Osteosarcoma cell line capable of stably, continuously and highly expressing C5orf46 gene as well as construction method and application of osteosarcoma cell line

Abstract

The invention discloses an osteosarcoma cell line capable of stably, continuously and highly expressing a C5orf46 gene as well as a construction method and application of the osteosarcoma cell line, and belongs to the technical field of biological medicines. The invention provides a construction method of an osteosarcoma cell line for highly expressing a C5orf46 gene. The construction method comprises the following steps: 1) designing a specific C5orf46 gene CDS region full-length amplification primer, and further constructing a C5orf46 gene expression vector; (2) transfecting a human osteosarcoma cell strain with the constructed C5orf46 gene expression vector; (3) purifying the transfected cell strain by using a fluorescence screening method; and (4) further stabilizing the recombinant cell line subjected to fluorescence screening by using a G418 drug, and carrying out continuous amplification culture. The C5orf46 stable high-expression cell line obtained by the invention has significance in medical research of osteosarcoma.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and specifically relates to an osteosarcoma cell line stably and persistently expressing a C5orf46 gene at a high level, and a preparation method and application thereof. Background Art

[0002] Osteosarcoma is the most common malignant bone tumor in children and adolescents. It has extremely high heterogeneity, which is mainly manifested in: different patients have different clinical manifestations, and even in the same patient, the biological behavior of different regions of the tumor tissue is also significantly different. Cells in different regions of osteosarcoma tissue have different functions and obvious heterogeneity. And because of this feature, many commonly used clinical treatments are difficult to play a role in osteosarcoma. For example, gene targeted therapy has achieved satisfactory therapeutic effects in many other cancers such as lung cancer and melanoma, and has even become the fourth largest tumor treatment method in lung cancer, along with chemotherapy, radiotherapy, and surgery. However, in osteosarcoma, due to the high heterogeneity of the tumor, no effective gene targets have been found so far, making targeted therapy difficult to implement. Similarly, the emerging immunotherapy has limited efficacy in osteosarcoma, and different patients have very different responses to treatment. It is for this reason that in the past three decades, the clinical treatment of osteosarcoma has not made significant progress. At present, cytotoxic chemotherapy is still the main treatment, and no other schemes have made breakthrough progress.

[0003] The high heterogeneity of the biological behavior of osteosarcoma precisely reflects the complexity of its tumor microenvironment. Different cell components, not only tumor cells, but also other cell components around the tumor, including: vascular endothelial cells, nerve cells, immune cells, etc., all have "interactive" behaviors with tumor cells, which have a significant impact on the function of the tumor. In this interactive process, exosomes play an important role as a "bridge". Analyzing the microenvironment of osteosarcoma tumors is of great significance to clarify the biological behavior of tumors and break through the current bottleneck of medical treatment.

[0004] The applicant has discovered that in the microenvironment of osteosarcoma tissue, a type of exosome is highly expressed: C5orf46 gene exosomes, suggesting its role in the biological behavior of osteosarcoma. However, unlike other cancers, the high heterogeneity of osteosarcoma determines that gene drugs cannot be widely used in clinical practice. It is necessary to first clarify in detail the specific effects of this gene on osteosarcoma tumor cells and surrounding blood vessels, nerves, immune and other cells, and determine the specific mechanism of its function before it can be applied in a targeted manner to specific target patient populations. To achieve this goal, it is necessary to first achieve the induced high expression of the gene in vitro, and then analyze and compare the effects of the gene on the biological functions of osteosarcoma cells before and after induced expression.

[0005] The present invention constructs a cell line with stable high expression of C5orf46 gene in osteosarcoma by combining cell transfection with fluorescence screening and G418 drug stability screening. The cell line can achieve continuous stable high expression of the gene in osteosarcoma. In this way, subsequent researchers can analyze the influence of C5orf46 gene on the occurrence and development of osteosarcoma and microenvironment regulation by comparing the biological behavior of the cell line with that of ordinary osteosarcoma cell lines. The cell line can be better applied to the practice of medical research on osteosarcoma. Summary of the invention

