Selective counting method for lactobacillus gene complete knockout defect type

Abstract

The invention discloses a selective counting method for a lactic acid bacteria gene complete knockout defect type, which comprises the following steps: designing a nested primer in a gene knockout region of a to-be-counted thallus, amplifying a specific fragment by taking DNA of the gene knockout defect type of the to-be-counted thallus as a template, constructing a defect type strain counting vector, and drawing a defect type strain standard curve; designing a wild-type counting primer in the defective deletion gene, constructing a special carrier for distinguishing the wild-type strains, and drawing a standard curve of the wild-type strains; the method comprises the following steps: extracting genome DNA of thalli to be counted, controlling annealing extension time, carrying out two-step qPCR amplification by adopting a knockout region nested primer, and counting complete knockout defect types of the thalli to be counted. According to the method, wild types and defective types can be distinguished, the purpose of quantitative counting is achieved, the change rule of genetically engineered bacteria in a sample is analyzed, then the effect of target genes in biological evolution, bacterial colony synthesis and food production is better analyzed, and technical support is provided for accurate design and development of food.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a selection and counting method for a lactic acid bacteria gene complete knockout defective type. Background Art

[0002] The application of lactic acid bacteria in food production has a history of thousands of years. It can not only improve the flavor and texture of food and extend the shelf life, but also some strains can play a probiotic function. Rhamnosus lactic acid bacteria can colonize in the intestines, help improve gastrointestinal function, enhance immunity, prevent and treat diarrhea, etc. At present, the genetic level mechanisms of lactic acid bacteria metabolic physiology, mixed fermentation, stress tolerance and probiotic functions are still under study. Gene knockout is an effective means of studying gene function. The gene is completely knocked out defective, that is, the target gene is completely deleted by double exchange, and antibiotic resistance fragments are not used for screening. The gene is completely knocked out defective without the introduction of foreign genes and resistance fragments. No selection pressure is required when the strain is cultured, which can reduce environmental interference and has higher safety.

[0003] With the development of science and technology, complete gene knockout defective types will play a role in the physiological research and application of lactic acid bacteria. However, when the defective type and the wild type are mixed and cultured, the existing plate counting method, high-throughput sequencing method, flow cytometry and other methods are difficult to select and count the complete gene knockout defective type, because the defective type has the same sequence as the wild type except for the lack of a gene, making it difficult to select and count the complete gene knockout defective type. This problem limits the research on gene function, biological evolution, food development and other aspects.

[0004] Quantitative PCR (qPCR) technology is based on the amplification behavior of specific primers, and can quickly count microorganisms of different genera, species, and even strains. It is a selective counting method with strong specificity and low latency. Designing specific primers inside the target gene can easily count the wild type, but the sequences contained in the defective strains are also present in the wild type, which makes qPCR counting of defective strains difficult. Summary of the invention

[0005] The present invention aims at solving the technical problem and overcomes the shortcomings of the prior art to provide a method for selecting and counting lactic acid bacteria with complete gene knockout defects.

[0006] The present invention provides a method for selecting and counting lactic acid bacteria with complete gene knockout defects, comprising the following steps: Step 1: design nested primers for the knockout region of the bacteria to be counted, use the DNA of the knockout defective bacteria to be counted as a template to amplify specific fragments, construct a defective strain counting vector, and draw a defective strain standard curve; Step 2: extract the genomic DNA of the bacteria to be counted as a template, control the annealing extension time of the two-step qPCR, use the nested primers of the knockout region to perform two-step qPCR amplification, and count the complete knockout defective type of the bacteria to be counted.

[0007] The core of the present invention is to provide a defective counting method. Based on the new region formed by the gene knockout junction and according to the amplification speed of DNA polymerase, a pair of knockout region nested primers are designed, which can distinguish and count the complete gene knockout defective type by controlling the annealing extension time.

[0008] The present invention uses special primers for distinguishing wild-type strains inside the knockout gene to perform two-step qPCR amplification to count the wild type of the sample to be counted.

[0009] The technical solution further optimized by the present invention is as follows: In the step 1, the upstream primer of the gene knockout region nested primer is designed in the upstream region of the gene knockout region, and the downstream primer is designed in the downstream region of the gene knockout region.

[0010] In step 2, the annealing extension time of the two-step qPCR is 20-X s, where X≤wild-type amplification length / 30.

