Method for identifying mould types in paper wine box

Abstract

The invention relates to the technical field of microorganisms, in particular to a method for identifying mould types in a paper wine box. Mixing the mildewed part of the paper wine box with normal saline, and performing oscillation treatment to obtain a mixed bacteria solution; a PDA culture medium is coated with the mixed bacterial liquid for culture, and bacterial colonies are obtained; mixing the bacterial colony with normal saline to obtain a diluted bacterial liquid; a PDA culture medium is coated with the diluted bacterial liquid for purification culture, and purified bacterial colonies are obtained; and carrying out morphological observation and ITS identification on the purified bacterial colony to obtain the mould type in the paper wine box. According to the method disclosed by the invention, various moulds are sampled and separated from the interior of the paper wine box and are subjected to microscopic examination and molecular biological identification to obtain the mould community composition in the paper wine box, so that a clear research object is provided for the mildew mechanism of the paper wine box, the pertinence of research is improved, and a theoretical basis is provided for the subsequent design of a wine box mildew-proof scheme.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a method for identifying mold species in a paper wine box. Background Art

[0002] Mold grows very quickly in warm and humid climates, especially in the humid environment of the southwest, which is very suitable for the growth of microorganisms. In the temperature and humidity range where mold grows best, many carton packaging is susceptible to mold contamination during storage and transportation, which not only affects the appearance, but also causes the products sold to be returned, causing heavy losses to manufacturers. The industry has taken a variety of anti-mold measures, including the use of mold inhibitors and improved storage conditions. However, in actual operations, due to the lack of effective mold species identification methods, it is often difficult to take targeted prevention and control measures. In terms of mold species identification, traditional laboratory identification methods such as microscopic observation, culture separation, etc., although accurate, are time-consuming and not conducive to rapid response to mold contamination problems. In addition, some rapid identification methods such as PCR-based DNA fingerprinting technology, although shortening the identification time, are costly and have high technical requirements for operators, and are not suitable for widespread application.

[0003] The main problems of existing technologies in mold identification include: slow identification speed, high cost, complex operation, and lack of rapid and accurate identification methods for the specific environment in paper wine boxes. These problems limit the widespread application of paper wine boxes in humid environments and increase the operating costs of wine companies. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a method for identifying the types of mold in paper wine boxes. The present invention takes samples from the inside of a wine box packaging factory in Sichuan, separates a variety of molds, and performs microscopic examination and molecular biological identification on them to obtain the mold community composition in the paper wine box, thereby providing a clear research object for the mildew mechanism of paper wine boxes, improving the targeted research, and providing a theoretical basis for the subsequent design of wine box anti-mildew solutions.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides a method for identifying the types of mold in a paper wine box, comprising the following steps:

[0007] 1) Mixing the moldy part of the paper wine box with physiological saline and shaking to obtain a mixed bacterial solution;

[0008] The mass of the moldy part of the paper wine box and the volume ratio of the physiological saline solution are 1g:99ml;

[0009] The conditions of the shaking treatment include: shaking treatment at a temperature of 28° C. and a rotation speed of 200 to 250 rpm for 6 hours;

[0010] 2) applying the mixed bacterial solution obtained in step 1) on a PDA medium and culturing to obtain colonies;

[0011] The components of the PDA culture medium are: 5g potato powder, 20g glucose, 15g agar, 0.1g chloramphenicol, 1000ml distilled water, and the pH value is 7.0-8.0;

[0012] The culture conditions include: culturing at 28°C for 24 hours, and then inverting and culturing for 48 hours;

[0013] 3) mixing the bacterial colonies obtained in step 2) with physiological saline to obtain a diluted bacterial solution;

[0014] 4) Spreading the diluted bacterial solution obtained in step 3) on a PDA medium for purification and culture to obtain purified bacterial colonies;

[0015] The purification culture conditions include: culturing at 28°C for 24 hours, and then inverting and culturing for 72 hours;

[0016] 5) Performing morphological observation and ITS identification on the purified colonies obtained in step 4) to obtain the types of mold in the paper wine box.