[0006] In view of the problems existing in the above-mentioned prior art, the purpose of the present invention is to design and provide an osteosarcoma cell line with a continuous, stable and high expression of the C5orf46 gene, as well as a preparation method and application thereof. The method includes: 1) designing a specific full-length amplification primer for the CDS region based on the CDS region sequence of the C5orf46 gene, and then constructing a C5orf46 gene expression vector; 2) transfecting the constructed C5orf46 gene expression vector into a human osteosarcoma cell line; 3) purifying the cell line obtained by the previous transfection by a fluorescence screening method; 4) using the G418 drug to further stabilize the recombinant cell line after fluorescence screening, and continuously expanding the culture. The C5orf46 stable high-expression cell line obtained by the present invention is of great significance to the medical research of osteosarcoma.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] In one aspect, the present invention provides a method for constructing an osteosarcoma cell line that highly expresses the C5orf46 gene, comprising the following steps:

[0009] (1) Design specific primers for amplifying the full-length CDS region of the C5orf46 gene;

[0010] (2) using normal human leukocyte DNA as a template and the amplification primers designed in step (1) above, amplifying the C5orf46 gene fragment by PCR, inserting the tool vector containing the drug resistance gene and the fluorescent signal, and obtaining the pEGFP-C5orf46 recombinant expression vector;

[0011] (3) The pEGFP-C5orf46 recombinant expression vector obtained in step (2) above was transformed into DH5α competent bacteria, positive clones were selected, the pEGFP-C5orf46 recombinant plasmid was extracted, and the human osteosarcoma U2OS cell line was transfected;

[0012] (4) The human osteosarcoma U2OS cell line transfected with the pEGFP-C5orf46 recombinant plasmid in the above step (3) is expanded and cultured, and cells with green fluorescent signals are screened by flow cytometry. The drug resistance gene contained in the tool vector is then used to screen for drugs to obtain an osteosarcoma cell line that highly expresses the C5orf46 gene.

[0013] In the construction method, the nucleotide sequences of the amplification primers in step (1) are shown as SEQ ID NO.5 and SEQ ID NO.6.

[0014] In the construction method, the nucleotide sequence of the C5orf46 gene in step (2) is shown as SEQ ID NO.1.

[0015] In the construction method, the tool vector containing the drug-resistant gene and the fluorescent signal in step (2) is pEGFP-N1.

[0016] In the construction method, the drug resistance gene contained in the tool vector in step (4) is G418.

[0017] In a second aspect, the present invention provides an osteosarcoma cell line that highly expresses the C5orf46 gene, obtained by any of the construction methods described above.

[0018] In a third aspect, the present invention provides use of the osteosarcoma cell line that highly expresses the C5orf46 gene in the preparation of a drug for treating osteosarcoma.

[0019] In a fourth aspect, the present invention provides a recombinant expression vector comprising a sequence for expressing the C5orf46 gene and a vector.

[0020] The vector is pEGFP-N1.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The present invention can load the constructed pEGFP-C5orf46 gene vector into human osteosarcoma cells, so that the C5orf46 gene in the cells is continuously and stably highly expressed, and the constructed "U2OS-C5orf46+ cell line" can be effectively used in osteosarcoma medical research. The present invention found that in osteosarcoma cells, after inducing high expression of the C5orf46 gene, it will continue to be released to the surrounding microenvironment in the form of exosomes, thereby regulating the interaction between osteosarcoma tumor cells and surrounding blood vessels, nerves, lymphocytes and other immune cells, affecting the biological behavior of tumors in the region. The induced high expression of C5orf46 in osteosarcoma cells in vitro is valuable for further analyzing the causes of tumor heterogeneity and developing potential drug treatment targets. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the C5orf46 gene amplification map;

[0024] Figure 2 This is the map of the p-EGFP-N1 tool vector;

[0025] Figure 3 This is a diagram showing the results of partial sequencing and identification of the C5orf46 recombinant vector;

[0026] Figure 4 Fluorescence image of osteosarcoma U2OS cells after transfection with P-EGFP-C5orf46 vector;

[0027] Figure 5 This is a diagram showing the results of Western blotting experiments to verify gene expression in cell lines. DETAILED DESCRIPTION

[0028] The present invention will be further described below by means of drawings and embodiments.

[0029] Embodiment 1:

[0030] The following steps were taken: designing C5orf46 gene amplification primers, constructing a full-length expression vector for the gene CDS region, and constructing a C5orf46 stably overexpressing osteosarcoma recombinant cell line through cell transfection combined with fluorescence screening and a series of drug stabilization measures, and named it: "U2OS-C5orf46+" cell line.

