Application of SlPRR5 gene in regulation and control of tomato chlorophyll synthesis and photosynthetic efficiency

Abstract

The invention provides an application of an SlPRR5 gene in regulation and control of tomato chlorophyll synthesis and photosynthetic efficiency. The nucleotide sequence of the SlPRR5 gene is as shown in SEQ ID NO. 1. A transgenic tomato plant with overexpression and gene knockout of the SlPRR5 gene is constructed and obtained, and by observing the chlorophyll content and photosynthetic capacity of the tomato, it is found that the SlPRR5 gene can effectively regulate and control synthesis of tomato chlorophyll and remarkably regulate the photosynthetic efficiency of the tomato plant, so that the growth state of the plant is changed. The invention provides a new gene regulation strategy for optimization of photosynthetic capacity and yield increase of tomatoes.

Description

Technical Field

[0001] The invention relates to the technical fields of genetic engineering, plant physiology and molecular biology, and in particular to the application of SlPRR5 gene in regulating tomato chlorophyll synthesis and photosynthetic efficiency. Background Art

[0002] Tomato (Solanum lycopersicum) is an important economic crop with a wide planting area worldwide. Its yield and quality are directly affected by the efficiency of photosynthesis. Photosynthesis is the process by which plants absorb light energy and convert it into chemical energy. Chlorophyll is an indispensable core pigment in this process and is directly involved in the capture and conversion of light energy. Therefore, the chlorophyll content determines the photosynthetic efficiency and yield of plants to a large extent. Studying the influencing mechanism of tomato chlorophyll content and photosynthetic efficiency, and exploring the key genes that regulate tomato chlorophyll synthesis and improve photosynthetic efficiency are of great significance to promoting the growth and development of tomatoes and increasing yields. This research direction has always been one of the focuses in agricultural breeding and crop improvement.

[0003] In higher plants, the circadian clock controls a wide range of cellular processes, such as photosynthesis and stress responses. Studies have shown that PSEUDO-RESPONSE REGULATOR 5 (PRR5) binds to target DNA by binding to the CCT motif in vivo, and its direct targets include genes encoding transcription factors involved in flowering time regulation, hypocotyl elongation and cold stress response, thereby affecting plant growth and development and its resistance to adversity (Norihito N, Takatoshi K, Mari K, et al. Transcriptional repressor PRR5 directly regulates clock-output pathways. PNAS, 2012, 109 (42): 17123-8.).

[0004] However, to date, there has been no relevant research report on the function of the SlPRR5 gene in regulating tomato chlorophyll synthesis and photosynthetic efficiency, and its specific regulatory mechanism in tomatoes still needs to be further explored. Summary of the invention

[0005] The present invention provides an application of the SlPRR5 gene in regulating tomato chlorophyll synthesis and photosynthetic efficiency, aiming to regulate the chlorophyll content and photosynthetic rate of tomatoes by regulating the expression level of the SlPRR5 gene.

[0006] The specific technical solutions are as follows:

[0007] The application of SlPRR5 gene in regulating tomato chlorophyll synthesis, the nucleotide sequence of the SlPRR5 gene is shown in SEQ ID NO.1.

[0008] Application of the SlPRR5 gene in regulating tomato photosynthetic efficiency, the nucleotide sequence of the SlPRR5 gene is shown in SEQ ID NO.1.

[0009] The amino acid sequence of the protein encoded by the SlPRR5 gene is shown in SEQ ID NO. 2. The present invention constructs a transgenic tomato with overexpression and gene editing of the SlPRR5 gene, and finds that the SlPRR5 gene can regulate the chlorophyll content and photosynthetic rate of tomato plants, thereby regulating the photosynthetic efficiency of tomato plants.

[0010] Furthermore, the application of genetically engineered bacteria in regulating tomato chlorophyll synthesis and / or photosynthetic efficiency is characterized in that the genetically engineered bacteria contains a vector for editing the SlPRR5 gene; the nucleotide sequence of the SlPRR5 gene is shown in SEQID NO.1; and the editing includes knocking out and overexpressing the gene.