[0017] Preferably, the indicators of morphological observation in step 5) include colony size, shape, edge, gloss, texture, color and transparency.

[0018] Preferably, the nucleotide sequences of the primer pairs used for ITS identification in step 5) are shown as SEQ ID No. 1-2.

[0019] Preferably, amplification is performed using a primer pair, and the amplification system is: 21 μL of PCR Mix, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of template.

[0020] Preferably, the amplification program is: 96°C for 5 min; 96°C for 20 s, 56°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 10 min.

[0021] In order to analyze the composition of the mold community in the wine box of the wine box packaging factory, the present invention provides a method for effectively identifying the types of mold in paper wine boxes. The present invention samples the area with microbial colonies in the wine box and inoculates it on a solid culture medium with potato as the only nutrient source, and cultures it at the optimal temperature. Pick the mold colonies for purification and culture. Perform morphological identification on the colonies and cells of the mold, and perform molecular biological identification on the purified mold. Perform ITS sequence analysis on the sequencing results to obtain detailed types and names of the mold communities. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0023] Figure 1 There are seven paper wine box samples;

[0024] Figure 2 The results of mold separation in seven moldy paper wine boxes;

[0025] Figure 3 These are the results of the plate purification culture of nine mold strains;

[0026] Figure 4 The mycelial morphology of nine mold strains;

[0027] Figure 5 This is the electrophoresis diagram of PCR amplification of the ITS sequence of mold in the paper wine box;

[0028] Figure 6 is the phylogenetic tree of the ITS sequence of strain S1;

[0029] Figure 7 is the phylogenetic tree of ITS sequences of strain S2;

[0030] Figure 8 is the phylogenetic tree of the ITS sequence of strain S3;

[0031] Fig. 9 is the phylogenetic tree of the ITS sequence of strain S4;

[0032] Fig.10 is the phylogenetic tree of the ITS sequence of strain S5;

[0033] Fig.11 is the phylogenetic tree of the ITS sequence of strain S6;

[0034] Fig.12 is the phylogenetic tree of the ITS sequence of strain S7;

[0035] Fig.13 is the phylogenetic tree of the ITS sequence of strain S8;

[0036] Fig.14 This is the phylogenetic tree of the ITS sequence of strain S9. DETAILED DESCRIPTION

[0037] The present invention provides a method for identifying the types of mold in a paper wine box, comprising the following steps:

[0038] 1) Mixing the moldy part of the paper wine box with physiological saline and shaking to obtain a mixed bacterial solution;

[0039] The mass of the moldy part of the paper wine box and the volume ratio of the physiological saline solution are 1g:99ml;

[0040] The conditions of the shaking treatment include: shaking treatment at a temperature of 28° C. and a rotation speed of 200 to 250 rpm for 6 hours;

[0041] 2) applying the mixed bacterial solution obtained in step 1) on a PDA medium and culturing to obtain colonies;

[0042] The components of the PDA culture medium are: 5g potato powder, 20g glucose, 15g agar, 0.1g chloramphenicol, 1000ml distilled water, and the pH value is 7.0-8.0;

[0043] The culture conditions include: culturing at 28°C for 24 hours, and then inverting and culturing for 48 hours;

[0044] 3) mixing the bacterial colonies obtained in step 2) with physiological saline to obtain a diluted bacterial solution;

[0045] 4) Spreading the diluted bacterial solution obtained in step 3) on a PDA medium for purification and culture to obtain purified bacterial colonies;

[0046] The purification culture conditions include: culturing at 28°C for 24 hours, and then inverting and culturing for 72 hours;

[0047] 5) Performing morphological observation and ITS identification on the purified colonies obtained in step 4) to obtain the types of mold in the paper wine box.

[0048] The invention mixes the moldy part of the paper wine box with physiological saline and performs an oscillation treatment to obtain a mixed bacterial solution; the mass ratio of the moldy part of the paper wine box to the volume of the physiological saline is 1g:99ml; the conditions of the oscillation treatment include: oscillating for 6 hours at a temperature of 28°C and a rotation speed of 200-250rpm. The invention has no special limitation on the source of the paper wine box.

