Bordetella nucleic acid detection primer group, kit and application

Abstract

The invention discloses a primer group and a kit for detecting the nucleic acid of Bordetella and application of the primer group, which are characterized in that specific primers of Bordetella (including Bordetella pertussis, Bordetella parapertussis, Bordetella hormaeckii and Bordetella bronchitis) are used, and a specific fragment of a target gene of the nucleic acid of Bordetella in a sample is amplified by using an existing amplification technology; then carrying out real-time fluorescence detection on a specific fragment of the target gene through a specific probe to realize screening detection of the Bordetella; all the processes of the detection method are carried out in one detection tube, and full-automatic integration of three processes of nucleic acid extraction and purification, nucleic acid amplification and detection analysis is realized.

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid detection, and relates to the detection of Bordetella, and in particular to a nucleic acid detection primer set, a kit and an application thereof which are mainly used in a full-automatic detection system, and are suitable for the qualitative detection of Bordetella pertussis nucleic acid, Bordetella parapertussis nucleic acid, Bordetella hohnii nucleic acid and Bordetella bronchiseptica nucleic acid. Background Art

[0002] Whooping Cough (Pertussis, Whooping Cough) is an acute respiratory infectious disease caused by Bordetella pertussis (BP). Clinically, it is characterized by spasmodic cough, crowing echo at the end of cough, and peripheral lymphocytosis. It is highly contagious, with high morbidity and mortality in infants and young children. The course of the disease is often nearly 2-3 months, so it is called whooping cough. In the 1950s, before the use of pertussis vaccine, whooping cough was one of the main infectious diseases that caused death in infants and young children. Since the implementation of the Expanded Program on Immunization (EPI) worldwide in 1974, the morbidity and mortality of whooping cough have been greatly reduced. However, in the past 20 years, the incidence of whooping cough has shown a clear upward trend in many countries around the world, especially in areas with high vaccine coverage. This phenomenon is called the Reemergence or Resurgence of Pertussis.

[0003] At present, the main reasons are related to the change of epidemic characteristics of pertussis, the variation of Bordetella pertussis strains, the development of pertussis diagnostic technology, and the gradual deepening of medical staff's understanding of pertussis. The number of pertussis cases reported in 2007 was 2881, but the number of pertussis cases reported by the Centers for Disease Control and Prevention in the United States in the same year was 8739. Due to the lack of understanding of pertussis by clinical physicians, there are serious cases of underdiagnosis and underreporting of infection cases in adults and adolescents, and there is a lack of accurate and rapid laboratory diagnostic technology support. The incidence of pertussis may be greatly underestimated.

[0004] There are many laboratory technologies currently used for pertussis diagnosis. Although these routine inspection methods are relatively mature in technology, there are still some problems:

[0005] 1. Direct fluorescent antibody test: It is a simple and rapid test for nasopharyngeal secretions, but the sensitivity is affected by many factors such as the tester. The sensitivity reported in the literature is 18%-78%. Culture, PCR or serological tests are often required to support the diagnosis.

[0006] 2. Bacterial culture: Bacterial culture is still the gold standard for diagnosing pertussis. Bordetella pertussis has high requirements for the growth environment and grows slowly, taking 3-5 days, and confirming a negative result usually takes 7-12 days.

[0007] 3. Nucleic acid amplification: Nucleic acid amplification has become a mature method for detecting pertussis pathogens. Traditional PCR has been gradually replaced by real-time PCR, which can be completed within a few hours, and because its amplification and result analysis are carried out in a closed system, the risk of contamination is reduced. However, the instruments required for its amplification detection are extremely expensive, and it is difficult for grassroots units to use them routinely. Therefore, the development of simple, fast, accurate, and economical rapid detection reagents and corresponding detection equipment for Bordetella pertussis, especially suitable for promotion and use by grassroots units, has become the focus of research. Summary of the invention

[0008] In order to solve the above problems, the first object of the present invention is to provide a nucleic acid detection primer set for detecting Bordetella pertussis nucleic acid, Bordetella parapertussis nucleic acid, Bordetella hallii nucleic acid and Bordetella bronchiseptica nucleic acid.

[0009] The second object of the present invention is to provide a fully automatic integrated kit for sample preparation (nucleic acid extraction), nucleic acid amplification and detection analysis, which is used to detect Bordetella pertussis nucleic acid, Bordetella parapertussis nucleic acid, Bordetella hohnii nucleic acid and Bordetella bronchiseptica nucleic acid.

[0010] The third object of the present invention is to provide the use of the above kit in preparing a product for diagnosing Bordetella pertussis infection.

[0011] In order to achieve the above object, the present invention adopts the following technical solutions:

[0012] The present invention first provides a Bordetella nucleic acid detection primer set, including a BP485 fragment for detecting Bordetella pertussis and an IS481 fragment and a PIS1001 fragment for detecting Bordetella parapertussis, Bordetella hohnii or Bordetella bronchiseptica;

[0013] Among them, the specific primers for Bordetella pertussis targeting the BP485 fragment are sequences shown in SEQ ID NO.1-SEQ ID NO.6;

[0014] The specific primers for Bordetella for the IS481 fragment include the sequences shown in SEQ ID NO.7 to SEQ ID NO.12;

[0015] The primers specific to Bordetella for the PIS1001 fragment include the sequences shown as SEQ ID NO.13 to SEQ ID NO.18.