[0011] Furthermore, the regulation method is one of the following:

[0012] (1) Through gene overexpression technology, the expression level of the S1PRR5 gene is increased, the chlorophyll content and photosynthetic rate of tomato plants are reduced, thereby reducing the photosynthetic efficiency;

[0013] (2) By knocking out the S1PRR5 gene, the chlorophyll content and photosynthetic rate of tomato plants were increased, thereby improving photosynthetic efficiency.

[0014] Furthermore, the method for constructing a mutant overexpressing the S1PRR5 gene is:

[0015] (1) constructing an overexpression vector containing the CDS sequence of the tomato S1PRR5 gene, the CDS sequence of which is shown in SEQ ID NO.3;

[0016] (2) transferring the vector into Agrobacterium competent cells to obtain Agrobacterium containing the SlPRR5 gene overexpression vector;

[0017] (3) The cotyledons of common wild-type tomatoes were infected with the Agrobacterium, seedlings were obtained again through tissue culture, and positive transgenic plants overexpressing the SlPRR5 gene were obtained by screening.

[0018] Furthermore, the knockout method is CRISPR / Cas9 gene editing technology.

[0019] Furthermore, the method for knocking out the S1PRR5 gene is:

[0020] (1) Design two target sequence sgRNAs for the SlPRR5 gene and construct a CRISPR / Cas9 vector for editing the tomato SlPRR5 gene;

[0021] (2) transferring the vector into Agrobacterium competent cells to obtain Agrobacterium carrying the CRISPR / Cas9 vector;

[0022] (3) The cotyledons of wild-type tomatoes were infected with Agrobacterium infection fluid containing the SlPRR5 gene editing vector, and seedlings were obtained through tissue culture. Mutant plants lacking the SlPRR5 gene were screened.

[0023] Furthermore, the vector is pAC004-HA with a 35S promoter; and the host cell is Agrobacterium GV3101.

[0024] Furthermore, in step (1), the two target sequence sgRNAs are shown as SEQ ID NO.4 and SEQ ID NO.5.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] (1) The present invention constructs transgenic tomato plants with overexpression and knockout of the SlPRR5 gene. By observing the chlorophyll content and photosynthetic capacity of tomatoes, it is found that the SlPRR5 gene can effectively regulate the synthesis of tomato chlorophyll and significantly adjust the photosynthetic efficiency of tomato plants, thereby changing the growth state of the plants.

[0027] (2) The present invention successfully achieved targeted regulation of the SlPRR5 gene through CRISPR / Cas9 gene editing technology and Agrobacterium-mediated transgenic technology. These methods not only have high efficiency and accuracy, but can also be applied to the improvement of other crops, providing important technical support for plant functional gene research and agricultural breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The gene editing site and amino acid changes of the homozygous mutant plant of the SlPRR5 gene in Example 1;

[0029] Among them, WT is the common wild-type tomato variety Condine Red, prr5-2# and prr5-9# are two strains of SlPRR5 gene knockout mutants. The prr5-2# strain had a base insertion at a gene editing target site, resulting in premature translation termination; the prr5-9# strain had a base deletion at a gene editing target site, also resulting in premature translation termination.

[0030] Figure 2The results of Western Blot and gene expression detection of transgenic protein in the SlPRR5 gene overexpressing tomato strain in Example 2; wherein A is the level of SlPRR5 protein content, and B is the level of SlPRR5 gene expression;

[0031] Figure 3 The chlorophyll content and phenotype of the wild-type tomato plants, SlPRR5 gene knockout mutants and SlPRR5 gene overexpression plants in Example 3; wherein A is the leaf color phenotype of the plant, and B is the chlorophyll content of the plant; WT is the wild-type tomato; prr5-2# and prr5-9# are SlPRR5 gene knockout mutants; OE-SlPRR5-8# and OE-SlPRR5-14# are SlPRR5 overexpression plants.