[0049] The present invention applies the obtained mixed bacterial liquid on a PDA culture medium for culture to obtain a colony; the components of the PDA culture medium are: 5g potato powder, 20g glucose, 15g agar, 0.1g chloramphenicol, 1000ml distilled water, and the pH value is 7.0-8.0; the culture conditions include: culture at 28°C for 24h, and then inverted culture for 48h. The present invention has no special restrictions on the source of the PDA culture medium, and conventional commercially available or self-prepared can be used.

[0050] The present invention mixes the obtained bacterial colonies with physiological saline to obtain a diluted bacterial solution. The present invention preferably mixes the bacterial colonies with 10 ml of sterilized physiological saline to obtain a bacterial solution, and then mixes 1 ml of the bacterial solution with 9 ml of sterilized physiological saline, repeating the operation twice to obtain a diluted bacterial solution.

[0051] The present invention applies the obtained diluted bacterial solution on a PDA medium for purification culture to obtain purified colonies; the conditions of the purification culture include: culturing at 28°C for 24 hours, and then inverting and culturing for 72 hours. In the present invention, the components of the PDA medium are preferably: 5g potato powder, 20g glucose, 15g agar, 0.1g chloramphenicol, 1000ml distilled water, and the pH value is 7.0-8.0. The present invention has no special restrictions on the source of the PDA medium, and conventional commercially available or self-prepared ones can be used.

[0052] The present invention performs morphological observation and ITS identification on the purified colonies to obtain the types of mold in the paper wine box. In the present invention, the indicators of the morphological observation preferably include colony size, shape, edge, gloss, texture, color and transparency. In the present invention, the nucleotide sequence of the primer pair used for the ITS identification is shown in SEQ ID No.1-2. The present invention uses a primer pair for amplification, and the amplification system is preferably: PCR Mix 21μL, upstream primer 1μL, downstream primer 1μL and template 2μL. In the present invention, the amplification program is preferably: 96℃5min; 96℃20s, 56℃30s, 72℃30s, 35 cycles; 72℃10min.

[0053] SEQ ID No.1:

[0054] TCCGTAGGTGAACCTGCGG;

[0055] SEQ ID No.2:

[0056] TCCTCCGCTTATTGATATGC.

[0057] In order to further illustrate the present invention, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0058] Example 1

[0059] 1. Material Preparation

[0060] Wine box sampling: The test bacterial flora was screened from paper wine boxes that were moldy in a winery warehouse. Figure 1 As shown. Take three 5cm×5cm cardboards from the six sides of the wine box with microbial colonies, cut them into 5mm×5mm pieces with sterilized scissors, and put them into sterile sealed bags corresponding to the six sides. Test immediately after taking the samples.

[0061] 2. Culture medium preparation

[0062] The potato dextrose agar (PDA) culture medium specially used for isolating molds has the following ingredients: 5.0 g potato powder, 20.0 g glucose, 15.0 g agar, 0.1 g chloramphenicol, 1000 ml distilled water, pH 7.0-8.0.

[0063] The lactic acid phenol cotton blue dye solution specially used for mold staining has the following ingredients: 10g phenol (pure crystal), 10g lactic acid, 20g glycerol and 10ml distilled water.

[0064] 3. Preparation of Suspension

[0065] Weigh 1g of wine box sample using an electronic balance, pour into a conical flask, add 99ml of sterile saline, seal and fix in a rotary shaker, move at 200-250r / min for 6h at 28℃ to obtain the original mixed bacterial solution for testing.

[0066] 4. Screening and Isolation of Bacteria

[0067] Extract 10 ml of the original mixed bacterial solution respectively and spread it on 3 potato dextrose agar (PDA) culture media with an area of ​​25 cm × 25 cm. After sealing the culture dishes, first place them flat in a biochemical constant temperature incubator at 28°C for 24 hours, then invert the culture dishes for incubation for 48 hours, observe the colony formation, and make a record in a notebook.

[0068] After screening of the separation medium, the mixed colony morphology on the medium is as follows Figure 2 shown.