[0016] The present invention further provides a Bordetella nucleic acid detection kit, the kit comprising:

[0017] (1) Detection tube A: comprising nanomagnetic particles, lysis solution, washing solution, eluent, and reaction reagent A; the specific target gene fragment amplified in the detection tube A is BP485, and comprises the specific primers for Bordetella pertussis targeting the BP485 fragment as described in claim 1;

[0018] (2) Detection tube B: comprising nanomagnetic particles, lysis solution, washing solution, elution solution, and reaction reagent B; the specific target gene fragments amplified in detection tube B are PIS1001 and IS481, and comprising the specific primers for Bordetella for the IS481 fragment and the specific primers for Bordetella for the PIS1001 fragment described in claim 1;

[0019] (3) Positive control A: a plasmid containing the BP485 fragment;

[0020] (4) Positive control B: a plasmid mixture containing the PIS1001 fragment and the IS481 fragment;

[0021] (5) Negative control: physiological saline.

[0022] As a preferred embodiment of the present invention, the reaction reagent A comprises an enzyme and a specific primer for Bordetella pertussis targeting the BP485 fragment;

[0023] The specific primers for B. pertussis targeting the BP485 fragment are:

[0024] BP485_FB: sequence as shown in SEQ ID NO.1;

[0025] BP485_OP: sequence as shown in SEQ ID NO.2;

[0026] BP485_CPR: the sequence shown in SEQ ID NO.3;

[0027] BP485_RB: sequence as shown in SEQ ID NO.4;

[0028] BP485_IP: sequence as shown in SEQ ID NO.5;

[0029] BP485_MB: the sequence shown in SEQ ID NO.6.

[0030] As a preferred embodiment of the present invention, the reaction reagent B comprises an enzyme and a specific primer for Bordetella targeting IS481 fragment and a specific primer for Bordetella targeting PIS1001;

[0031] The specific primers for Bordetella for the IS481 fragment are:

[0032] IS481_FB: sequence as shown in SEQ ID NO.7;

[0033] IS481_OP: the sequence shown in SEQ ID NO.8;

[0034] IS481_CPR: the sequence shown in SEQ ID NO.9;

[0035] IS481_RB: sequence as shown in SEQ ID NO.10;

[0036] IS481_IP: sequence as shown in SEQ ID NO.11;

[0037] IS481_MB: sequence as shown in SEQ ID NO.12;

[0038] The specific primers for Bordetella for the PIS1001 fragment are:

[0039] PIS1001_FB: sequence as shown in SEQ ID NO.13;

[0040] PIS1001_OP: the sequence shown in SEQ ID NO.14;

[0041] PIS1001_CPR: the sequence shown in SEQ ID NO.15;

[0042] PIS1001_RB: sequence as shown in SEQ ID NO.16;

[0043] PIS1001_IP: sequence as shown in SEQ ID NO.17;

[0044] PIS1001_MB: the sequence shown in SEQ ID NO.18.

[0045] As a preferred embodiment of the present invention, the preparation method of the positive control A is as follows: using two peripheral primers SEQ ID NO.1 and SEQ ID NO.6 to perform PCR amplification to obtain BP485 target gene fragments respectively; using Shanghai Biotech's PCR purification kit to purify the obtained PCR amplification products; using the purified amplification products through a plasmid transfection kit (Shanghai Biotech's T-easy plasmid transfection kit) to construct a complete plasmid sequence containing the target gene SEQ ID NO.19; quantifying the extracted plasmid and diluting it to 10 6 copies / ml, stored at -20℃.

[0046] As a preferred embodiment of the present invention, the preparation method of the positive control B is as follows: using two peripheral primers SEQ ID NO.7 and SEQ ID NO.12 and SEQ ID NO.13 and SEQ ID NO.18 to perform PCR amplification to obtain two target gene fragments IS481 and PIS1001 respectively; using Shanghai Biotech's PCR purification kit to purify the obtained PCR amplification product; using the purified amplification product through a plasmid transfection kit (Shanghai Biotech's T-easy plasmid transfection kit) to construct a complete plasmid sequence containing the target genes SEQ ID NO.20 and SEQ ID NO.21; quantifying the extracted plasmid and diluting it to 2×10 6 The two plasmid DNAs were mixed in a 1:1 ratio to make their final concentrations 10 6 copies / μl, stored at -20℃.

[0047] As a preferred embodiment of the present invention, the amplification reaction system for the BP485 fragment is: 0.1-0.5μM BP485_FB, 0.2-1.8μM BP485_OP, 0.2-1.8μM BP485_CPR, 0.1-0.5μM BP485_RB, 0.2-1.8μM BP485_IP, 0.1-0.5μM BP485_MB, 1-2.5x enzyme buffer, 2-8mM magnesium sulfate, 0.2-1mM dNTP, 0-1M Betaine and 4-15U enzyme, supplemented to 25-50μL with ddH2O.

[0048] As a preferred embodiment of the present invention, the amplification reaction system for the IS481 fragment is: 0.1-0.5 μM IS481_FB, 0.2-1.8 μM IS481_OP, 0.2-1.8 μM IS481_CPR, 0.1-0.5 μM IS481_RB, 0.2-1.8 μM IS481_IP, 0.1-0.5 μM IS481_MB, 1-2.5x enzyme buffer, 2-8 mM magnesium sulfate, 0.2-1 mM dNTP, 0-1 M Betaine and 4-15 U enzyme, supplemented to 25-50 μL with ddH2O;

[0049] The amplification reaction system for the PIS1001 fragment is: 0.1-0.5μM PIS1001_FB, 0.2-1.8μM PIS1001_OP, 0.2-1.8μM PIS1001_CPR, 0.1-0.5μM PIS1001_RB, 0.2-1.8μM PIS1001_IP, 0.1-0.5μM PIS1001_MB, 1-2.5x enzyme buffer, 2-8mM magnesium sulfate, 0.2-1mM dNTP, 0-1M Betaine and 4-15U enzyme, supplemented to 25-50μL with ddH2O.