[0011] Lactic acid bacteria of the present invention ccpA The specific steps of the selection and counting method for complete gene knockout defective type are as follows: (1) Design of Lactobacillus rhamnosus ccpA Gene complete knockout defective counting primers; (2) Lactobacillus rhamnosus ccpA The gene-defective genomic DNA was used as template, and the complete knockout defective counting primers and standard curve were constructed; (3) Extract sample DNA, control the annealing extension time of the two-step qPCR, and use defective counting primers to quantify Lactobacillus rhamnosus. ccpA Complete gene knockout defective types were selectively counted.

[0012] In the step (2), a complete knockout defective counting primer and a wild-type counting primer are used to amplify specific fragments using the DNA of the knockout defective and wild-type bacteria to be counted as templates, a defective strain counting vector and a wild-type strain distinguishing vector are constructed, and a defective strain standard curve and a wild-type strain standard curve are drawn; Draw a standard curve with the Lg value of the counting plasmid concentration as the horizontal axis and the Ct value as the vertical axis, and we can get y=-ax+b, then .

[0014] The present invention uses Lactobacillus rhamnosus ccpA For example, the defective type of Lactobacillus rhamnosus hsryfm 1301 ccpA The sequences of the gene and its adjacent regions were analyzed in ccpA Counting primers are designed for the sequences inside and on both sides of the gene, and the defective type and wild type are distinguished and counted by controlling the length of the qPCR annealing extension time. The present invention realizes selective counting of mixed wild type and genetically engineered bacteria in culture medium and food samples, and has great application prospects.

[0015] In the step (1), Lactobacillus rhamnosus ccpA The length of the counting primers for complete gene knockout defect type is 18-25 bp, and the length of the amplified sequence is 100-300 bp.

[0016] In the step (1), Lactobacillus rhamnosus ccpA The counting primers for complete gene knockout defect type are F:CCTTAAAACTCGCTGCTGGC; R:TCGTCTATGCTTGCTTGGCA.

[0017] In the step (3), the annealing extension time of the two-step qPCR is 20-35 s and the temperature is 60°C.

[0018] In step (2), the two-step qPCR reaction system includes 10 µL of qPCR reaction buffer, wild-type genomic DNA of Lactobacillus rhamnosus or Lactobacillus rhamnosus ccpA 2 µL of gene-defective genomic DNA, 0.4 µL of each primer, and 7.2 µL of ddH2O.

[0019] In the step (2), pre-denaturation is performed at 95°C for 5 min; denaturation is performed at 95°C for 10 s, and the cycle is repeated 40 times; annealing-extension is performed at 60°C for 5-60 s, and the cycle is repeated 40 times; melting is performed at 95°C for 15 s; 60°C for 60 s; and 95°C for 15 s.

[0020] The present invention also provides a method for selecting and counting wild-type lactic acid bacteria genes, comprising: step 1, designing wild-type counting primers in the defective deletion gene, constructing a special vector for distinguishing wild-type strains, and drawing a standard curve of wild-type strains, wherein the upstream primer and the downstream primer of the wild-type counting primer are both designed in the knockout gene region; Step 2: Using the mixed bacterial sample DNA as a template, two-step qPCR amplification is performed using wild-type counting primers to distinguish the wild-type and complete knockout defective types of the bacteria to be counted and count the wild-type of the bacteria to be counted. The mixed bacterial sample contains wild-type and complete knockout defective types.

[0021] Preferably, the wild type Lactobacillus rhamnosus corresponds to ccpA The counting primers for gene defects are F:GAGGCGACCAGACGATTGAT; R:CTGTCAATCCGTGCCCCATA.

