A method for identifying the antioxidant stress ability of Tibetan sheep based on SNP molecular markers

Abstract

The present invention relates to the technical field of molecular markers, and particularly relates to a method for identifying the antioxidant stress ability of Tibetan sheep based on SNP molecular markers. An SNP molecular marker related to the antioxidant stress ability of Tibetan sheep, the molecular marker is located at the 136620499th base on chromosome 2 of the international sheep genome version Oar_v4.0, and the mutated base is T or C. By detecting the base at the 136620499th nucleotide site on chromosome 2 of Tibetan sheep, the present invention can judge the content of the antioxidant stress index T-AOC of Tibetan sheep individuals. The present invention provides a new SNP molecular marker resource for marker-assisted selection of antioxidant stress traits of Tibetan sheep for non-diagnostic purposes.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and in particular to a method for identifying the antioxidant stress ability of Tibetan sheep based on SNP molecular markers. Background Art

[0002] Tibetan sheep is an important part of the grassland animal husbandry in the alpine pastoral areas of the Qinghai-Tibet Plateau. The characteristics of the Qinghai-Tibet Plateau region are: high altitude, low air pressure, strong ultraviolet rays, lack of oxygen, etc. Due to the harsh environment in the Qinghai-Tibet Plateau region, a series of non-specific reactions of Tibetan sheep will be caused, mainly immune stress, cold stress and oxidative stress, among which oxidative stress is the main one. After Tibetan sheep is stimulated by stressors, the dynamic balance between the oxidation system and the antioxidant system in the body is destroyed. Antioxidants in organisms are mainly composed of two major substances, one is antioxidant enzymes; the other is non-enzymatic antioxidants. The antioxidant effect of this system is mainly achieved through the following three ways: eliminating free radicals and reactive oxygen species to avoid lipid peroxidation; decomposing peroxides and blocking the peroxidation chain; removing catalytic metal ions. Total antioxidant capacity (T-AOC) refers to the sum of the antioxidant capacities of all antioxidants in an organism, and is an important indicator for measuring the ability of an organism to scavenge reactive oxygen species (ROS). It reflects the ability of the organism to resist oxidative stress and is an important tool for evaluating health status and disease risk. Total antioxidant capacity is also the main indicator reflecting the total antioxidant level of the enzymatic and non-enzymatic systems in the organism. In the prior art, there are many studies on exercise and free radicals and antioxidant systems, but there are few studies on the adaptive regulation of the native plateau animal Tibetan sheep in different degrees of hypoxic environments.

[0003] By detecting the content of total antioxidant capacity, the oxidative stress ability and health status of Tibetan sheep can be evaluated. By detecting the indicators of antioxidant stress, the oxidative stress response ability of Tibetan sheep can be timely discovered, and certain measures can be taken to improve its oxidative stress ability, so that it can better adapt to the harsh environmental conditions of the Qinghai-Tibet Plateau, providing a basis for the assisted breeding of Tibetan sheep.

[0004] With the rapid development of molecular marker technology, searching for variant sites in genes at the gene level, discovering the relationship between genes and traits through association analysis between them, and conducting early selection to improve the efficiency and accuracy of breeding selection can fundamentally enhance the oxidative stress ability of Tibetan sheep and has broad application value. Therefore, molecular markers lay the foundation for people to study the genetic mechanism of the oxidative stress ability of Tibetan sheep at the molecular level. Screening corresponding molecular markers for more efficient use in the breeding of Tibetan sheep is an important issue in this field. There are not many studies on using molecular markers related to the oxidative stress ability of Tibetan sheep for assisted breeding in the existing technology. Providing a molecular marker related to the oxidative stress ability of Tibetan sheep for use in molecular marker-assisted breeding of Tibetan sheep and screening Tibetan sheep with strong antioxidant stress ability is particularly important. Summary of the Invention

[0005] The object of the present invention is to provide a method for identifying the antioxidant stress ability of Tibetan sheep based on SNP molecular markers.