[0050] As a preferred embodiment of the present invention, the detection tube includes a main tube and two branch tubes below the main tube. The main tube is provided with a nucleic acid extraction area and a nucleic acid purification area. The branch tubes are two independent nucleic acid amplification detection areas, which are divided into a left leg and a right leg, and can perform independent nucleic acid amplification and detection.

[0051] Finally, the present invention provides the use of the above-mentioned kit in preparing a product for diagnosing Bordetella infection.

[0052] Table 1 summarizes the current methods for testing Bordetella pertussis and their advantages and disadvantages. Therefore, the present invention provides a kit for fully automatic integrated sample preparation (nucleic acid extraction), nucleic acid amplification and detection analysis, which is used to detect Bordetella pertussis nucleic acid, Bordetella parapertussis nucleic acid, Bordetella hohnii nucleic acid and Bordetella bronchiseptica nucleic acid. All detection processes of the present invention are carried out in one detection tube.

[0053] Table 1. Summary of current methods for testing Bordetella pertussis and comparison of their advantages and disadvantages

[0054]

[0055]

[0056] Compared with the prior art, the present invention has the following beneficial effects:

[0057] 1) The present invention is simple to operate and has high repeatability: the operator only needs to perform a sample addition step and complete the entire detection process with a single click, thus achieving high repeatability.

[0058] 2) High detection rate: The "two-tube" design of the test tube has two test tubes. Test tube A can complete the gene target sequence amplification of Bordetella pertussis; test tube B can complete the gene target sequence amplification of Bordetella. On the premise that test tube A is negative, it can distinguish between positive Bordetella parapertussis / positive Bordetella hohnii / positive or negative Bordetella bronchiseptica.

[0059] 3) Fully enclosed integrated detection: The present invention adopts multi-layer liquid phase movement technology under the traction of multi-level magnetic media (nanomagnetic beads), so that external magnetic bodies can be used as power sources. Multiple processing steps of samples from nucleic acid extraction to amplification and detection can all occur in the same detection tube, and the detection tube is in a fully enclosed state, thereby reducing the chance of sample cross-contamination and amplification product contamination. Therefore, not only is the detection efficiency higher, but the detection accuracy is also higher.

[0060] 4) Good applicability: It can meet the sample testing needs of centralized central laboratories and primary medical institutions at the same time.

[0061] 5) No special requirements for operator skills and use environment: Since the kit of the present invention is easy to operate and the detection is closed throughout the process, there are no special requirements for operator skills and instrument use environment. DETAILED DESCRIPTION

[0062] In order to make the technical means, creative features, purpose and efficacy of the present invention easy to understand, the present invention is further described below in conjunction with specific embodiments, but the following embodiments are only preferred embodiments of the present invention, not all. Based on the embodiments in the implementation mode, other embodiments obtained by those skilled in the art without creative work all belong to the protection scope of the present invention. The experimental methods in the following embodiments, unless otherwise specified, are conventional methods, and the materials, reagents, etc. used in the following embodiments, unless otherwise specified, can all be obtained from commercial channels.

[0063] The Bordetella nucleic acid detection kit provided by the present invention uses primers designed with specific target fragments of Bordetella (including Bordetella pertussis, Bordetella parapertussis, Bordetella hohnii and Bordetella bronchiseptica), utilizes multiple DNA polymerase chain reaction combinations to amplify specific fragments of target genes of Bordetella nucleic acid in samples, and performs real-time fluorescence detection of specific fragments of target genes through specific probes, thereby realizing screening and detection of Bordetella pertussis and other Bordetella.

[0064] Among them, during the detection, one or more detection tubes can be used for combined detection to distinguish Bordetella pertussis, Bordetella parapertussis, Bordetella hohnii and Bordetella bronchiseptica. The nucleic acid extraction and purification, nucleic acid amplification and detection and analysis processes are automatically completed in the detection tube.

[0065] DNA polymerase chain reaction includes but is not limited to PCR technology, constant temperature amplification technology, digital PCR technology, etc. Probes include but are not limited to common probes such as molecular beacons, Taqman, and MGB probes.

[0066] The specific fragments of the target gene to be amplified can be one group or multiple groups, and different specific primers are used for amplification reaction accordingly, and fluorescence detection is performed on the amplification reaction at the same time. Based on the results of different target gene amplification reactions, it is determined whether the sample contains Bordetella pertussis, Bordetella parapertussis, Bordetella hohnii or Bordetella bronchiseptica.

[0067] That is, first use the test tube A to detect whether the sample contains Bordetella pertussis, and then use the test tube B to distinguish Bordetella parapertussis, Bordetella hohnii, and Bordetella bronchiseptica on the premise that the test tube A is negative.

[0068] The method for detecting Bordetella pertussis using the kit of the present invention comprises the following specific steps:

[0069] a) Take 500 μL-2 ml of sample into test tube A; add positive control template A and negative control template into control test tube A respectively.

[0070] b) placing the added test tube into a nucleic acid amplification test analyzer, starting a specific program to begin testing, and performing an amplification reaction at 60-65° C. for 10-30 minutes, preferably at 63° C. for 30 minutes.

[0071] c) After the reaction is completed, save the data file.

[0072] The results analysis is shown in Table 2.