[0032] Figure 4 It is the photosynthetic efficiency of the leaves of the SlPRR5 gene knockout mutant and the SlPRR5 gene overexpressing plant in Example 3; A is the plant phenotype, B is the maximum photochemical efficiency of photosystem II (ΦPSII), and C is the photosynthetic rate (Pn). DETAILED DESCRIPTION

[0033] The present invention will be further described below in conjunction with the accompanying drawings and specific examples. It should be understood that these examples are only intended to illustrate the present invention and are not intended to limit the scope of the present invention. The operating methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0034] SEQ ID NO.1:

[0035]

[0036] SEQ ID NO.2:

[0037] MGEVVVSSEGDLEVIGGGDMVIETEAGGNMKETGAGAAVAAASSSILKWERFLPKMVFRVLLVESDDSTRQIVAALLRKCSYRVAAVSDGLKAWELLKGRPHNVDLILTEVDLPSISGYALLSLIMEHDICKNIPVIMMSSNDSVSTVYRCMLRGAADFLVKPVRKNELRNLWQHVWRRRAASGSSQGPVDESVAQQKVEATAENNACSNHSSGYKACVQRNRECIEKGSDAQSSCTKPELENEEENAENLPESVQPNREASLPNAADLVKELLHEANNRLRISENDGRAPTTDANAMTRGEDINSDDNWGHGRTIGQTSDEHPGPPTKQAIDLIGAFDNYLKCNSKSSGSDTRINKGDSSPLLDLSLTRSHPSGSVNQFTNEKRRLNHSDTSAFTRYVNRAMQSGQSTSSRTYNLQEYETDSDKQLCGHAIDYNSDTRGPMTRPQSVAPPSYAEPGPAEIGFPSPQQRVTPLPISVRGIRFEGPSSAYCSMIAPILRMPSGISPLQSPGSATPGESSYQANPFLALNCESRSSQKFHSQSDQNNSDSSAYNEGKRGHMSEPTTDCERFPSATDQTINSICCNGDLNHVHLSYGSNGNISLPPGKTPAEYWKEESLHTTDGNSQRSQREAALTKFRMKRKDRCFEKKVRYESRKKLAEQRPRVKGQFVRHVPSESSPGNS。

[0038] SEQ ID NO.3:

[0039]

[0040] Example 1 Obtaining S1PRR5 gene knockout plants

[0041] 1. Construction of CRISPR / Cas9 gene editing vector for SlPRR5 gene

[0042] The gene sequence of tomato SlPRR5 was obtained from the NCBI database (http: / / www.ncbi.nlm.nih.gov / ) and the CRISPR-P 2.0 (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR) Design SlPRR5 gene sgRNA (small guide RNA);

[0043] sgRNA1: TGGAAATATGAAGGAAACAG (SEQ ID NO. 4), sgRNA2: CTTAGGAAATGCAGTTACAG (SEQ ID NO. 5).

[0044] Figure 1 Shown are the locations and sequences of two sgRNAs on the tomato SlPRR5 gene.

[0045] The specific construction process of the vector is as follows: first, PCR amplification primers containing sgRNA1 and sgRNA2 were designed, and the PCR fragments of the two targets were amplified using plasmid Y0014472-1 as a template. The specific primer sequences are shown in Table 1.

[0046] The two amplified PCR products were connected to the pAEE401 plasmid containing the endonuclease BbsI site by Golden Gate assembly kit (BsaI-HFv2) (NEB, E1601). The obtained vector pAEE401-SlPRR5 was sequenced to confirm whether it was successfully constructed.

[0047] Table 1 PCR primer sequences for constructing CRISPR / Cas9 vectors

[0048]

[0049]

[0050] 2. Obtaining SlPRR5 gene CRISPR / Cas9 gene-edited plants

[0051] Agrobacterium transformed with the recombinant plasmid pHEE401-SlPRR5 was obtained by the heat shock method. The competent state of Agrobacterium was GV3101. The wild-type tomato cotyledons were infected by Agrobacterium, and the infected cotyledons were then developed into complete transgenic tomato plants through plant tissue culture.