[0006] To achieve the above-mentioned invention object, the present invention provides the following technical solutions:

[0007] The present invention provides an SNP molecular marker related to the antioxidant stress ability of Tibetan sheep. The molecular marker is located at the 136620499th base on chromosome 2 of the international sheep genome version Oar_v4.0, and the mutant base is T or C.

[0008] Preferably, the genotype of Tibetan sheep with the mutant base T is TT or TC;

[0009] The genotype of Tibetan sheep with the mutant base C is CC;

[0010] The antioxidant stress index T-AOC of Tibetan sheep individuals with the TC and CC genotypes is significantly higher than that of TT genotype individuals;

[0011] There is no significant difference in the antioxidant stress index T-AOC between Tibetan sheep individuals with the TC and CC genotypes.

[0012] The present invention also provides the application of the above-mentioned SNP molecular marker in marker-assisted selection of the antioxidant stress trait of Tibetan sheep for non-diagnostic purposes.

[0013] The present invention also provides the application of the above-mentioned SNP molecular marker in the assisted breeding of Tibetan sheep.

[0014] The present invention also provides a primer pair for amplifying the above-mentioned SNP molecular marker, and the primer pair is shown as SEQ ID NO.2-3.

[0015] The present invention also provides the application of the primer pair in the preparation of a product for marker-assisted selection of antioxidant stress traits in Tibetan sheep for non-diagnostic purposes.

[0016] The present invention also provides the application of the primer pair in the preparation of a product for the assisted breeding of Tibetan sheep.

[0017] The present invention also provides a method for marker-assisted selection of antioxidant stress traits in Tibetan sheep for non-diagnostic purposes, comprising the following steps:

[0018] (1) Extract the genomic DNA of Tibetan sheep;

[0019] (2) Using the genomic DNA of Tibetan sheep obtained in step (1) as a template, amplify using the primer pair to obtain an amplification product;

[0020] (3) Perform genotype analysis on the amplification product to obtain Tibetan sheep with different genotypes; associate the genotypes of Tibetan sheep with antioxidant stress indicators; the antioxidant stress indicators include total antioxidant capacity.

[0021] Preferably, the amplification system in step (2) is: 22 μL of GoldMix (green), 1 μL each of the upstream and downstream primers, and 1 μL of template DNA;

[0022] The amplification program in step (2) is: 98 °C for 2 min; 98 °C for 10 s, 56 °C for 10 s, 72 °C for 10 s, a total of 40 cycles; 72 °C for extension for 2 min.

[0023] The present invention also provides a kit for marker-assisted selection of antioxidant stress traits in Tibetan sheep for non-diagnostic purposes and / or for the assisted breeding of Tibetan sheep, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The SNP molecular marker of the present invention is located at the 136,620,499th base on chromosome 2 of the international sheep reference genome version Oar_v4.0; the mutation type is T / C, named g136620499T>C, and there are three genotypes. When the 136,620,499th base on chromosome 2 is T, the genotype is TT or TC; when the 136,620,499th base on chromosome 2 is C, the genotype is CC; through the correlation analysis of different genotypes with the content of the antioxidant stress indicator T-AOC, it is found that the antioxidant stress indicator T-AOC of Tibetan sheep individuals with the TC and CC genotypes is significantly higher than that of TT genotype individuals (p < 0.05), and there is no significant difference in the antioxidant stress indicator T-AOC between Tibetan sheep individuals with the TC and CC genotypes (p > 0.05).

[0026] By detecting the base at the 136620499th nucleotide site on chromosome 2 of Tibetan sheep, the present invention can determine the content of the antioxidant stress index T-AOC in Tibetan sheep individuals. The present invention provides a new SNP molecular marker resource for marker-assisted selection of antioxidant stress traits in Tibetan sheep for non-diagnostic purposes. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained according to the provided drawings without creative efforts.