[0069] 5. Purification of bacterial strains

[0070] According to the morphology, color, size and hyphae characteristics of the colonies, use a sterilized inoculation needle to pick up the colonies with a compact texture and a velvety surface on the culture medium, put them into 10 ml of sterile saline, and obtain the bacterial liquid after hyphae separation.

[0071] (1) Take 1 ml of the isolated bacterial solution and add it to 9 ml of sterile saline;

[0072] (2) After the bacterial solution is evenly dispersed, 1 ml of the bacterial solution from step (1) is taken and added to 9 ml of sterile saline;

[0073] (3) After the bacterial solution is evenly dispersed, 1 ml of the bacterial solution from step (2) is taken and added to 9 ml of sterile saline;

[0074] (4) Take 100 μL of the bacterial solution from steps (1), (2), and (3) respectively, and evenly spread the bacterial solution on potato dextrose agar (PDA) medium by plate spreading method. Repeat three times for each concentration, first place it flat in a biochemical constant temperature incubator at 28°C for 24 hours, then invert the culture dish and culture it for 72 hours, and observe the morphological characteristics of the colony surface. After purification three times, 9 single colony molds were obtained. The operation process should strictly prevent contamination by foreign bacteria.

[0075] According to the different morphology, color and hyphae of the colony, the following Figure 3 The 9 fungal strains are shown.

[0076] 6. Observe the colony morphology

[0077] Through three purification cultures, the size, shape, edge, gloss, texture, color and transparency of the 9 fungal colonies were morphologically observed. The results are shown in Table 1.

[0078] Table 1 Morphological characteristics of nine fungal colonies

[0079]

[0080] 7. Observe bacterial morphology under microscope

[0081] Use an inoculation needle to pick up a small amount of mold hyphae with spores from the purified culture medium, immerse them in 50% ethanol for 2 seconds, and then wash them with distilled water for 3 seconds to wash away the fallen spores. Drop 0.5 ml of lactic acid phenol cotton blue dye solution on the slide, put the washed hyphae into the dye solution on the slide, separate the hyphae with a dissecting needle, let it stand for 15 minutes, cover it with a coverslip, and observe the bacterial characteristics of the nine kinds of molds under a microscope at 400 times. The results of the bacterial characteristics description are shown in Table 2. The bacterial morphology under the microscope is as follows Figure 4 shown.

[0082] Table 2 Morphological characteristics of fungal cells

[0083]

[0084] According to the observation results of colonies and bacteria, preliminary identification was carried out with reference to the Manual of Systematic Identification of Common Bacteria, and it was determined that S1 was Aspergillus, S2, S3, S4, and S6 were Penicillium, S7 was Rhizopus, S5 and S9 were Cladosporium, and S8 was Alternaria.

[0085] The sterilization conditions of the culture medium, physiological saline and utensils described above are: sterilization at 115°C for 20 minutes.

[0086] 8. Molecular Biological Identification

[0087] 8.1 Genomic DNA extraction

[0088] After morphological identification of 9 kinds of molds, the purified mold colonies were picked and added to 5ml sterile water as pre-treated bacterial solution. There are obvious bacteria in the bacterial solution, which cannot be too clear. Take a 2ml centrifuge tube, add 200μL TE buffer (10mmol / L Tris-HCl, 1mmol / L EDTA, pH=8.0) and a few glass beads, then add an appropriate amount of bacterial sample, put it in a grinder and grind it until it is sufficient. Add 20μL proteinase K (20mg / mL), add 200μL 10% SDS solution, mix thoroughly by inversion, and place at 70℃ for 10min. Add 200μL anhydrous ethanol, mix thoroughly by inversion, and centrifuge briefly to remove droplets on the inner wall of the tube cover. Pass through the adsorption column, wash once with washing solution, and wash twice with rinsing solution. Place the adsorption column at room temperature for 3-5min to thoroughly dry the residual rinsing solution in the adsorption material. Transfer the adsorbed sample to a new centrifuge tube, add 50-100 μL ddH2O to the middle of the adsorption film, place at room temperature for 3-5 minutes, centrifuge at 12000 rpm for 2 minutes, collect the solution in a centrifuge tube, and obtain the sample to be tested. Check the DNA quality by 0.8% agarose gel electrophoresis, and store the DNA at -20°C for later use.