[0022] The present invention can use specific primers to distinguish the wild type and its defective type and achieve the purpose of quantitative counting. It can better analyze the change pattern of genetically engineered bacteria in the sample, and then better analyze the role of the target gene in biological evolution, synthetic colonies and food production, providing technical support for the precise design and development of food. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of the design position of the primers of the present invention. Figure 2 Schematic diagram of the PCR amplification results of two bacterial strains using four pairs of primers during the three-step extension for 20 s. Figure 3 Schematic diagram of PCR amplification results of two bacterial strains using four pairs of primers during three-step extension for 15 s. Figure 4 Schematic diagram of PCR amplification results of two bacterial strains using four pairs of primers during three-step extension for 10 s. Figure 5 This is a schematic diagram of the PCR amplification results of two bacterial strains using four pairs of primers when the three-step extension method was used for 5 s. Figure 6 Schematic diagram of the PCR amplification results of two bacterial strains using four pairs of primers in a two-step annealing-extension method for 15 s. Figure 7 Schematic diagram of the PCR amplification results of two bacterial strains using four pairs of primers in a two-step annealing-extension method for 10 s. Figure 8 Schematic diagram of PCR amplification results of two bacterial strains using four pairs of primers during two-step annealing-extension for 5 s. Fig. 9 The d2 primer pair ccpA The standard curve of the defective counting plasmid as template annealing-extension for 5 s. Fig.10 The d2 primer pair ccpA The standard curve of the defective counting plasmid as template annealing-extension for 10 s. Fig.11 The d2 primer pair ccpA The standard curve of the defective counting plasmid as template annealing-extension for 15 s. Fig.12 The d2 primer pair ccpA The standard curve of the defective counting plasmid as template annealing-extension for 20 s. Fig.13 The d2 primer pair ccpA The standard curve of the defective counting plasmid as template annealing-extension for 25 s. Fig.14 The d2 primer pair ccpA The standard curve of the defective counting plasmid as template annealing-extension for 30 s. Fig.15 The d2 primer pair ccpA The standard curve of the defective counting plasmid as template annealing-extension for 35 s. Fig.16 The d2 primer pair ccpA The standard curve of the defective counting plasmid as template annealing-extension for 40 s. Fig.17 The d2 primer pair ccpA The standard curve of the defective counting plasmid as template annealing-extension for 45 s. Fig.18 The d2 primer pair ccpA The standard curve of the defective counting plasmid as template annealing-extension for 50 s. Fig.19 The d2 primer pair ccpA The standard curve of the defective counting plasmid as template annealing-extension for 55 s. Fig. 20 The d2 primer pair ccpA The standard curve of the defective counting plasmid as template annealing-extension for 60 s. Fig.21 This is the standard curve of the D2 primer pair annealing-extending for 5 s with the wild-type counting plasmid as template. Fig. 22 This is the standard curve of the D2 primer pair annealing-extending for 10 s with the wild-type counting plasmid as template. Fig.23 This is the standard curve of the D2 primer pair annealing-extending for 15 s with the wild-type counting plasmid as template. Fig.24 This is the standard curve of the D2 primer pair annealing-extending for 20 s with the wild-type counting plasmid as template. Fig.25 The standard curve of the D2 primer pair annealing-extending for 25 s with the wild-type counting plasmid as template. Fig.26 This is the standard curve of the D2 primer pair annealing-extending for 30 s with the wild-type counting plasmid as template. Fig. 27 The standard curve of the D2 primer pair annealing-extending for 35 s with the wild-type counting plasmid as template. Fig.28 This is the standard curve of the D2 primer pair annealing-extending for 40 s with the wild-type counting plasmid as template. Fig.29 The standard curve of the D2 primer pair annealing-extending for 45 s with the wild-type counting plasmid as template. Fig.30 This is the standard curve of the D2 primer pair annealing-extending for 50 s with the wild-type counting plasmid as template. Fig.31 This is the standard curve of the D2 primer pair annealing-extending for 55 s with the wild-type counting plasmid as template. Fig.32 This is the standard curve of the D2 primer pair annealing-extending for 60 s with the wild-type counting plasmid as template. Fig.33 Y2 primer pair ccpA The standard curve of the defective counting plasmid as template annealing-extension for 20 s. Fig.34The standard curve of the Y2 primer pair annealing-extending for 20 s with the wild-type counting plasmid as template. Fig.35 for ccpA Schematic diagram of the results of single and mixed culture of defective and wild-type in MRS. Fig.36 for ccpA Schematic diagram of the results of single and mixed culture of the defective and wild types in skim milk. Fig.37 for ccpA Microscopic examination of the defective type cultured in MRS medium. Fig.38 The figure is a microscopic examination of the wild type cultured in MRS medium. Fig.39 for ccpA Microscopic examination of the defective type cultured in skim milk. Fig.40 This is a microscopic examination of the wild type cultured in skim milk. DETAILED DESCRIPTION

[0024] The technical solution of the present invention is further described in detail below in conjunction with the embodiments: This embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation method and a specific operation process are given, but the protection authority of the present invention is not limited to the following embodiments.