[0073] Table 2. Detection results of Bordetella pertussis

[0074]

[0075] The automatic analysis system of the instrument obtains the following results: positive for pertussis, negative for pertussis, or invalid. According to the table above, when both the left and right legs of test tube A are positive, the left leg is positive and the right leg is negative, or the left leg is negative and the right leg is positive, the results are all positive for Bordetella pertussis; when both the left and right legs of test tube A are negative, the result is negative for Bordetella pertussis; if one or both legs show "invalid", the test result is "invalid" and needs to be retested.

[0076] The method for detecting Bordetella parapertussis / Bordetella hodgsoni / Bordetella bronchitis using the kit of the present invention is that, on the premise that the test result of the above-mentioned test tube A is negative, the sample is retested using the test tube B, and the specific detection steps are as follows:

[0077] a) Take 500 μL-2 ml of sample into test tube B; add positive control template B and negative control template into control test tube B respectively.

[0078] b) Place the added test tube B into a nucleic acid amplification test analyzer, start a specific program to begin testing, and perform an amplification reaction at 60-65° C. for 10-30 minutes, preferably at 63° C. for 30 minutes.

[0079] c) After the reaction is completed, save the data file.

[0080] The results analysis is shown in Table 3.

[0081] Table 3. Detection results of Bordetella parapertussis / Bordetellahodgsoni / Bordetella bronchitis

[0082]

[0083] The following results are obtained through the automatic analysis system of the instrument: positive or negative for Bordetella bronchiseptica, positive or negative for Bordetella hohnii, positive or negative for Bordetella parapertussis, or invalid.

[0084] According to Table 3, when both the left leg and the right leg of test tube B are positive, the result is positive for Bordetella bronchiseptica; when the left leg of test tube B is positive and the right leg is negative, the result is positive for Bordetella hohnii; when the left leg of test tube B is negative and the right leg is positive, the result is positive for Bordetella parapertussis; when both the left leg and the right leg of test tube B are negative, the result is negative for Bordetella; if one or both legs show "invalid", the test result is "invalid" and needs to be retested.

[0085] The samples mentioned above include nasopharyngeal swabs, but are not limited to nasopharyngeal swabs, and can be other samples such as bacterial liquid, sputum, lavage fluid, etc.

[0086] Example 1

[0087] The composition of the kit of the present invention:

[0088] The reaction solution in the detection tube is as follows:

[0089] (I) The specific primers for Bordetella pertussis BP485 are:

[0090] SEQ ID NO.1(BP485_FB):GCGATCTCGATGCTTGACG;

[0091] SEQ ID NO.2 (BP485_OP): TTGATTGACAGGGCAATCCGGC;

[0092] SEQ ID NO.3 (BP485_CPR):

[0093] TTGATTGACAGGGCAATCCGGCTGCGTGTTTTCCCCAGAG;

[0094] SEQ ID NO.4(BP485_RB): CCTCATCTTCGTTCAGCGAA;

[0095] SEQ ID NO.5(BP485_IP):AATAGCGCAGTCCGGCGTA;

[0096] SEQ ID NO.6 (BP485_MB): 5'-6FAM-GCCGTGCGTGCTTGACGTGACCGCGCACGGC-(BHQ1)-3'; (ii) the specific primer for Bordetella of IS481 is:

[0097] SEQ ID NO.7(IS481_FB): CGCTGGATGGTCACGC;

[0098] SEQ ID NO.8(IS481_OP):CGTGGTCATCGATGGCCACG;

[0099] SEQ ID NO.9 (IS481_CPR): CGTGGTCATCGATGGCCACGGGTCACGGGCAACCGAG;

[0100] SEQ ID NO.10(IS481_RB): TGGGACGTATCCAGCGC;

[0101] SEQ ID NO.11(IS481_IP):GTCCCAGCCGGCCCCCTC;

[0102] SEQ ID NO.12 (IS481_MB): 5'-6FAM-GCCGTGCGTCCCAGCCGGCCCCCTC GCACGGC-(BHQ1)-3'; (iii) the specific primer for Bordetella of PIS1001 is:

[0103] SEQ ID NO.13 (PIS1001_FB): AGGCGGTGGCGAGGTT;

[0104] SEQ ID NO.14 (PIS1001_OP): TTGGCGATGGACGAGTTTGCC;

[0105] SEQ ID NO.15 (PIS1001_CPR):

[0106] TTGGCGATGGACGAGTTTGCCCGGATCGACCACCACTGTC;

[0107] SEQ ID NO.16(PIS1001_RB): GGGCCAATCCACAGCAC;

[0108] SEQ ID NO.17(PIS1001_IP): GCAAAAGGGCATCGCTACGC;

[0109] SEQ ID NO.18(PIS1001_MB): 5'-6FAM-GCCGTGC GAGCCTTGTCCAGCGTCTTGACGCACGGC-

[0110] (BHQ1)-3'.

[0111] See Table 4 for the ratio of reaction solution components of the amplification reaction system for BP485.

[0112] Table 4. Amplification reaction system of BP485

[0113]

[0114]

[0115] See Table 5 for the ratio of reaction solution components of the IS481 amplification reaction system.

[0116] Table 5. Amplification reaction system of IS481

[0117] IS481 Working concentration range Priority Selection IS481_FB 0.1-0.5μM 0.1μM IS481_OP 0.2-1.8μM 1.2μM IS481_CPR 0.2-1.8μM 1μM IS481_RB 0.1-0.5μM 0.1μM IS481_IP 0.2-1.8μM 0.3μM IS481_MB-FAM 0.1-0.5μM 0.3μM Enzyme buffer 1-2.5x 1x MgSO4 (Magnesium sulfate) 2-8mM 3mM dNTP 0.2-1mM 0.5mM Betaine 0-1M 0.3M Enzymes 4-15U 6U ddH2O (distilled water) / Make up to 25-50 μL total / 25-50μL

[0118] The reaction solution component ratios for the amplification reaction system of PIS1001 are shown in Table 6.

