Primer probe combination and kit for detecting porcine diarrhea related viruses

Abstract

The invention provides a primer probe combination and a kit for detecting porcine diarrhea related viruses, and belongs to the technical field of virus detection. The combination comprises specific primers and fluorescent probes aiming at a porcine epidemic diarrhea virus (PEDV), a porcine group A rotavirus (PoRV-A), a porcine transmissible gastroenteritis virus (TGEV) and a porcine delta coronavirus (PDCoV). The primer probe combination disclosed by the invention can be used for simultaneously detecting and identifying the four viruses mainly causing porcine diarrhea in one PCR reaction, and has the characteristics of high specificity, high sensitivity, simplicity and convenience in operation, rapidness and high efficiency. Therefore, according to the invention, rapid and accurate detection of porcine diarrhea related viruses can be realized, and disease prevention and control and epidemiological investigation of pig farms can be effectively supported.

Description

Technical Field

[0001] The present invention belongs to the technical field of virus detection, and in particular relates to a primer probe combination and a kit for detecting swine diarrhea-related viruses. Background Art

[0002] Porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus (PDCoV) and porcine group A rotavirus (PoRV-A) are the four main viruses that cause diarrhea in pigs. They can all cause intestinal infectious diseases characterized by diarrhea, vomiting and dehydration, causing serious economic losses to the pig industry.

[0003] PEDV can be divided into classical group and epidemic group. In recent years, the genome structure of PEDV has shown a high variation trend, leading to the emergence of highly pathogenic mutant strains, which reduces the protective effect of commercial vaccines. PEDV, TGEV, and PDCoV belong to the Coronavirus family. The S protein is its main antigenic protein, which plays an important role in virus adsorption, entry into host cells, and induction of neutralizing antibodies. Therefore, the S protein has always been an important target protein for differential diagnosis, vaccine development, and genetic variation analysis of PEDV, TGEV, and PDCoV. Rotavirus has different serogroups and serotypes. According to the VP6 gene, it can be divided into 7 serogroups with different antigenicity, 5 of which can infect pigs. Rotavirus belongs to the double-stranded RNA (dsRNA) virus of the Reoviridae family. Its genome consists of 11 segments of dsRNA, encoding six structural viral proteins (VP1, VP4, VP6 and VP7 and five non-structural proteins (NSP1-NSPS / 6). Rotavirus is divided into 10 groups (A-J) based on the antigenic relationship of its VP6 protein. The most common groups that infect animals are groups A, B and C (RVA, RVB and RVC), among which PoRV-A group has the highest prevalence. From a public health perspective, this is one of the most important causes of acute dehydration diarrhea in piglets.

[0004] At present, the detection of porcine enteric diarrhea viruses mainly includes virus isolation and identification, ELISA antibody detection, ordinary PCR, single and multiplex RT-PCR differential diagnosis methods, etc. Among them, virus isolation and identification is the most accurate method for laboratory virus diagnosis, but its experimental operation is cumbersome, technically demanding and time-consuming, which is not conducive to rapid virus detection and epidemic control during large-scale outbreaks. ELISA antibody detection is prone to false positives due to the influence of autoantibodies. Although ordinary PCR is simple to operate, it takes a long time. At present, there are few patents and detection methods that can simultaneously identify porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus (PDCoV) and porcine group A rotavirus (PoRV-A). Invention patent: Quadruple fluorescent PCR detection kit for porcine viral diarrhea pathogens and its application (application number: 202211602247.1), a detection kit for porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus (PDCoV) and porcine group A rotavirus (PoRV-A) in samples is provided, and its sensitivity reaches a high level. However, when using this kit for detection, RNA needs to be reverse transcribed into DNA first, and then fluorescent amplification is performed for pathogen identification; reverse transcription first and then amplification, the operation steps are complicated and time-consuming. Therefore, establishing a rapid, accurate and sensitive quadruple detection method for identifying porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus (PDCoV) and porcine group A rotavirus (PoRV-A) is of great significance for the differential diagnosis and prevention and control of porcine enteric diarrhea virus. Summary of the invention

[0005] The object of the present invention is to provide a primer-probe combination and a kit for detecting porcine diarrhea-related viruses, thereby realizing the detection and identification of porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus (PDCoV) and porcine group A rotavirus (PoRV-A).