[0031] Among them, the full-length sequence of the C5orf46 gene is shown in SEQ ID NO.1: gaacaatttatctgcacgaataccccgtgctaccag aatggctgtctcagtacttcgcctgacagttgtcctgggactgcttgtcttattcctgacctgctatgcagacgacaaaccagacaagccagacgacaagccagacgactcgggcaaagacccaaagccagacttccccaaattcctaagcctcctgggcacagagatcattgagaatgcagtcgagttcatcctccgctccatgtccaggagcacaggatttatggaatttgatgataatgaaggaaaacattcatcaaagtgacatcctcaggacacacccatgtggctcctggacaatccaagagcagccaaatcctgcttttccagtttggctccacaagtcctccaggacagagccctcaaagcaactcccaacgagttctcaggattcaggctctggcttcaaccaaacagaactcattttgaacaccctgactgcatttttgcttttagaaagttagaataaatatggcgctttgggatcacata。

[0032] The sequence of the CDS region of the C5orf46 gene is shown in SEQ ID NO.2:

[0033] atggctgtctcagtacttcgcctgacagttgtcctgggactgcttgtcttattcctgacctgctatgcagacgacaaaccagacaagccaga cgacaagccagacgactcgggcaaagacccaaagccagacttccccaaattcctaagcctcctgggcacagagatcattgagaatgcagtcg agttcatcctccgctccatgtccaggagcacaggatttatggaatttgatgataatgaaggaaaacattcatcaaagtga。

[0034] 1. Based on the sequence of the CDS region of the C5orf46 gene, design primers for amplifying the full-length gene:

[0035] Upstream primer: ATGGCTGTCTCAGTACTTCGCC (as shown in SEQ ID NO. 3);

[0036] Downstream primer: TCACTTTGATGAATGTTTTCCT (as shown in SEQ ID NO.4).

[0037] Based on the CDS region sequence and the designed primer base characteristics (including: CDS region restriction site sequence, total primer GC base content, primer hairpin structure, etc.), select appropriate restriction endonuclease sites at the beginning and end of the primer (core principle: the CDS region sequence of the target gene cannot contain the same sequence as the restriction site), and insert them into the primer structure. The upstream primer F and downstream primer R after insertion are as follows:

[0038] Upstream primer F: CCGGAATTCGCCACCATGGCTGTCTCAGTACTTCGCC (as shown in SEQ ID NO.5);

[0039] Note: ATGGCTGTCTCAGTACTTCGCC is the primer sequence itself, GAATTC is the EcoRI restriction site inserted according to the CDS sequence of the C5orf46 gene; CCG is the protective base of the EcoRI restriction site; GCCACC is the biomedical engineering KOZAK sequence, which can promote the stable expression of recombinant genes in cells after transfection.

[0040] Downstream primer R: CGGGGTACCCCTCACTTTGATGAATGTTTTCCT (as shown in SEQ ID NO.6);

[0041] Note: TCACTTTGATGAATGTTTTCCT is the primer sequence itself, GGTACC is the KpnI restriction site inserted according to the CDS sequence of the C5orf46 gene; CGG.....CC is the protective base of the KpnI restriction site.

[0042] Figure 1 By using the designed C5orf46 gene CDS region amplification primers (i.e., upstream primer F and downstream primer R), the target gene sequence can be successfully amplified using normal human leukocyte genomic DNA as a template: wherein the number on the left is the expected length value of the amplified band. Figure 1 In the figure, the left band is the control gene sequence, and the right band (indicated by the red arrow) is the C5orf46 gene CDS region sequence amplified using the designed primers. The results show that the product band obtained in Example 1 is clear, the length is basically consistent with the expectation, the background is clean, and there is no particularly obvious non-specific miscellaneous band, indicating that the amplification is successful.

[0043] 2. Use the upstream primer F and downstream primer R mentioned above to construct a pEGFP-C5orf46 recombinant expression vector with gene expression function:

[0044] The CDS region of the C5orf46 gene is 264 bp in length. Using normal human leukocyte DNA as a template, the C5orf46 gene fragment was amplified by PCR using the upstream primer F and downstream primer R, and inserted into the pEGFP-N1 tool vector to construct a pEGFP-C5orf46 recombinant expression vector with actual expression function. The PCR reaction conditions are set as shown in Table 1. Among them, the sequence of the p-EGFP-N1 tool vector is as follows Figure 2 shown.