[0025] The materials and reagents mentioned in the present invention are all commercially available and can be purchased by the public from domestic and foreign commercial channels, so they will not be described one by one here. Example 1

[0026] (1) Design and verification of counting primers Download the complete gene sequence of Lactobacillus rhamnosus hsryfm 1301 from NCBI (NCBI accession number is CP044228) and obtain the ccpA The gene sequence and its upstream and downstream adjacent region sequences (as shown in SEQ ID NO.1, ccpA The gene sequence is from position 591 to 1592. ccpA The sequence before the gene sequence is the upstream sequence up, and the sequence after it is the downstream fragment down). Figure 1 The designed primers are shown as follows: the F primer of the defective primer pair is designed in the upstream region (up), and the R primer is designed in the downstream region (down). The length of the amplified sequence of the primer pair in the defective type is between 100-300 bp; the F primer and R primer of the wild-type primer pair are both designed in ccpAGene region, the length of the amplified sequence of the primer pair in the wild type is between 100-300 bp. The length of the defective and wild-type primers is 18-25 bp, the melting temperature (Tm) is 55-62℃, and the Tm difference between the two primers in the same primer pair does not exceed 2℃; the primer design is completed using an online tool (Primer-BLAST: https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi?LINK_LOC=BlastHome).

[0027] This example is a wild type of Lactobacillus rhamnosus hsryfm 1301 and its ccpA Two pairs of primers were designed for each defective type ( ccpA The F primer in the defective primer pair dcc2 is shown in SEQ ID NO.2, and the R primer is shown in SEQ ID NO.3; ccpA The F primer in the defective primer pair dcc8 is shown as SEQ ID NO.4, and the R primer is shown as SEQ ID NO.5; the F primer in the wild-type primer pair Ycc1 is shown as SEQ ID NO.6, and the R primer is shown as SEQ ID NO.7; the F primer in the wild-type primer pair Ycc2 is shown as SEQ ID NO.8, and the R primer is shown as SEQ ID NO.9). The above four primer pairs were used to perform conventional three-step PCR procedures (Taq enzyme, PCR reaction system see Table 1, amplification procedure see Table 2) to respectively amplify Lactobacillus rhamnosus hsryfm 1301 and its ccpA The defective type was amplified. The PCR product was subjected to agarose gel electrophoresis. The results are as follows Figure 2 As shown, the wild-type counting primer pair Y1 and Y2 could not amplify bands in the defective strain, but amplified the expected bands in the wild type; the defective counting primer pair d2 and d8 amplified the expected bands in both the defective type (about 250 bp) and the wild type (about 1200 bp), indicating that the designed primer positions were correct. Table 1 PCR reaction system

[0028] Table 2 Three-step PCR amplification procedure

[0029]

[0030] Note: *Annealing temperature is determined by different primers (2) Counting program selection like Figure 2As shown in Figure 2, although the recommended amplification speed of Taq enzyme is 1 Kb / min, when the extension time is 20 s, the defective counting primer pair can amplify from the wild type to the band, indicating that qPCR counting is not possible at this time. The extension time was reduced to 15 s (amplification results are shown in Figure 2). Figure 3 ), 10 s (amplification results see Figure 4 ) and 5 s (amplification results see Figure 5 ), the defective counting primer pair was still able to amplify the wild-type band, indicating that the three-step method could not achieve selective counting by limiting the extension time.

[0031] Then, a two-step PCR method combining annealing and extension was selected for amplification (see Table 3 for amplification program), and the annealing-extension time was selected as 15 s (see Table 3 for amplification results). Figure 6 ), 10 s (amplification results see Figure 7 ), 5 s (amplification results see Figure 8 ). Comparing the electrophoresis results at different annealing times, the defective counting primer pairs d2 and d8 were unable to amplify the wild-type bands, which confirmed that the two-step method was promising for selective counting. Based on the band clarity, the primer pair d2 was selected as the defective-type specific counting primer, and Y2 was selected as the wild-type specific counting primer. Table 3 Two-step PCR amplification procedure

[0032]

[0033] (3) Standard plasmid construction The wild type of Lactobacillus rhamnosus hsryfm 1301 and ccpA The defective type was amplified by the d2 primer pair (d2-F: CCtTAAAACtCGCtGCtGGC; d2-R: TCGTCtATGCtTGCtTGGCA) and connected to the T vector pMD19-T (Baoriyi Biotechnology (Beijing) Co., Ltd.) to construct recombinant plasmids. Ecor I (Baoriyi Biotechnology (Beijing) Co., Ltd.) linearized recombinant plasmid and recovered by gel excision. The nucleic acid concentration of the standard plasmid was adjusted to 15 ng / μL and gradient dilution was performed. The number of standard plasmids in each gradient sample was calculated according to the molecular weight.