[0028] Figure 1 is the amplification product of the SNP site detected by agarose gel electrophoresis, where M represents Marker; 1, 2, and 3 represent 3 groups of replicates;

[0029] Figure 2 is the peak map and sequence obtained after the PCR amplification product is purified and sequenced. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0030] The following will describe in detail the technical solutions provided by the present invention in combination with the embodiments, but they cannot be understood as limiting the protection scope of the present invention.

[0031] Example 1

[0032] 1. Sample collection

[0033] The samples were from Tibetan sheep populations under natural grazing conditions, including 58 from Gannan Tibetan Autonomous Prefecture, Gansu Province, 59 from Yushu Tibetan Autonomous Prefecture, Qinghai Province, and 50 from Shigatse City, Tibet Autonomous Region. 5 mL of fasting Tibetan sheep blood samples were collected in clean coagulation-promoting vacuum blood collection tubes, left to stand for 30 min, then centrifuged at 3500 r / min for 15 min, and the supernatant was aspirated into a clean PE tube, sealed and stored in a -20 °C low-temperature refrigerator; another 5 mL of blood samples were collected in blood collection tubes containing EDTA-K2 anticoagulant, quickly mixed after blood sample collection, placed in a sampling box with ice packs for temporary storage, and frozen in a -20 °C refrigerator after being transported back to the laboratory for genomic DNA extraction.

[0034] 2. Main reagents and instruments

[0035] The EDTA-K2 vacuum blood collection tube was purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; the blood genomic DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; the NanoDrop2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; the DL2000 Marker, agarose, and nucleic acid dye were all purchased from Beijing Solarbio Science & Technology Co., Ltd.; the GoldMix (green) was purchased from Beijing Tsingke Biotechnology Co., Ltd.; the electrophoresis apparatus was purchased from Beijing Liuyi Instrument Factory; the PCR instrument was purchased from BioRad. The total antioxidant capacity T-AOC (A015-2-1) detection kit was purchased from Nanjing Jiancheng Bioengineering Institute.

[0036] 3. Methods

[0037] 3.1 Detection of T-AOC in serum

[0038] The determination was carried out by the ABTS method according to the T-AOC detection kit of Nanjing Jiancheng Bioengineering Institute. The determination steps were as follows: (1) Add 10 μL of double-distilled water and 20 μL of reagent four application solution (reagent one and peroxidase were mixed at 9:1) to the blank tube, add 10 μL of MTrolox solution with different concentrations and 20 μL of reagent four application solution to the standard tube, and add 10 μL of the serum to be tested and 20 μL of reagent four application solution to the determination tube; (2) Add 170 μL of ABTS working solution (reagent one: reagent two: reagent three application solution = 76:5:4) to the blank tube, standard tube, and determination tube; (3) React at room temperature for 6 min, and use an enzyme-linked immunosorbent assay reader to read the OD value of each well at a wavelength of 405 nm; (4) Make a standard curve with the OD of the standard product and obtain the curve formula, and substitute the OD measured by the sample determination tube into the calculation formula to obtain the result.

[0039] 3.2 Extraction of blood genomic DNA

[0040] The blood genomic DNA extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood sample. The extracted genomic DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. When the concentration > 20 ng / μL and OD260 / OD280 were between 1.7 and 1.9, it met the experimental requirements and was stored at -20 °C for standby.

[0041] 3.3 Primer design

[0042] Referring to the gene sequence of chromosome 2 of the international sheep genome Oar_v4.0 version (GenBank accession number: NC_019459.2), a pair of specific primers containing the g136620499T>C SNP locus was designed using the primer premier 5.0 software.

[0043] Primer sequence:

[0044] F: 5'-CAATTTACTGCCTGGATCCTG-3' (SEQ ID NO.2);

[0045] R: 5'-TCCACTTTCCTGTGCCACAA-3' (SEQ ID NO.3).

[0046] The amplified fragment length is 492 bp, and the primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd.

[0047] 3.4 PCR Amplification and Sequencing

[0048] The PCR amplification system was 25 μL: 22 μL of GoldMix (green), 1 μL each of the upstream and downstream primers, and 1 μL of the template.