[0045] Table 1 PCR reaction conditions

[0046]

[0047]

[0048] The PCR reaction product was double digested with EcoRI / KpnI to expose the sticky ends (digestion conditions: 37°C, 1h), and then connected to the pEGFP-N1 tool vector with T4DNA ligase. The ligation product was transformed into DH5α competent bacteria, and the positive clones were selected. The bacterial solution was sequenced and identified after shaking. The sequence successfully identified by sequencing is the successfully constructed pEGFP-C5orf46 recombinant expression vector. The pEGFP-C5orf46 recombinant expression vector was sent to a gene company for first-generation sequencing. Part of the sequencing map is shown below. Figure 3 As shown, after comparison, it is consistent with the C5orf46 gene sequence published by TCGA (Human Genome Project), indicating that the constructed pEGFP-C5orf46 vector sequence is correct.

[0049] The pEGFP-C5orf46 vector sequence is shown in SEQ ID NO.7:

[0050] ccggaattcgccaccatggctgtctcagtacttcgcctgacagttgtcctgggactgcttgtcttattcctgacctgctatgcagacgacaaaccagacaagccagacgacaagccagacgactcgggcaaagacccaaagccag acttccccaaattcctaagcctcctgggcacagagatcattgagaatgcagtcgagttcatcctccgctccatgtccaggagcacaggatttatggaatttgatgatgatgacggggtacccctcactttgatgaatgttttcct.

[0051] 3. Transfection of the constructed pEGFP-C5orf46 recombinant plasmid vector into human osteosarcoma U2OS cell line

[0052] The positive clones that were successfully constructed as shown by the sequencing results in the above steps were shaken in large quantities for plasmid extraction. The extracted pEGFP-C5orf46 recombinant plasmid was dissolved in sterile DEPC water, the plasmid concentration was determined, and the human osteosarcoma U2OS cell line was transfected using lipofectimane 2000 cationic liposome method.

[0053] The pEGFP-N1 tool vector carries the Neomycin gene and the EGFP green fluorescence signal. (1) The EGFP fluorescence carried can make the transfected cells also emit green fluorescence; and the Neomycin gene carried has resistance to the G418 drug, making the transfected cell lines also resistant to G418. Cells that are not transfected with eukaryotic vectors do not carry fluorescence and do not have G418 resistance. Based on this feature, the osteosarcoma cell line transfected with the pEGFP-C5orf46 recombinant plasmid was double-identified.

[0054] 4. First round screening of recombinant cell lines using flow cytometry

[0055] The osteosarcoma cells transfected with the pEGFP-C5orf46 recombinant expression vector were expanded and cultured, and then the cells with green fluorescence signals were screened out using flow cytometry, and other cells without fluorescence were filtered out (the flow cytometry screening was performed according to conventional steps). The cells screened by flow fluorescence are the recombinant osteosarcoma cell lines that have been initially identified as successfully transfected, and the cell population with fluorescence (carried by the tool vector) is obtained. Figure 4 shown.

[0056] 5. G418 drug screening yielded the "U2OS-C5orf46+" cell line with stable and high expression of C5orf46

[0057] (1) The above cell population was further stabilized by G418 to construct the "U2OS-C5orf46+ cell line": the untransfected human osteosarcoma U2OS cell line was used as a control to screen the optimal concentration of G418. The screening steps were as follows: U2OS cells were seeded in a 24-well plate. When the cell density reached 50% to 70% the next day, the culture medium was replaced and G418 was added at concentrations of 500 ng / mL, 800 ng / mL, 1000 ng / mL, 1500 ng / mL, and 2000 ng / mL to start screening. The lowest concentration at which all cells died within 10 to 14 days was determined as the optimal screening concentration. Based on the above steps, our experimental results determined that the optimal concentration of G418 for human osteosarcoma U2OS cell line was 1000 ng / mL.

[0058] (2) The primary transfected cells screened by flow cytometry were inoculated in a six-well plate at a density of 50% to 70%. After 24 hours of plating, G418 at a concentration of 1000 ng / mL was added in proportion. When the cell growth reached 90%, the cells were subcultured with a medium containing G418. The drug concentration was maintained for 10 to 14 days, and the screening was terminated when all cells in the control group died. According to the above steps, osteosarcoma recombinant cells with stable overexpression of C5orf46 were finally obtained and named "U2OS-C5orf46+" cell line.