[0034] (4) Determination of two-step qPCR extension time According to the PCR results (see Figures 2 to 5 ), when using the three-step method, the d2 primer pair can also amplify the wild-type fragment with the shortest extension time; Figures 6 to 8As shown, when the annealing time was 5 s, 10 s, and 15 s, the wild-type strain 1301 did not amplify a band larger than 1 Kb. Therefore, this example explored the use of two-step qPCR (reaction system see Table 4, amplification program see Table 5) to distinguish and count the two strains. Table 4 qPCR reaction system

[0035] Table 5 Two-step qPCR amplification procedure

[0036]

[0037] The wild type also has the d2 primer pair region, which differs from the defective type in that its amplification length is longer. This example achieves the distinction between wild type and defective strains by adjusting the annealing-extension time. A series of qPCR experiments were performed on the standard plasmids of the two strains using primer d2, and the annealing-extension time was set to 5-60 s, with a gradient increase of 5 s. The results are shown in Figure 2. Figures 9 to 20 As shown, ccpA The defective standard plasmid can obtain an amplification curve under the conditions of 5-60 s. The standard curve of fluorescent quantitative PCR requires a slope range of -3.1~-3.59 (amplification efficiency between 90%~110%). When the annealing temperature is 5-15 s, the defective amplification efficiency is lower than 90% or higher than 110%, and the stability is low (see Figures 9 to 11 ). When the annealing temperature is 20s, Lactobacillus rhamnosus ccpA The counting curve equation of the defective plasmid is y = -3.4677x + 45.798, and the correlation coefficient R 2 =0.9979, the amplification efficiency is moderate (see Fig.12 ). When the annealing temperature is 25s, Lactobacillus rhamnosus ccpA The counting curve equation of the defective plasmid is y=-3.4403x+45.478, and the correlation coefficient R 2 =0.9993, the amplification efficiency is moderate, and the linear relationship is good (see Fig.13 ). When the annealing temperature is 30s, Lactobacillus rhamnosus ccpA The counting curve equation of the defective plasmid is y=-3.5073x+44.505, and the correlation coefficient R 2 =0.9944, the amplification efficiency is moderate (see Fig.14 ). When the annealing temperature is 35s, Lactobacillus rhamnosus ccpA The counting curve equation of the defective plasmid is y=-3.5553x+45.224, and the correlation coefficient R 2 =0.996, the amplification efficiency is moderate (see Fig.15When the annealing temperature is 40-60 s, the amplification efficiency of the defective standard plasmid is too high and the correlation coefficient decreases (see Figures 16 to 20 ).like Figure 21 to Figure 27 As shown in Figure 2, from annealing-extension time 5s to 35s, the wild-type standard plasmid was in a state of no amplification. Slight amplification began to occur from 40s (see Fig.28 ), at which point the maximum amplification speed is 30 bp / s.

[0038] The counting curves of the defective standard plasmid were qualified when the annealing-extension time was 20 s, 30 s, and 35 s, among which the Ct value at 20 s was relatively close and stable. Using the Y2 primer pair (Y2-F: GAGGCGACCAGACGATTGAT; Y2-R: CtGTCAATCCGTGCCCCATA), the wild type and defective type of Lactobacillus rhamnosus hsryfm 1301 were tested under the conditions of two-step qPCR (annealing-extension time 20 s), as shown in Figure 2. Fig.33 and Fig.34 As shown, Y2 exhibits specificity for wild type, ccpA The defective type is in a non-amplifiable state. Therefore, 60℃ annealing-extension for 20 s is the key to distinguish between Lactobacillus rhamnosus hsRYFM1301 and ccpA Defective feasible time.

[0039] In summary, the annealing-extension time can be adjusted to achieve the target of Lactobacillus rhamnosus. ccpA Completely knock out the specific count of the defective strain. The F primer of the defective primer pair is designed in the upstream region of the target gene, and the R primer is designed in the downstream region of the target gene. The length of the amplified sequence of the primer pair in the defective type is between 100-300 bp; a two-step qPCR program is used, with an annealing-extension temperature of 60 ℃ and a time of 20-35 s.