[0049] The PCR amplification program was: 98°C for 2 min; 98°C for 10 s, 56°C for 10 s, 72°C for 10 s, for a total of 40 cycles; 72°C for 2 min of extension.

[0050] The PCR products were detected by 1.5% agarose gel electrophoresis. After the PCR products passed the agarose gel electrophoresis test, direct sequencing was used for sequencing, which was completed by Beijing Tsingke Biotechnology Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID NO.1, and the SNP marker is located at position 342 of the nucleotide sequence shown in SEQ ID NO.1.

[0051] The sequencing results of the PCR products were aligned using the biological analysis software MEGA 6.0, and the sequencing peak maps were analyzed to complete the genotyping.

[0052] 4. Statistical Analysis

[0053] According to the gene typing results, the number of individuals with different genotypes at each locus was counted. The Popgen32 software was used to calculate the gene frequency, genotype frequency, effective number of alleles (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test of the g136620499T>C gene, and the polymorphism information content was calculated using the PIC (polymorphism information content) calculation software. The general linear model in the IBM SPSS Statistics 22 software was used to analyze the correlation between different genotypes of Tibetan sheep and the antioxidant stress index T-AOC, and the results were expressed as "mean ± standard error".

[0054] 5. Results

[0055] 5.1 PCR Amplification and Sequencing Results

[0056] The amplification products of the g136620499T>C SNP locus on chromosome 2 of Tibetan sheep were detected by 1.5% agarose gel (see Figure 1 ). The bands were clear without background bands, and the specificity was good. The size of the PCR product fragment was 492bp, which was consistent with the expected size, and the next experiment could be carried out.

[0057] SEQ ID NO.1

[0058] CAATTTACTGCCTGGATCCTGCTGAAACTTTTGGTTATAGGAAGATCATAGAATGTATATGTCATGGATGCAAAGGTCAGAGGATTTCACAGCCATGTGGAAAGAGGAAAAGATCAGGACAAATTTCCCTCAGTTCCTTGGTGGAGTACCTGTCTCAGTGGTTAATTCTCAGGAACTAAATAAAACCTCCTGTCTGCTTTTTAGGGTCTTATTGGTAGTTAGCTGTTTTAACACATACTTCCTGGGACTGAATGGAATAAAATCTCATTAATGTTTCTAACTACTGACGAAAAGCATGTCCCTTCTACTATTGTACTGTGTACTGTTCTTCTATTTTGGAATATAAGGGAAGCCCAAGATTAATTTAATTAATTTAATTCTAAGATTTACATCTAACTTCGTGGAGACAATCCAAGTGATCTGTAGGAGCAAATGTCTGCTCTAAAGTGAAATCAAGTACTAGAAACTCTAGTTGTGGCACAGGAAAGTGGA。

[0059] The peak map and sequence obtained after purification and sequencing of the PCR product are shown in Figure 2 . It can be seen from Figure 2 that a T-C mutation occurred at the g136620499T>C SNP locus, and there were three genotypes: TT, TC, and CC.

[0060] 5.2 Statistical analysis results

[0061] Genotype and allele frequencies of the g136620499T>C SNP locus on chromosome 2 of Tibetan sheep were analyzed from the perspective of population genetics. As shown in Table 1, at the g136620499T>C SNP locus, the TT genotype frequency was the highest, being the dominant genotype, and the T allele frequency was 91.0%, showing the dominant allele. The χ2 goodness-of-fit test indicated that the SNP locus significantly deviated from the Hardy-Weinberg equilibrium state (P<0.05) (Table 1). The expected heterozygosity of this locus was 0.170, and the PIC was 0.150. With PIC<0.25, it belonged to low polymorphism.