[0119] Table 6. Amplification reaction system of PIS1001

[0120]

[0121]

[0122] (IV) Positive control A: DNA containing the Bordetella pertussis BP485 gene [NCBI: BX470248.1, range: 428451-428680]. Preparation steps of positive control:

[0123] (1) PCR amplification of the target gene was performed using two peripheral primers and the genomic DNA template of Bordetella pertussis;

[0124] (2) Purify the PCR amplification product using Shanghai Bio-Tech Purification Kit;

[0125] (3) The purified amplified product was used with the Shanghai Biotechnology T-easy plasmid kit to construct a plasmid containing the target gene fragment;

[0126] (4) Measure A using a spectrophotometer 260 Quantify and dilute to 10 6 copies / μl, stored at -20℃.

[0127] (V) Positive control B: DNA containing the IS481 gene [Bordetella pertussis NCBI: BX470248.1, range: 27595-27806] and the IS1001 gene [Bordetella parapertussis NCBI: HE965803.1, range: 612218-612416] of Bordetella pertussis, Bordetella hohnii and Bordetella bronchiseptica. Preparation steps of positive control:

[0128] (1) PCR amplification was performed using two peripheral primers to obtain two target gene fragments, IS481 and PIS1001;

[0129] (2) Purify the PCR amplification product using Shanghai Bio-Tech Purification Kit;

[0130] (3) The purified amplified product was used with the Shanghai Biotechnology T-easy plasmid kit to construct a plasmid containing the target gene fragment;

[0131] (4) Measure A260 with a spectrophotometer and dilute to 2x10 6 copies / ml.

[0132] (5) The two plasmid DNAs were mixed in a 1:1 ratio so that the final concentration of each was 10 6 copies / μl, stored at -20℃.

[0133] (vi) Negative control: normal saline.

[0134] Example 2

[0135] The specific method for detecting Bordetella pertussis using the kit of the present invention is:

[0136] (a) Take 500 μL of nasopharyngeal swab sample and put it into test tube A; add positive control template and negative control template into the control test tubes respectively.

[0137] (b) Scan the QR code to perform extraction, amplification and analysis on the nucleic acid amplification analyzer:

[0138] (c) After the reaction is completed, save the data file.

[0139] The results analysis is shown in Table 2.

[0140] Table 2. Detection results of Bordetella pertussis

[0141]

[0142]

[0143] The automatic analysis system of the instrument obtains the following results: positive for pertussis, negative for pertussis, or invalid. According to the table above, when the left leg and the right leg of test tube A are both positive, the left leg is positive and the right leg is negative, or the left leg is negative and the right leg is positive, the results are all positive for Bordetella pertussis; when the left leg and the right leg of test tube A are both negative, the result is negative for Bordetella pertussis; if one or both legs show "invalid", the test result is "invalid" and needs to be retested.

[0144] The experiment was repeated 10 times, and there was no significant difference in the test results, indicating that the test results of different batches of the kit of the present invention are comparable and have good repeatability. The above examples show that the test kit of the present invention has good repeatability, and the test of the sample only takes about 0.5-1 hour to complete, greatly shortening the test time. At the same time, the kit of the present invention only requires one person to complete all the operation processes, which also reduces the waste of manpower.

[0145] Example 3

[0146] The specific method of using the kit of the present invention to detect Bordetella parapertussis / Bordetella hohnii / Bordetella bronchiseptica is as follows:

[0147] (a) If the test tube A is negative, use the test tube B in the kit to perform the following tests;

[0148] (b) Take 500 μl of nasopharyngeal swab sample and put it into test tube B; add positive control template and negative control template to the control test tubes respectively.

[0149] (c) Scan the QR code to perform extraction, amplification and analysis on the nucleic acid amplification analyzer:

[0150] (d) After the reaction is completed, save the data file.

[0151] The results analysis is shown in Table 3.

[0152] Table 3. Detection results of Bordetella parapertussis / Bordetellahodgsoni / Bordetella bronchitis

[0153]

[0154]

[0155] The following results are obtained through the instrument's automatic analysis system: positive or negative for Bordetella bronchiseptica; positive or negative for Bordetella hohnii; positive or negative for Bordetella parapertussis; or invalid results.

[0156] According to Table 3, when both the left leg and the right leg of test tube B are positive, the result is positive for Bordetella bronchiseptica; when the left leg of test tube B is positive and the right leg is negative, the result is positive for Bordetella hohnii; when the left leg of test tube B is negative and the right leg is positive, the result is positive for Bordetella parapertussis; when both the left leg and the right leg of test tube B are negative, the result is negative for Bordetella; if one or both legs show "invalid", the test result is "invalid" and needs to be retested.

[0157] The experiment was repeated 10 times, and there was no significant difference in the test results, indicating that the test results of different batches of the kit of the present invention are comparable and have good repeatability. The above examples show that the test kit of the present invention has good repeatability, and the test of the sample only takes about 1-1.5 hours to complete, greatly shortening the test time. At the same time, the kit of the present invention only requires one person to complete all the operation processes, which also reduces the waste of manpower.