[0089] 8.2 PCR amplification

[0090] The 18s rDNA of pure mold strains was amplified using PCR technology. The universal primers ITS1 / ITS4 for 18s rDNA sequence of mold identification were used as molecular identification primers for 9 types of molds. The universal primer sequences for molds used in this experiment are as follows:

[0091] ITS1:-TCCGTAGGTGAACCTGCGG-;

[0092] ITS4: -TCCTCCGCTTATTGATATGC-.

[0093] In an ice bath, add 21 μL of PCR Mix, 1 μL of Primer F (5p), 1 μL of Primer R (5p), and 2 μL of template (ng / μL) to a 0.5 ml sterile centrifuge tube in order. Centrifuge the mixture slightly and immediately place it on a PCR instrument to perform amplification. Pre-denature at 96°C for 5 minutes and enter the cyclic amplification stage: initial denaturation at 96°C for 20 seconds, annealing at 56°C for 30 seconds, extension at 72°C for 30 seconds, cycle 35 times, and finally extend at 72°C for 10 minutes. End the reaction and place the PCR product at 4°C for electrophoresis detection. The PCR amplification reaction system and conditions are shown in Table 3.

[0094] Table 3 PCR amplification reaction system and conditions

[0095]

[0096] 8.3 PCR product purification

[0097] Accurately weigh 1g of agarose powder into a conical flask and add an appropriate amount of electrophoresis buffer. Use a microwave to heat to promote the dissolution of agarose until it is completely melted. When the agarose solution cools naturally to 60-70°C, add 1μL of ethidium bromide stain and mix carefully to ensure uniform distribution. Pour the molten agarose solution cooled to 60°C into the pre-prepared gel mold to achieve the desired gel thickness, usually 3-5mm. Let it stand at room temperature for about 30min so that the gel is completely solidified. After solidification, place the gel together with the mold in the electrophoresis tank and ensure that the sample well is located at the negative pole position of the electric field. Add enough electrophoresis buffer to the electrophoresis tank to cover the surface of the gel. After adding the buffer, gently remove the comb fixed in the gel to prepare for sample loading. Add loading buffer to the sample and mix gently with a pipette to ensure that the sample is fully combined with the buffer. Perform electrophoresis at a set voltage of 80V and a current of 10mA for 30min.

[0098] After electrophoresis, use a UV detector to directly observe and record the migration of DNA bands so that the samples can be analyzed and recorded. In this way, DNA samples can be effectively separated and detected, providing important information for subsequent molecular biology experiments.

[0099] The results are as follows Figure 5 As shown, the DNA fragments of strains S1, S2, S3, S4, S5, S6, S7, S8 and S9 were 561bp, 579bp, 591bp, 611bp, 592bp, 601bp, 621bp, 582bp and 609bp respectively. The sizes of the DNA fragments of the 9 mold strains (as shown in SEQ ID No.3-11, respectively) were in the range of 500-700, and the product bands were single and high in concentration, which were consistent with the mold ITS sequence bands.

[0100] S1 (SEQ ID No. 3):

[0101] TCCTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCTCACGGCCGCCGGGGGGCATCCGCCCCCGGGCCCGCGCCCGCCGAAGACACACAAACGAACTCTTGTCTGAAGATTGCAGTCTGAGTACTTGACTAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCTCGCCCCCCGCTTCCGGGGGGCGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTAGGCCCGGCCGGCGCCCGCCGGCGAACACCATCAATCTTAACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATAT。

[0102] S2(SEQ ID No.4):