[0062] Table 1 Polymorphism of the g136620499T>C SNP locus on chromosome 2 of Tibetan sheep

[0063]

[0064] 5.3 Association analysis between different genotypes and the antioxidant stress index T-AOC

[0065] The general linear model in IBM SPSS Statistics 22 software was used to analyze the association between different genotypes of Tibetan sheep and the content of the antioxidant stress index T-AOC. The results showed that the antioxidant stress index T-AOC of Tibetan sheep individuals with the TC and CC genotypes was significantly higher than that of TT genotype individuals (p<0.05), and there was no significant difference in the antioxidant stress index T-AOC between Tibetan sheep individuals with the TC and CC genotypes (p>0.05). This indicated that the base at the g136620499T>C SNP locus on chromosome 2 of Tibetan sheep was significantly correlated with T-AOC of Tibetan sheep, and it was an SNP marker related to T-AOC of Tibetan sheep. The results are shown in Table 2.

[0066] Table 2 Correlation analysis between different genotypes and the antioxidant stress index T-AOC

[0067]

[0068] Note: Different lowercase letters marked between data in the same row indicate significant differences (P<0.05).

[0069] In summary, the SNP molecular marker of the present invention is located at the 136620499th base on chromosome 2 of the international sheep reference genome version Oar_v4.0; the mutation type is T / C, named g136620499T>C, and there are three genotypes. When the 136620499th base on chromosome 2 is T, the genotype is TT or TC; when the 136620499th base on chromosome 2 is C, the genotype is CC. Through the correlation analysis between different genotypes and the content of the antioxidant stress index T-AOC, it is found that the antioxidant stress index T-AOC of Tibetan sheep individuals with the TC and CC genotypes is significantly higher than that of TT genotype individuals (p<0.05), and there is no significant difference in the antioxidant stress index T-AOC between Tibetan sheep individuals with the TC and CC genotypes (p>0.05). By detecting the base at the 136620499th nucleotide site on chromosome 2 of Tibetan sheep, the present invention can judge the content of the antioxidant stress index T-AOC of Tibetan sheep individuals. The present invention provides a new SNP molecular marker resource for marker-assisted selection of antioxidant stress traits of Tibetan sheep for non-diagnostic purposes.

[0070] The above are only the preferred embodiments of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. Use of a reagent for detecting SNP molecular markers in the preparation of an in vitro detection reagent for antioxidant stress traits of Tibetan sheep or an auxiliary breeding detection reagent for antioxidant stress traits of Tibetan sheep, characterized in that, The SNP molecular marker is located at the 136620499th base on chromosome 2 of the international sheep genome version Oar_v4.0, and the mutated base is T or C; among them, the total antioxidant capacity of Tibetan sheep individuals with TC and CC genotypes is significantly higher than that of TT genotype individuals; there is no significant difference in the total antioxidant capacity between Tibetan sheep individuals with TC and CC genotypes.

2. The application according to claim 1, wherein, The reagent for detecting the SNP molecular marker is a primer pair, as shown in SEQ ID NO.2~3.

3. A method for marker-assisted selection of antioxidant stress traits in Tibetan sheep for non-diagnostic purposes, characterized in that, It includes the following steps: (1) Extract the genomic DNA of Tibetan sheep; (2) Using the genomic DNA of Tibetan sheep obtained in step (1) as a template, amplify with the primer pair shown in SEQ ID NO.2~3 to obtain an amplification product; (3) Perform genotype analysis on the amplification product to obtain Tibetan sheep with different genotypes; associate the genotypes of Tibetan sheep with antioxidant stress indicators; The primer pair is used to amplify the SNP molecular marker, and the nucleotide sequence of the amplification product is shown in SEQ ID No.

1. The genotype is determined based on whether the 342nd base is T or C; among them, the total antioxidant capacity of Tibetan sheep individuals with TC and CC genotypes is significantly higher than that of TT genotype individuals; there is no significant difference in the total antioxidant capacity between Tibetan sheep individuals with TC and CC genotypes.

4. The method according to claim 3, characterized in that, The amplification program in step (2) is: 98°C for 2 min; 98°C for 10 s, 56°C for 10 s, 72°C for 10 s, a total of 40 cycles; 72°C extension for 2 min.

Images