[0158] Example 4

[0159] Specific method for detecting Bordetella pertussis / Bordetella parapertussis / Bordetella hohnii / Bordetella bronchiseptica using the kit of the present invention:

[0160] (I) The reaction solution described in detection tube A is as follows:

[0161] The specific primers for Bordetella pertussis BP485 are:

[0162] SEQ ID NO.1(BP485_FB):GCGATCTCGATGCTTGACG

[0163] SEQ ID NO.4(BP485_RB): CCTCATCTTCGTTCAGCGAA

[0164] SEQ ID NO. 12 (BP485_MB): 5'-6FAM-GCCGTGC GTCCCAGCCGGCCCCCTC GCACGGC-(BHQ1)-3'.

[0165] The ratio of the reaction solution components of the amplification reaction system for BP485 is shown in Table 7.

[0166] Table 7. Amplification reaction system of BP485

[0167]

[0168]

[0169] (ii) The reaction solution described in detection tube B is as follows:

[0170] The specific primers for Bordetella against IS481 are:

[0171] SEQ ID NO.7(IS481_FB):CGCTGGATGGTCACGC

[0172] SEQ ID NO.10 (IS481_RB): TGGGACGTATCCAGCGC SEQ ID NO.12 (IS481_MB): 5'-6FAM-GCCGTGC GTCCCAGCCGGCCCCCTC GCACGGC-(BHQ1)-3'. The specific primers for Bordetella of PIS1001 are:

[0173] SEQ ID NO.13(PIS1001_FB):AGGCGGTGGCGAGGTT

[0174] SEQ ID NO.16 (PIS1001_RB): GGGCCAATCCACAGCACSEQ ID NO.18 (PIS1001_MB): 5'-6FAM-GCCGTGC GAGCCTTGTCCAGCGTCTTGAC GCACGGC-

[0175] (BHQ1)-3'.

[0176] The ratio of the reaction solution components of the IS481 amplification reaction system is shown in Table 8.

[0177] Table 8. Amplification reaction system of IS481

[0178] IS481 Working concentration range Priority Selection IS481_FB 0.1-1μM 0.3μM IS481_RB 0.1-1μM 0.3μM IS481_MB-FAM 0.1-0.5μM 0.3μM MgSO4 (Magnesium sulfate) 2-8mM 2mM dNTP 0.2-1mM 0.2mM Taq enzyme 0.1-5U 1.25U ddH2O (distilled water) / Make up to 25-50 μL total / 25-50μL

[0179] The ratio of the reaction solution components of the amplification reaction system for PIS1001 is shown in Table 9.

[0180] Table 9. Amplification reaction system of PIS1001

[0181]

[0182]

[0183] Example 5

[0184] 1. Materials and Methods

[0185] 1.1 Reagents and instruments

[0186] Plasmid DNA, primers, and probes were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.;

[0187] Plasmid concentration was determined using a NanoDrop 2000 micro-spectrophotometer;

[0188] The nucleic acid amplification detection analyzer is produced by Hangzhou Ustar Biotechnology Co., Ltd.

[0189] 1.2 Preparation of test tubes

[0190] Prepare test tube A and test tube B according to Tables 4 to 6.

[0191] 1.3 Nucleic Acid Amplification

[0192] Four different concentrations of plasmid dilutions of Bordetella pertussis / Bordetella parapertussis / Bordetella hochstella / Bordetella bronchiseptica, 5000 copies / mL, 1000 copies / mL, 500 copies / mL, and 200 copies / mL, were selected as amplification templates (load volume 500 μL), and each concentration gradient of plasmid dilution was tested 10 times. Distilled water was used as the amplification template for the negative control.

[0193] 2. Interpretation of results

[0194] The instrument automatically reports the results and summarizes the statistics.

[0195] 3. See Table 10 for experimental results.

[0196] Table 10. Experimental results

[0197] Template concentration Bordetella pertussis Bordetella parapertussis Bordetella hohnii Bronchitis Bout 5000 copies / mL 20 / 20 20 / 20 20 / 20 20 / 20 1000 copies / mL 20 / 20 20 / 20 20 / 20 20 / 20 500 copies / mL 20 / 20 20 / 20 20 / 20 20 / 20 200 copies / mL 16 / 20 12 / 20 5 / 20 7 / 20 Negative control 0 / 20 0 / 20 0 / 20 0 / 20

[0198] 4. Experimental Conclusion

[0199] The detection limit of the Bordetella detection kit disclosed in the present invention for Bordetella pertussis / Bordetella parapertussis / Bordetella hohnii / Bordetella bronchiseptica is not less than 500 copies / mL.

[0200] Example 6

[0201] Influenza A virus, influenza B virus, respiratory syncytial virus, adenovirus, parainfluenza virus, Epstein-Barr virus, Mycoplasma pneumoniae, Chlamydia pneumoniae, rhinovirus, Bocavirus, coronavirus NL63, coronavirus OC43, Legionella pneumophila, Streptococcus pneumoniae, human metapneumovirus, Klebsiella pneumoniae, Haemophilus influenzae, Escherichia coli, and Staphylococcus aureus are common and easily confused pathogens in clinical practice. Therefore, it is necessary to verify whether the above pathogens cause false positive results for the Bordetella test reagent.

[0202] 1. Materials and Methods

[0203] 1.1 Reagents and instruments

[0204] Plasmid DNA, primers, and probes were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.;

[0205] Plasmid concentration was determined using a NanoDrop 2000 micro-spectrophotometer;

[0206] The nucleic acid amplification detection analyzer is produced by Hangzhou Ustar Biotechnology Co., Ltd.