[0059] 6. Collect exosomes from cultured "U2OS-C5orf46+" cells and identify the expression of C5orf46 gene by Western blotting experiment

[0060] (1) The constructed recombinant "U2OS-C5orf46+" cell line was expanded and cultured, the cell supernatant was collected, and the exosomes therein were collected by ultracentrifugation. The main steps included:

[0061] The recombinant "U2OS-C5orf46+" cells and the control U2OS cell line were routinely cultured. When the cells grew to 70% to 80% of the exponential growth phase, the cell culture medium was centrifuged at 2000× for 10 min, and the supernatant was centrifuged again at 1000× for 30 min to remove cell debris. After resuspending in 4°C precooled PBS, the supernatant was filtered with a 0.22 um filter membrane and 1*10 5 ×g ultrahigh-speed centrifugation for 70 min, repeat high-speed centrifugation to obtain cell exosome precipitate, and store at -80℃ for future use.

[0062] (2) The collected tumor cell exosomes were used to extract exosome proteins according to the instructions of the conventional exosome RNA / protein extraction kit. Western blotting experiments were performed to verify the expression of the C5orf46 gene. The main steps of the Western blotting experiment were: after the concentration of the extracted protein was detected, the extracted protein was subjected to SDS-PAGE electrophoresis, wet-transferred to PVDF membrane, blocked with 5% skim milk powder at room temperature for 1 hour, incubated with anti-C5orf46 primary antibody at 4°C overnight, incubated with secondary antibody at room temperature for 1 hour, and imaged with ECL. Compare the expression differences of C5orf46 protein in recombinant cells and control cells.

[0063] like Figure 5 The results of Western blotting experiments on the "U2OS-C5orf46+ cell line" and the control U2OS cells showed that the gene expression level in the recombinant "U2OS-C5orf46+ cell line" was significantly higher than that in the untransfected control U2OS cells, indicating that the recombinant cell line was successfully constructed and could achieve stable and high expression of the C5orf46 gene.

Claims

1. A method for constructing an osteosarcoma cell line that highly expresses the C5orf46 gene, characterized in that: The following steps are involved: (1) Design specific primers for amplifying the full-length CDS region of the C5orf46 gene; (2) using normal human leukocyte DNA as a template and the amplification primers designed in step (1) above, amplifying the C5orf46 gene fragment by PCR, inserting the tool vector containing the drug resistance gene and the fluorescent signal, and obtaining the pEGFP-C5orf46 recombinant expression vector; (3) The pEGFP-C5orf46 recombinant expression vector obtained in step (2) above was transformed into DH5α competent bacteria, positive clones were selected, the pEGFP-C5orf46 recombinant plasmid was extracted, and the human osteosarcoma U2OS cell line was transfected; (4) The human osteosarcoma U2OS cell line transfected with the pEGFP-C5orf46 recombinant plasmid in the above step (3) is expanded and cultured, and cells with green fluorescent signals are screened by flow cytometry. The drug resistance gene contained in the tool vector is then used to screen for drugs to obtain an osteosarcoma cell line that highly expresses the C5orf46 gene.

2. The construction method according to claim 1, characterized in that: The nucleotide sequences of the amplification primers in step (1) are shown in SEQ ID NO.5 and SEQ ID NO.

6.

3. The construction method according to claim 1, characterized in that: The nucleotide sequence of the C5orf46 gene in step (2) is shown in SEQ ID NO.

1.

4. The construction method according to claim 1, characterized in that: The tool vector containing the drug-resistant gene and the fluorescent signal in step (2) is pEGFP-N1.

5. The construction method according to claim 1, characterized in that: The drug resistance gene contained in the tool vector in step (4) is G418.

6. An osteosarcoma cell line that highly expresses the C5orf46 gene, characterized in that: Obtained by the construction method according to any one of claims 1 to 5.

7. Use of the osteosarcoma cell line highly expressing the C5orf46 gene as claimed in claim 6 in the preparation of a drug for treating osteosarcoma.

8. A recombinant expression vector, characterized in that: Contains sequences and vectors for expressing C5orf46 gene.

9. The vector according to claim 8, characterized in that The vector is pEGFP-N1.

Images