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] First, the present invention provides a primer-probe combination for detecting porcine diarrhea-related viruses, wherein the porcine diarrhea-related viruses are porcine epidemic diarrhea virus PEDV, porcine group A rotavirus PoRV-A, porcine transmissible gastroenteritis virus TGEV, and porcine deltacoronavirus PDCoV;

[0008] The primer-probe combination comprises:

[0009] PEDV primer and PEDV probe combination, PoRV-A primer and PoRV-A probe combination, TGEV primer and TGEV probe combination, and PDCoV primer and PDCoV probe combination;

[0010] The forward primer sequence of the PEDV primer is shown in SEQ ID NO.1;

[0011] The reverse primer sequence of the PEDV primer is shown in SEQ ID NO.2;

[0012] The sequence of the PEDV probe is shown in SEQ ID NO.3;

[0013] The forward primer sequence of the PoRV-A primer is shown in SEQ ID NO.4;

[0014] The reverse primer sequence of the PoRV-A primer is shown in SEQ ID NO.5;

[0015] The sequence of the PoRV-A probe is shown in SEQ ID NO.6;

[0016] The forward primer sequence of the TGEV primer is shown in SEQ ID NO.7;

[0017] The reverse primer sequence of the TGEV primer is shown in SEQ ID NO.8;

[0018] The sequence of the TGEV probe is shown in SEQ ID NO.9;

[0019] The forward primer sequence of the PDCoV primer is shown in SEQ ID NO.10;

[0020] The reverse primer sequence of the PDCoV primer is shown in SEQ ID NO.11;

[0021] The sequence of the PDCoV probe is shown in SEQ ID NO.12.

[0022] Preferably, the 5' end of the PEDV probe is labeled with a FAM group, and the 3' end is labeled with a BHQ1 group;

[0023] The 5' end of the PoRV-A probe is labeled with a VIC group, and the 3' end is labeled with a BHQ1 group;

[0024] The TGEV probe is labeled with a CY5 group at the 5' end and a MGB group at the 3' end;

[0025] The 5' end of the PDCoV probe is labeled with a ROX group, and the 3' end is labeled with a MGB group.

[0026] Preferably, the target gene sequence of the PEDV primer is shown in SEQ ID NO.13;

[0027] The target gene sequence of the PoRV-A primer is shown in SEQ ID NO.14;

[0028] The target gene sequence of the TGEV primer is shown in SEQ ID NO.15;

[0029] The target gene sequence of the PDCoV primer is shown in SEQ ID NO.16.

[0030] Secondly, the present invention provides the use of a primer-probe combination in the preparation of a kit for detecting porcine diarrhea-related viruses, wherein the porcine diarrhea-related viruses are porcine epidemic diarrhea virus PEDV, porcine group A rotavirus PoRV-A, porcine transmissible gastroenteritis virus TGEV and porcine deltacoronavirus PDCoV.

[0031] Secondly, the present invention provides a quadruple fluorescence quantitative PCR kit for simultaneously detecting and identifying porcine epidemic diarrhea virus PEDV, porcine group A rotavirus PoRV-A, porcine transmissible gastroenteritis virus TGEV and porcine deltacoronavirus PDCoV, wherein the quadruple fluorescence quantitative PCR kit comprises the above-mentioned primer probe combination.

[0032] Preferably, when the quadruple fluorescent quantitative PCR kit is used for PCR detection, the reaction system per 25 μL is: 2×One Step U+Mix 12.5 μL, One Step U+Enzyme Mix 2 μL, PEDV forward primer 0.5 μL, PEDV reverse primer 0.5 μL, PEDV probe 0.5 μL; PoRV-A forward primer 0.25 μL, PoRV-A reverse primer 0.25 μL, PoRV-A probe 0.5 μL; TGEV forward primer 0.5 μL, TGEV reverse primer 0.5 μL, TGEV probe 0.5 μL; PDCoV forward primer 0.5 μL, PDCoV reverse primer 0.5 μL, PDCoV probe 0.5 μL, 5 μL detection sample RNA.

[0033] Preferably, the reaction conditions of the quadruple fluorescence quantitative PCR kit for PCR detection are: 52°C for 5 min, pre-denaturation at 95°C for 20 s, denaturation at 95°C for 5 s, annealing and extension at 60°C for 20 s, and a total of 40 cycles of denaturation and annealing and extension.