[0207] 1.2 Cultures or clinical samples

[0208] Influenza A virus, influenza B virus, respiratory syncytial virus, adenovirus, parainfluenza virus, Epstein-Barr virus, Mycoplasma pneumoniae, Chlamydia pneumoniae, rhinovirus, Bocavirus, coronavirus NL63, coronavirus OC43, Legionella pneumophila, Streptococcus pneumoniae, human metapneumovirus, Klebsiella pneumoniae, Haemophilus influenzae, Escherichia coli, Staphylococcus aureus.

[0209] 1.3 Preparation of test tubes

[0210] Prepare test tube A and test tube B according to Tables 4 to 6.

[0211] 1.4 Nucleic Acid Amplification

[0212] High-concentration cultures or clinical samples were used as amplification templates, and each pathogen / virus was tested in triplicate.

[0213] Bordetella plasmid template was amplified as a positive control and the test was repeated three times.

[0214] Distilled water was used as the amplification template for the negative control and the test was repeated 3 times.

[0215] 2. Interpretation of results

[0216] The instrument automatically reports the results and summarizes the statistics.

[0217] 3. Experimental results

[0218] The test results for influenza A virus, influenza B virus, respiratory syncytial virus, adenovirus, parainfluenza virus, Epstein-Barr virus, Mycoplasma pneumoniae, Chlamydia pneumoniae, rhinovirus, bocavirus, coronavirus NL63, coronavirus OC43, Legionella pneumophila, Streptococcus pneumoniae, human metapneumovirus, Klebsiella pneumoniae, Haemophilus influenzae, Escherichia coli, and Staphylococcus aureus were all negative.

[0219] The test results of negative control and positive control were correct.

[0220] in conclusion

[0221] The Bordetella nucleic acid detection reagent disclosed in the present invention has no cross-reaction to 19 common clinical pathogens.

[0222] (III) PCR reaction conditions (example):

[0223]

[0224] (IV) PCR result determination (example):

[0225] (1) Use the test tube A in the kit for testing:

[0226] The automatic analysis system of the instrument obtains the following results: positive for pertussis, negative for pertussis, or invalid. According to the above table, when the left leg and the right leg of test tube A are both positive, the left leg is positive and the right leg is negative, or the left leg is negative and the right leg is positive, the results are all positive for Bordetella pertussis; when the left leg and the right leg of test tube A are both negative, the result is negative for Bordetella pertussis; if one or both legs show "invalid", the test result is "invalid" and needs to be retested (see Table 2).

[0227] The experiment was repeated 10 times, and there was no significant difference in the test results, indicating that the test results of different batches of the kit of the present invention are comparable and have good repeatability. The above examples show that the test kit of the present invention has good repeatability, and the test of the sample only takes about 1-1.5 hours to complete, greatly shortening the test time. At the same time, the kit of the present invention only requires one person to complete all the operation processes, which also reduces the waste of manpower.

[0228] (2) If the test tube A is negative, use the test tube B in the kit to test;

[0229] The following results are obtained through the automatic analysis system of the instrument: positive or negative for Bordetella bronchiseptica, positive or negative for Bordetella hohnii, positive or negative for Bordetella parapertussis, or invalid.

[0230] Refer to Table 3. When both the left leg and the right leg of test tube B are positive, the result is positive for Bordetella bronchiseptica; when the left leg of test tube B is positive and the right leg is negative, the result is positive for Bordetella hohnii; when the left leg of test tube B is negative and the right leg is positive, the result is positive for Bordetella parapertussis; when both the left leg and the right leg of test tube B are negative, the result is negative for Bordetella; if one or both legs show "invalid", the test result is "invalid" and needs to be retested.

[0231] The experiment was repeated 10 times, and there was no significant difference in the test results, indicating that the test results of different batches of the kit of the present invention are comparable and have good repeatability. The above examples show that the test kit of the present invention has good repeatability, and the test of the sample only takes about 1-1.5 hours to complete, greatly shortening the test time. At the same time, the kit of the present invention only requires one person to complete all the operation processes, which also reduces the waste of manpower.

[0232] The above is only a preferred embodiment of the present invention, and is not any formal or substantial limitation of the present invention. It should be pointed out that ordinary technicians in this technical field can make several improvements and supplements without departing from the method of the present invention, and these improvements and supplements should also be regarded as the protection scope of the present invention. Any technician familiar with this profession, without departing from the spirit and scope of the present invention, can make some changes, modifications and evolutions of the technical content disclosed above, which are equivalent embodiments of the present invention; at the same time, any changes, modifications and evolutions of any equivalent changes made to the above embodiments based on the essential technology of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. A primer set for detecting Bordetella nucleic acid, characterized in that: The method comprises a BP485 fragment for detecting Bordetella pertussis and an IS481 fragment and a PIS1001 fragment for detecting Bordetella parapertussis, Bordetella hohnii or Bordetella bronchiseptica; Among them, the specific primers for Bordetella pertussis targeting the BP485 fragment are sequences shown in SEQ ID NO.1-SEQ ID NO.6; The specific primers for Bordetella for the IS481 fragment include the sequences shown in SEQ ID NO.7 to SEQ ID NO.12; The primers specific to Bordetella for the PIS1001 fragment include the sequences shown as SEQ ID NO.13 to SEQ ID NO.

18.

2. A Bordetella nucleic acid detection kit, characterized in that: The kit comprises: (1) Detection tube A: comprising nanomagnetic particles, lysis solution, washing solution, eluent, and reaction reagent A; the specific target gene fragment amplified in the detection tube A is BP485, and comprises the specific primers for Bordetella pertussis targeting the BP485 fragment as described in claim 1; (2) Detection tube B: comprising nanomagnetic particles, lysis solution, washing solution, elution solution, and reaction reagent B; the specific target gene fragments amplified in detection tube B are PIS1001 and IS481, and comprising the specific primers for Bordetella for the IS481 fragment and the specific primers for Bordetella for the PIS1001 fragment described in claim 1; (3) Positive control A: a plasmid containing the BP485 fragment; (4) Positive control B: a plasmid mixture containing the PIS1001 fragment and the IS481 fragment; (5) Negative control: physiological saline.