[0040] For the defective types of other genes, a two-step qPCR procedure was used with an annealing-extension temperature of 60 °C and a time of 20-X s, where X was no greater than the wild-type amplification length (bp) / 30 (bp / s). Example 2

[0041] (1) Selection and counting of Lactobacillus rhamnosus hsryfm 1301 and its defective strains in MRS medium Lactobacillus rhamnosus hsryfm 1301 and its ccpA After 24 h of activation, the defective type was inoculated into MRS medium at a 2% inoculum and divided into three groups. One group was inoculated with only the wild type, the second group was inoculated with only the defective type, and the third group was inoculated with both the wild type and the defective type. 。The inoculated culture medium was placed in a 37℃ culture medium for 8, 16, and 24 h. The bacterial solution was diluted 10 times with physiological saline, 1 mL was taken in a 1.5mL centrifuge tube, and the bacteria were collected by centrifugation at 10000 rpm for 5 min. Lysozyme (Sangon Biotechnology, 20 mg / mL) was added and the mixture was incubated in a water bath at 37℃ for 2 h. DNA was extracted according to the instructions of the kit (Tiangen Biochemical Bacterial Genomic DNA Extraction Kit). In the last step of extraction, 100 μL of sterile water (sterile deionized water) was added to dissolve the extracted DNA, and the DNA was diluted 100 times as a template for qPCR. The qPCR selected a two-step method of 60℃ annealing-extension for 20 s, and the primers used were d2 and Y2 primer pairs, respectively. The number of bacteria in each sample was calculated according to the standard curve. The standard curves for both the defective and wild types were y=-ax+b, where the defective primer counted the defective type and the wild type primer counted the wild type; the counted samples could be pure bacterial samples or mixed samples. Specifically, a standard curve is drawn with the Lg value of the counting plasmid concentration as the horizontal axis and the Ct value as the vertical axis, and y=-ax+b is obtained. Then .

[0043] like Fig.35 As shown, when mixed cultured in MRS medium, the wild type had a significant inhibitory effect on the growth of the defective type, with the growth amount being approximately one-fifth of that in single culture; while the defective type had no significant inhibitory effect on the wild type.

[0044] (2) Selection and enumeration of Lactobacillus rhamnosus hsryfm 1301 and its defective strains in skim milk Lactobacillus rhamnosus hsryfm 1301 and its ccpAThe defective type was inoculated into different MRS culture media at a 2% inoculation rate for 24 h, then the bacteria were washed with saline and inoculated into skim milk at a 2% inoculation rate, and divided into three groups, one of which was inoculated with only the wild type, the second was inoculated with only the defective type, and the third was inoculated with both the wild type and the defective type. The inoculated skim milk was placed in a 37°C incubator for 12 h, 24 h, and 36 h. The fermented skim milk was diluted 10 times with pH 8.0 PBS solution, 1 mL was taken in a 1.5 mL centrifuge tube, and the cells were collected by centrifugation at 10,000 rpm for 15 min. Then, it was diluted 10 times with physiological saline, 1 mL was taken in a 1.5 mL centrifuge tube, and 100× mixed protease (flavor protease: Flavourzyme 1000L (HPN00600) of Novozymes, Denmark, neutral protease: Neutrase0.8L (PWN10251) of Novozymes, Denmark, alkaline protease: Alcalase 2.4L FG (PLN05570) of Novozymes, Denmark) was added. The cells were collected by centrifugation at 10,000 rpm for 10 min in a 45°C water bath for 2 h. After adding TE buffer, the cells were inactivated by water bath at 90°C for 10 min, and then placed on ice to quickly cool to room temperature. After adding lysozyme, the cells were incubated at 37°C for 2 h. DNA was extracted according to the instructions of the kit (Tiangen Biochemical Bacterial Genomic DNA Extraction Kit). At the last step of extraction, 100 μL of sterilized water was added to dissolve the extracted DNA and diluted 10 times as a template for qPCR. The qPCR selected a two-step method of 60°C annealing-extension for 20 s, and the primers used were d2 and Y2 primer pairs. The number of bacteria in each sample was calculated based on the standard curve.

[0045] like Fig.36 As shown, when mixed cultured in skim milk, the inhibitory effect between the wild type and the defective type was comparable. As the culture time increased, the growth of the mixed culture was approximately half of that of the individual cultures.

