 1 mL of 20 mg / mL acetosyringone, 1 mL of 1 mg / mL 6-BA, 0.5 mL of 2 mg / mL ABA, 0.5 mL of 125 mg / mL 2-morpholineethanesulfonic acid, and 1 mL of 2 mg / mL silver nitrate.

[0047] 4. Bud induction The cotyledons after co-cultivation were inserted into bud induction medium and cultured at 26°C / 16 h and 22°C / 8 h for 3 to 4 weeks.

[0048] Prepare the bud induction medium as follows: dissolve 4.43 g MS powder and 30 g sucrose in 1 L of ddH2O, adjust the pH to 5.8, add 8 g agar, and autoclave at 121°C for 20 min. Once the medium has cooled to approximately 60°C, add the following sterilized, filter-sterilized reagents in a clean hood: 1 mL of 1 mg / mL 6-BA (6-benzylaminoadenine), 0.5 mL of 2 mg / mL ABA (abscisic acid), 1 mL of 2 mg / mL silver nitrate, 1 mL of 200 mg / mL timentin, and 1 mL of 200 mg / mL cephalosporin.

[0049] 5. Rooting of regenerated seedlings Transgenic positive buds containing GFP fluorescence were selected and cut from the base of the stem when they grew to 2-3 cm. They were transferred to rooting medium to induce rooting for about two weeks. The rooted regenerated seedlings were acclimated and then planted in a plastic greenhouse.

[0050] The rooting medium was prepared by adding 50 mL of vermiculite and 40 mL of 4.43 g / L MS culture solution into a glass bottle and sterilizing at 121°C for 20 min.

[0051] Example 3 ​ Identification and phenotypic observation of gene-edited plants The leaves of different T0 transgenic melon plants obtained in Example 2 were collected and genomic DNA was extracted as a template. ​ PCR amplification was performed using gene identification primers. The identification primer sequences are shown in SEQ ID NO. 6 and SEQ ID NO. 7, respectively: TCP1-IF: GCCCAAAGAGGGCTAAAGTTTACC (SEQ ID NO. 6); TCP1-IR: CAATTTGGAGTCAAATTGGAAGCTGG (SEQ ID NO. 7).

[0052] The PCR amplified products were subjected to Sanger sequencing and compared with those in wild-type melon WT. ​ Gene sequence comparison and screening ​ The gene-edited plants were self-pollinated to obtain T1 generation seeds.

[0053] Sanger sequencing of PCR products was also used to screen T1 plants. ​ Homozygous edited individuals. Sequencing results are as follows ​ As shown, two editing forms were found in T1 plants. ​ Sequences, the corresponding plants were named mutants ​ and mutants ​ Compared with wild-type melon WT, the mutant ​The 932nd A base of the nucleotide sequence shown in SEQ ID NO.1 is deleted, and the mutant ​ The 60 bases from position 887 to position 946 (CAATTTCGGTCTCCGCCGCCTCCGCCACCGCAACCGTCGATGCCAACGCCGGTTGTACAA) of the nucleotide sequence shown in SEQ ID NO.1 were deleted. The tendril phenotype of the mutant is as follows ​ As shown, unlike the wild type, which can form normal tendrils, the mutant ​ and ​ In the experiment, the tendrils cannot form and instead a modified side branch is formed.

[0054] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to preferred embodiments, ordinary technicians in the field should understand that the specific implementation methods of the present invention can still be modified or some technical features can be replaced by equivalents without departing from the spirit of the technical solutions of the present invention. They should all be included in the scope of the technical solutions claimed for protection by the present invention.

Claims

1. A CmTCP1 Application of genes in creating tendril-free melons, the application being editing melons CmTCP1 Gene, destroying or weakening the function of CmTCP1 protein in maintaining tendril development, so as to produce melon materials without tendrils; Said CmTCP1 The nucleotide sequence of a gene contains or consists of any of the following sequences: 1) The nucleotide sequence shown in SEQ ID NO.1; 2) The homologous sequence of the nucleotide sequence shown in SEQ ID NO.1 in melon.

2. A method for changing the characteristics of melon tendrils, comprising editing the melon CmTCP1 Gene, making the CmTCP1 The protein CmTCP1 expressed by the gene is inactivated or its activity is reduced; among them, Said CmTCP1 The nucleotide sequence of a gene contains or consists of any of the following sequences composition: 1) The nucleotide sequence shown in SEQ ID NO.1; 2) The homologous sequence of the nucleotide sequence shown in SEQ ID NO.1 in melon.

3. The method according to claim 2, characterized in that The gene knockout method was used to edit the CmTCP1 Gene, making the CmTCP1 The function of the protein produced by the gene to promote tendril formation is destroyed or weakened; Preferably, the CRISPR / Cas9 system is used to target and knock out the CmTCP1 Gene.

4. The method according to claim 3, characterized in that The CRISPR / Cas9 system is used to knock out the 932nd A base in the nucleotide sequence shown in SEQ ID NO.1, so that the formation of melon tendrils is inhibited.

5. The method according to claim 3, characterized in that: The CRISPR / Cas9 system was used to knock out 60 bases from position 887 to position 946 in the nucleotide sequence shown in SEQ ID NO.1, thereby inhibiting the formation of melon tendrils.

6. The method according to any one of claims 3 to 5, characterized in that: The target site sequence of the CRISPR / Cas9 system comprises or consists of any of the following sequences composition: 1) The nucleotide sequence shown in SEQ ID NO.2; 2) The homologous sequence of the nucleotide sequence shown in SEQ ID NO.2 in melon.

7. The method according to claim 6, characterized in that edit CmTCP1 The genetic material includes at least one of the following: (a) an expression cassette and / or vector into which the CRISPR / Cas9 system is introduced; (b) a microorganism into which the expression cassette and / or vector described in (a) is introduced; Preferably, the vector comprises pBSE402, pKSE401, pZHW512G or pGH-CR; Preferably, the microorganism comprises Agrobacterium, Bacillus subtilis, Bacillus subtilis, Escherichia coli or lactic acid bacteria; more preferably, the microorganism is Agrobacterium tumefaciens.

8. Use of the method according to any one of claims 2 to 7, or the expression cassette and / or vector according to claim 7, or the microorganism according to claim 7 in the preparation of tendril-free melon material.

9. A method for breeding melons, comprising selfing the melon material obtained by the method according to any one of claims 2 to 7 or hybridizing the melon material with other melon varieties to obtain offspring of the melon material without tendrils.

10. The melon breeding method according to claim 9, characterized in that: The tendril-free diploid melon material is hybridized with other diploid melon varieties to obtain the tendril-free diploid melon material offspring.

Images