3. The Bordetella nucleic acid detection kit according to claim 2, characterized in that: The reaction reagent A comprises an enzyme and a specific primer for Bordetella pertussis targeting the BP485 fragment; The specific primers for B. pertussis targeting the BP485 fragment are: BP485_FB: sequence as shown in SEQ ID NO.1; BP485_OP: sequence as shown in SEQ ID NO.2; BP485_CPR: the sequence shown in SEQ ID NO.3; BP485_RB: sequence as shown in SEQ ID NO.4; BP485_IP: sequence as shown in SEQ ID NO.5; BP485_MB: the sequence shown in SEQ ID NO.

6.

4. The Bordetella nucleic acid detection kit according to claim 3, characterized in that: The reaction reagent B comprises an enzyme and a specific primer for Bordetella targeting IS481 fragment and a specific primer for Bordetella targeting PIS1001; The specific primers for Bordetella for the IS481 fragment are: IS481_FB: sequence as shown in SEQ ID NO.7; IS481_OP: the sequence shown in SEQ ID NO.8; IS481_CPR: the sequence shown in SEQ ID NO.9; IS481_RB: sequence as shown in SEQ ID NO.10; IS481_IP: sequence as shown in SEQ ID NO.11; IS481_MB: sequence as shown in SEQ ID NO.12; The specific primers for Bordetella for the PIS1001 fragment are: PIS1001_FB: sequence as shown in SEQ ID NO.13; PIS1001_OP: the sequence shown in SEQ ID NO.14; PIS1001_CPR: the sequence shown in SEQ ID NO.15; PIS1001_RB: sequence as shown in SEQ ID NO.16; PIS1001_IP: sequence as shown in SEQ ID NO.17; PIS1001_MB: the sequence shown in SEQ ID NO.

18.

5. The Bordetella nucleic acid detection kit according to claim 2, characterized in that: The preparation method of the positive control A is as follows: using two peripheral primers SEQ ID NO.1 and SEQ ID NO.6 to perform PCR amplification to obtain the BP485 target gene fragments respectively; purifying the obtained PCR amplification products; using the purified amplification products to construct a complete plasmid sequence containing the target gene SEQ ID NO.19 through a plasmid transfection kit; quantifying the extracted plasmid and diluting it to 10 6 copies / ml, stored at -20℃.

6. The Bordetella nucleic acid detection kit according to claim 2, characterized in that: The preparation method of the positive control B is as follows: using two peripheral primers SEQ ID NO.7 and SEQ ID NO.12 and SEQ ID NO.13 and SEQ ID NO.18 to perform PCR amplification to obtain two target gene fragments IS481 and PIS1001 respectively; purifying the obtained PCR amplification products; using the purified amplification products to construct a complete plasmid sequence containing the target genes SEQ ID NO.20 and SEQ ID NO.21 through a plasmid transfection kit; quantifying the extracted plasmid and diluting it to 2×10 6 The two plasmid DNAs were mixed in a 1:1 ratio to make their final concentrations 10 6 copies / μl, stored at -20℃.

7. The Bordetella nucleic acid detection kit according to claim 2, characterized in that: The amplification reaction system for the BP485 fragment is: 0.1-0.5μM BP485_FB, 0.2-1.8μM BP485_OP, 0.2-1.8μM BP485_CPR, 0.1-0.5μM BP485_RB, 0.2-1.8μM BP485_IP, 0.1-0.5μM BP485_MB, 1-2.5x enzyme buffer, 2-8mM magnesium sulfate, 0.2-1mM dNTP, 0-1M Betaine and 4-15U enzyme, supplemented to 25-50μL with ddH2O.

8. The Bordetella nucleic acid detection kit according to claim 2, characterized in that: The amplification reaction system for the IS481 fragment is: 0.1-0.5 μM IS481_FB, 0.2-1.8 μM IS481_OP, 0.2-1.8 μM IS481_CPR, 0.1-0.5 μM IS481_RB, 0.2-1.8 μM IS481_IP, 0.1-0.5 μM IS481_MB, 1-2.5x enzyme buffer, 2-8 mM magnesium sulfate, 0.2-1 mM dNTP, 0-1 M Betaine and 4-15 U enzyme, supplemented to 25-50 μL with ddH2O; The amplification reaction system for the PIS1001 fragment is: 0.1-0.5μM PIS1001_FB, 0.2-1.8μM PIS1001_OP, 0.2-1.8μM PIS1001_CPR, 0.1-0.5μM PIS1001_RB, 0.2-1.8μM PIS1001_IP, 0.1-0.5μM PIS1001_MB, 1-2.5x enzyme buffer, 2-8mM magnesium sulfate, 0.2-1mM dNTP, 0-1M Betaine and 4-15U enzyme, supplemented to 25-50μL with ddH2O.

9. The Bordetella nucleic acid detection kit according to claim 2, characterized in that: The detection tube includes a main tube and two branch tubes below the main tube. The main tube is provided with a nucleic acid extraction area and a nucleic acid purification area. The branch tubes are two independent nucleic acid amplification detection areas, divided into a left leg and a right leg, which can perform independent nucleic acid amplification and detection.

10. Use of the kit according to any one of claims 2 to 9 in the preparation of a product for diagnosing Bordetella infection.

Images