[0046] In addition, the growth of wild-type and defective strains in skim milk was about 20 times different from that in culture medium (CFU was close), as shown by microscopic examination (see Figures 37 to 40 ) found that the average chain length of each cell in the culture medium is about 7-10 times that in skim milk. Therefore, the counting result is more accurate.

[0047] The present invention designs nested primers for gene knockout region, uses two-step qPCR, and controls the annealing-extension time of primers to knock out Lactobacillus rhamnosus hsryfm 1301 ccpA Defective type can be selectively counted. The present invention can selectively count the mixed cultured wild type and defective type in common MRS culture medium and skim milk.

[0048] The above description is only a specific implementation of the present invention, but the protection scope of the present invention is not limited thereto. Any person familiar with the technology can understand and think of any changes or substitutions within the technical scope disclosed by the present invention, which should be included in the scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. A method for selecting and counting lactic acid bacteria with complete gene knockout defects, characterized in that: The following steps are involved: Step 1: design nested primers for the knockout region of the bacteria to be counted, use the DNA of the knockout defective bacteria to be counted as a template to amplify specific fragments, construct a defective strain counting vector, and draw a defective strain standard curve; Step 2: extract the genomic DNA of the bacteria to be counted as a template, control the annealing extension time of the two-step qPCR, use the nested primers of the knockout region to perform two-step qPCR amplification, and count the complete knockout defective type of the bacteria to be counted.

2. The method for selecting and counting lactic acid bacteria with complete gene knockout defects according to claim 1, characterized in that: In the step 1, the upstream primer of the gene knockout region nested primer is designed in the upstream region of the gene knockout region, and the downstream primer is designed in the downstream region of the gene knockout region.

3. The method for selecting and counting lactic acid bacteria with complete gene knockout defects according to claim 1, characterized in that: In step 2, the annealing extension time of the two-step qPCR is 20-X s, where X≤wild-type amplification length / 30.

4. A lactic acid bacterium according to any one of claims 1 to 3. ccpA A method for selecting and counting a gene complete knockout defective type, characterized in that: The following steps are involved: (1) Design of Lactobacillus rhamnosus ccpA Gene complete knockout defective counting primers; (2) Lactobacillus rhamnosus ccpA The gene-defective genomic DNA was used as a template, and the standard curve was constructed using complete knockout defective counting primers; (3) Extract sample DNA, control the annealing extension time of the two-step qPCR, and use defective counting primers to quantify Lactobacillus rhamnosus. ccpA Complete gene knockout defective types were selectively counted.

5. A lactic acid bacteria according to claim 4 ccpA A method for selecting and counting a gene complete knockout defective type, characterized in that: In the step (1), Lactobacillus rhamnosus ccpA The length of the counting primers for complete gene knockout defect type is 18-25bp, and the length of the amplified sequence is 100-300 bp.

6. A lactic acid bacterium according to claim 4 ccpA A method for selecting and counting a gene complete knockout defective type, characterized in that: In the step (1), Lactobacillus rhamnosus ccpA The counting primers for complete gene knockout defect type are F:CCTTAAAACTCGCTGCTGGC; R:TCGTCTATGCTTGCTTGGCA.

7. A lactic acid bacteria according to claim 4 ccpA A method for selecting and counting a gene complete knockout defective type, characterized in that: In step (3), the annealing extension time of the two-step qPCR is 20-35 s and the temperature is 60°C.

8. A method for selecting and counting wild-type lactic acid bacteria genes as claimed in claim 1, characterized in that: In the step 1, a wild-type counting primer is designed within the defective deletion gene, a special vector for distinguishing wild-type strains is constructed, and a standard curve of wild-type strains is drawn. The upstream primer and the downstream primer of the wild-type counting primer are both designed in the knockout gene region; in the step 2, the mixed bacterial sample DNA is used as a template, the annealing extension time of the two-step qPCR is controlled, and the wild-type counting primer is used to perform two-step qPCR amplification to distinguish the wild type and the completely knockout defective type of the bacteria to be counted, and the wild type of the bacteria to be counted is counted.

9. A lactic acid bacterium according to claim 9. ccpA A method for selecting and counting wild-type genes, characterized in that: The wild-type Lactobacillus rhamnosus counting primers were F:GAGGCGACCAGACGATTGAT; R:CTGTCAATCCGTGCCCCATA.

Images