[0103] TGCGGAAGGATCATTACCGAGTGCGGGCCCTCGCGGCCCAACCTCCCACCCTTGTCTCTCTACACCTGTTGCTTTGGCGGGCCCACTGGGGCTCCCTGGTCGCCGGGGGACACCCGTCCCCGGGCCCGCGCCCGCCGAAGCGCTTCGTGAACCCTGATGAAGAAGGGCTGTCTGAGTACTATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGTGTGGTCCCCCCGGGGACCTGCCCGAAAGGCAGCGGCGACGTCCGTCTGGTCCTCGAGCGTATGGGGCTCTGTCACTCGCTCGGGAAGGACCTGCGGGGGTTGGTCACCACCACATTTTCCATTATGGTTGACCTCGGATCAGGTAGGAGTTACCCGCTGAACTTAAGCATATCAATA。

[0104] S3(SEQ ID No.5):

[0105] CCCTCCGTAGGTGAACCTGCGGAGGGATCATTACAAGTGACCCCGGTCTAACCACCGGGATGTTCATAACCCTTTGTTGTCCGACTCTGTTGCCTCCGGGGCGACCCTGCCTTCGGGCGGGGGCTCCGGGTGGACACTTCAAACTCTTGCGTAACTTTGCAGTCTGAGTAAACTTAATTAATAAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGACCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGCTCGGGAGGCTACGCCGTAAAACAAACCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCA。

[0106] S4(SEQ ID No.6):

[0107] GAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCTCACGGCCGCCGGGGGGCATCCGCCCCCGGGCCCGCGCCCGCCGAAGACACACAAACGAACTCTTGTCTGAAGATTGCAGTCTGAGTACTTGACTAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCTCGCCCCCCGCTTCCGGGGGGCGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTAGGCCCGGCCGGCGCCCGCCGGCGAACACCATCAATCTTAACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATA。

[0108] S5(SEQ ID No.7):

[0109] TGCGGAAGGATCATTACCGAGTGCGGGCCCTCGCGGCCCAACCTCCCACCCTTGTCTCTCTACACCTGTTGCTTTGGCGGGCCCACTGGGGCTCCCTGGTCGCCGGGGGACACCCGTCCCCGGGCCCGCGCCCGCCGAAGCGCTTCGTGAACCCTGATGAAGAAGGGCTGTCTGAGTACTATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGTGTGGTCCCCCCGGGGACCTGCCCGAAAGGCAGCGGCGACGTCCGTCTGGTCCTCGAGCGTATGGGGCTCTGTCACTCGCTCGGGAAGGACCTGCGGGGGTTGGTCACCACCACATTTTCCATTATGGTTGACCTCGGATCAGGTAGGAGTTACCCGCTGAACTTAAGCATAT。

[0110] S6(SEQ ID No.8):

[0111] CGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCTCACGGCCGCCGGGGGGCATCCGCCCCCGGGCCCGCGCCCGCCGAAGACACACAAACGAACTCTTGTCTGAAGATTGCAGTCTGAGTACTTGACTAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCTCGCCCCCCGCTTCCGGGGGGCGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTAGGCCCGGCCGGCGCCCGCCGGCGAACACCATCAATCTTAACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA。

[0112] S7(SEQ ID No.9):

[0113] TTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCTCACGGCCGCCGGGGGGCATCCGCCCCCGGGCCCGCGCCCGCCGAAGACACACAAACGAACTCTTGTCTGAAGATTGCAGTCTGAGTACTTGACTAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGA ACGCAGCGAA ATGCGATAAG TAATGTGAAT TGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATT GCGCCCCCTG GTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCC CTCAAGCACGGCTTGTGTGT TGGGCTCTCGCCCCCCGCTTCCGGGGGGCGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTAGGCCCGGCCGGCGCCCGCCGGCGAACACCATC AATCTTAACCAGGTTGACCTCGGATCAGGT AGGGATACCCGCTGAACTTAAGCATATCAA TAAGGCGGAG GAA。

[0114] S8(SEQ ID No.10):