[0052] Subsequently, primers were designed and verified according to the target location, which were:

[0053] 401-Y-P5-F:AAACATAAGTAGGAATCGAAGAAAT (SEQ ID NO. 10);

[0054] 401-Y-P5-R:ATTAAGCCACAACTAACTC (SEQ ID NO. 11).

[0055] The transgenic plant DNA was extracted, amplified using PCR technology, and sequenced for verification. The mutation types obtained were heterozygous T0 plants with 1 base insertion in prr5-2# and 1 base deletion in prr5-9#. After self-pollination, T1 homozygous prr5-2# and prr5-9# plants were obtained ( Figure 1 ).

[0056] Example 2 Obtaining plants overexpressing the S1PRR5 gene

[0057] In order to clarify the regulatory mechanism of the circadian clock on chlorophyll synthesis in tomato plants, total RNA was extracted from tomato leaves and cDNA was obtained by reverse transcription. Using cDNA as a template, the SlPRR5 gene was cloned from the tomato genome.

[0058] According to the SlPRR5 coding region sequence, the multiple cloning site of the overexpression vector pAC004-HA and its nearby sequences, restriction enzyme sites (AscI and BamHI) were selected and homology arms were designed. The software CE DesignV1.03 was used to generate specific primers SlPRR5-F (ttacaattaccatggggcgcgccATGGGTGAGGTTGTTGTGAGTAGTG) and SlPRR5-R (aacatcgtatgggtaggtaccTGAGTTACCTGGCGAAGACTCA), and the sequences are shown in SEQ ID NO.12 and SEQ ID NO.13, respectively.

[0059] The SlPRR5 fragment was amplified by PCR with KOD high-fidelity enzyme and the PCR product was purified and recovered. The pAC004-HA vector was double-digested and purified to recover the linear vector after digestion. Then, the SlPRR5 fragment was connected to pAC004-HA with the Norwegian native recombinase Exnase II to obtain the plant overexpression vector pAC004-SlPRR5-HA. After successful expression in the plant, the expression vector will produce SlPRR5-HA fusion protein. The above recombinant plasmid was sent to the company for sequencing confirmation, and the nucleotide sequence of the obtained gene SlPRR5 is shown in SEQ ID NO.1; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2.

[0060] The results showed that the cloned sequence was consistent with the sequence published in the database, and the positive plasmid was extracted for future use.

[0061] 2. Obtaining plants overexpressing the SlPRR5 gene

[0062] The positive overexpression vector plasmid pAC004-SlPRR5-HA was transformed into Agrobacterium GV3101 by heat shock. The common tomato variety Condine Red was used as the wild type (WT), and Agrobacterium infection was carried out by cotyledon infection method. Then, callus, bud differentiation and rooting were induced successively by adjusting the hormone ratio, and finally T0 generation tissue culture seedlings were obtained. Western Blot was used to verify the SlPRR5 overexpression positive transgenic plants. The results showed that WT had no protein bands, while the overexpression strain had SlPRR5-HA bands ( Figure 2 ).

[0063] Example 3

[0064] 1. Detection of chlorophyll content and photosynthetic efficiency of SlPRR5 gene knockout plants and SlPRR5 gene overexpression plants Wild-type tomato WT, SlPRR5 gene knockout plants and SlPRR5 gene overexpression plants were used as experimental materials.

[0065] The seeds were soaked at a constant temperature of about 50°C for 15 minutes, and then cultured in a 28°C constant speed shaker (200 rpm / min) for about 2 days. The water was changed every 12 hours. After the radicle of the seeds turned white, they were sown in a 72-hole plug tray filled with a mixture of peat: vermiculite: perlite in a volume ratio of 4:2:1. The plug tray seedlings were grown in a plant factory with a photoperiod of 12h / 12h, an ambient temperature of 21°C / 19°C, a relative humidity of about 75%, and an average light intensity of 250μmol·m -2 s -1, the nutrient solution was 1 / 2 Hoagland nutrient solution. When the seedlings grew to three leaves and one heart, the individual plants were transplanted into plastic pots for cultivation under the same culture conditions as above. When the WT plants grew to five leaves and one heart, the chlorophyll content, the maximum photochemical efficiency of photosystem II and the photosynthetic rate were tested. Each group was treated with 10 biological replicates.

[0066] Results: Compared with wild-type tomatoes (WT), the chlorophyll content of SlPRR5 knockout tomato mutants was significantly increased, and ΦPSII and Pn in tomato plants were significantly increased; on the contrary, the chlorophyll content, ΦPSII and Pn of SlPRR5 overexpression plants were significantly lower than those of wild-type ( Figure 3 and Figure 4 ).

[0067] Based on the above research, the present invention discovered that knocking out tomato SlPRR5 can promote the synthesis of plant chlorophyll, while improving the maximum photochemical efficiency and photosynthetic rate of plant photosystem II. The present invention provides a new gene regulation strategy for optimizing the photosynthetic capacity of tomatoes and increasing yield.

[0068] In addition, it should be understood that after reading the above description of the present invention, those skilled in the art may make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. Application of SlPRR5 gene in regulating tomato chlorophyll synthesis, characterized in that: The nucleotide sequence of the SlPRR5 gene is shown in SEQ ID NO.

1.

2. Application of SlPRR5 gene in regulating tomato photosynthetic efficiency, characterized in that: The nucleotide sequence of the SlPRR5 gene is shown in SEQ ID NO.

1.

3. The use of genetically engineered bacteria in regulating tomato chlorophyll synthesis and / or photosynthetic efficiency, characterized in that: The genetically engineered bacteria contain a vector for editing the SlPRR5 gene; the nucleotide sequence of the SlPRR5 gene is shown in SEQ ID NO.1; and the editing includes knocking out and overexpressing the gene.

4. The use according to any one of claims 1 to 3, characterized in that: The method of regulation is one of the following: (1) Through gene overexpression technology, the expression level of the S1PRR5 gene is increased, the chlorophyll content and photosynthetic rate of tomato plants are reduced, thereby reducing the photosynthetic efficiency; (2) By knocking out the S1PRR5 gene, the chlorophyll content and photosynthetic rate of tomato plants were increased, thereby improving photosynthetic efficiency.

5. The use according to claim 3, characterized in that The method for constructing a mutant overexpressing the SlPRR5 gene is: (1) constructing an overexpression vector containing the CDS sequence of the tomato S1PRR5 gene, the CDS sequence of which is shown in SEQ ID NO.3; (2) transferring the vector into Agrobacterium competent cells to obtain Agrobacterium containing the SlPRR5 gene overexpression vector; (3) The cotyledons of common wild-type tomatoes were infected with the Agrobacterium, seedlings were obtained again through tissue culture, and positive transgenic plants overexpressing the SlPRR5 gene were obtained by screening.

6. The use according to claim 3, characterized in that The knockout method is CRISPR / Cas9 gene editing technology.

7. The use according to claim 3, characterized in that The method for knocking out the S1PRR5 gene is: (1) Design two target sequence sgRNAs for the SlPRR5 gene and construct a CRISPR / Cas9 vector for editing the tomato SlPRR5 gene; (2) transferring the vector into Agrobacterium competent cells to obtain Agrobacterium carrying the CRISPR / Cas9 vector; (3) The cotyledons of wild-type tomatoes were infected with Agrobacterium infection fluid containing the SlPRR5 gene editing vector, and seedlings were obtained through tissue culture. Mutant plants lacking the SlPRR5 gene were screened.

8. The use according to claim 6, characterized in that The vector is pAC004-HA with 35S promoter; the host cell is Agrobacterium GV3101.

9. The use according to claim 6, characterized in that In step (1), the two target sequence sgRNAs are shown as SEQ ID NO.4 and SEQ ID NO.5.

Images