[0115] TTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCTCACGGCCGCCGGGGGGCATCCGCCCCCGGGCCCGCGCCCGCCGAAGACACACAAACGAACTCTTGTCTGAAGATTGCAGTCTGAGTACTTGACTAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGA ACGCAGCGAA ATGCGATAAG TAATGTGAAT TGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATT GCGCCCCCTG GTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCC CTCAAGCACGGCTTGTGTGT TGGGCTCTCGCCCCCCGCTTCCGGGGGGCGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTAGGCCCGGCCGGCGCCCGCCGGCGAACACCATC AATCTTAACCAGGTTGACCTCGGATCAGGT AGGGATACCCGCTGAACTTAAGCATATCAA TAAGGCGGAG GAA。

[0116] S9(SEQIDNo.11):

[0117] CTTCCGTTAGGGGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCTCACGGCCGCCGGGGGGCATCCGCCCCCGGGCCCGCGCCCGCCGAAGACACACAAA CGAACTCTTGTCTGAAGATTGCAGTCTGAGTACTTGACTAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACA TTGCGCCCCCTGGTATTCCGGGGGGCATGC CTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGT GTTGGGCTCTCGCCCCCCGCTTCCGGGGGGCGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTAGGCCCGGCCG GCGCCCGCCGGCGAACACCATCAATCTTAACCAGGTTGACCTCGGATCAG GTAGGGATAC CCGCTGAACTTAAGCATATCAATAAGGCGGAGGAACC.

[0118] 9. Sequence Analysis

[0119] The quality of the amplified PCR product was tested by 1.0% agarose gel. After a single band was obtained, it was sent to Suzhou Genewise Biotechnology Co., Ltd. for sequencing and analysis.

[0120] 10. Sequence alignment and identification results

[0121] The obtained 18SrDNA sequences were compared with the BLAST sequence homology in the GenBank database. The evolutionary history was inferred using the Neighbor-Joining method using MEGA7 software to obtain an evolutionary tree. The evolutionary distance was calculated using the Kimura 2-parameter method, and the Bootstrap confidence value was estimated and repeated 1000 times.

[0122] According to the constructed phylogenetic tree Figures 6 to 14It was found that S1 was Aspergillus niger, S2 was Penicillium oxalicum, S3 was Penicillium expansum, S4 was Talaromyces funiculosus, S5 was Cladosporium oxysporum, S6 was Talaromyces verruculosus, S7 was Rhizopus stolonifer, S8 was Alternaria alternata, and S9 was Cladosporium tenuissimum.

[0123] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for identifying the type of mold in a paper wine box, characterized in that: The following steps are involved: 1) Mixing the moldy part of the paper wine box with physiological saline and shaking to obtain a mixed bacterial solution; The mass of the moldy part of the paper wine box and the volume ratio of the physiological saline solution are 1g:99ml; The conditions of the shaking treatment include: shaking treatment at a temperature of 28° C. and a rotation speed of 200 to 250 rpm for 6 hours; 2) applying the mixed bacterial solution obtained in step 1) on a PDA medium and culturing to obtain colonies; The components of the PDA culture medium are: 5g potato powder, 20g glucose, 15g agar, 0.1g chloramphenicol, 1000ml distilled water, and the pH value is 7.0-8.0; The culture conditions include: culturing at 28°C for 24 hours, and then inverting and culturing for 48 hours; 3) mixing the bacterial colonies obtained in step 2) with physiological saline to obtain a diluted bacterial solution; 4) Spreading the diluted bacterial solution obtained in step 3) on a PDA medium for purification and culture to obtain purified bacterial colonies; The purification culture conditions include: culturing at 28°C for 24 hours, and then inverting and culturing for 72 hours; 5) Performing morphological observation and ITS identification on the purified colonies obtained in step 4) to obtain the types of mold in the paper wine box.

2. The method according to claim 1, characterized in that The indicators of the morphological observation in step 5) include colony size, shape, edge, gloss, texture, color and transparency.

3. The method according to claim 1, characterized in that The nucleotide sequences of the primer pairs used for ITS identification in step 5) are shown in SEQ ID No. 1-2.

4. The method according to claim 3, characterized in that Amplification was performed using a primer pair, wherein the amplification system was: 21 μL of PCR Mix, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of template.

5. The method according to claim 4, characterized in that The amplification procedure is: 96°C for 5 min; 96°C for 20 s, 56°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 10 min.

Images