[0034] Preferably, the detection conditions for the quadruple fluorescent quantitative PCR kit when used for PCR detection are as follows:

[0035] The reading result of the negative control FAM channel was No Ct, the reading result of the VIC / HEX channel was No Ct, the reading result of the CY5 channel was No Ct, and the reading result of the ROX channel was No Ct;

[0036] Meanwhile, the reading result of the FAM channel of the positive control was Ct≤30, the reading result of the VIC / HEX channel was Ct≤30, the reading result of the CY5 channel was Ct≤30, and the reading result of the ROX channel was Ct≤30.

[0037] Preferably, when the quadruple fluorescent quantitative PCR kit is used for PCR detection, the criteria for determining the detection results are as follows:

[0038] When the reading result of the FAM channel of the test sample is Ct≤40, and the test curve has an obvious exponential growth, showing a typical S-shaped curve, the test result is judged to be positive and the PEDV virus is detected in the test sample;

[0039] When the reading result of the VIC / HEX channel of the test sample is Ct≤40, and the test curve has an obvious exponential growth, showing a typical S-shaped curve, the test result is judged to be positive and PoRV-A virus is detected in the test sample;

[0040] When the reading result of the CY5 channel of the test sample is Ct≤40, and the test curve has an obvious exponential growth, showing a typical S-shaped curve, the test result is judged to be positive and TGEV virus is detected in the test sample;

[0041] When the reading result of the ROX channel of the test sample is Ct≤40, and the test curve has an obvious exponential growth, showing a typical S-shaped curve, the test result is judged to be positive and the PDCoV virus is detected in the test sample;

[0042] When the reading results of the FAM channel, VIC / HEX channel, CY5 channel and ROX channel of the test sample are all No Ct or Ct value>40, the test result is judged to be negative and PEDV, PoRV-A, TGEV and PDCoV viruses are not detected in the test sample.

[0043] Secondly, the present invention provides a method for detecting and identifying porcine epidemic diarrhea virus PEDV, porcine group A rotavirus PoRV-A, porcine transmissible gastroenteritis virus TGEV and porcine deltacoronavirus PDCoV for non-diagnostic purposes, the detection and identification method comprising the following steps:

[0044] (1) Obtaining RNA of test samples;

[0045] (2) preparing reagents according to the above reaction system;

[0046] (3) performing a PCR reaction according to the above reaction conditions;

[0047] (4) determining whether the test result is established according to the above test establishment conditions;

[0048] (5) After the test result is determined to be established, the test result is determined according to the above-mentioned test result determination criteria.

[0049] The beneficial effects of the present invention are:

[0050] 1. The primer-probe combination provided by the present invention can efficiently and specifically identify and amplify the target gene sequences of porcine epidemic diarrhea virus (PEDV), porcine group A rotavirus (PoRV-A), porcine transmissible gastroenteritis virus (TGEV) and porcine deltacoronavirus (PDCoV). Through precise design and verification, it is ensured that the fluorescent signals of each virus have no cross-reaction, which significantly improves the specificity and sensitivity of the detection.

[0051] 2. This primer-probe combination and kit can simultaneously detect and identify four major viruses that cause swine diarrhea through a single PCR reaction, greatly simplifying the experimental operation steps, saving time and resources, and improving detection efficiency.

[0052] 3. The quadruple fluorescent quantitative PCR kit of the present invention saves the step of reverse transcription, so that the detection can be completed in a shorter time. Compared with traditional virus isolation and identification methods, the detection time is greatly shortened, which is conducive to rapid response to large-scale epidemic outbreaks.

[0053] 4. The real-time fluorescence quantitative PCR method developed in the present invention has good repeatability and reliability, and exhibits a low coefficient of variation in both intra-group and inter-group experiments, thus ensuring the stability of the experimental results.

[0054] Through the above advantages, the primer-probe combination and the kit of the present invention will significantly improve the detection efficiency and accuracy of porcine diarrhea-related viruses, which is of great significance to the healthy development of the pig industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 A standard curve diagram of porcine epidemic diarrhea virus detected using the quadruple fluorescent quantitative PCR detection method provided by the present invention;

[0056] Figure 2 A standard curve diagram of porcine group A rotavirus detected using the quadruple fluorescence quantitative PCR detection method provided by the present invention;

[0057] Figure 3 A standard curve diagram of porcine transmissible gastroenteritis virus detected by the quadruple fluorescence quantitative PCR detection method provided by the present invention;

[0058] Figure 4 A standard curve diagram of porcine deltacoronavirus detected using the quadruple fluorescent quantitative PCR detection method provided by the present invention;

[0059] Figure 5 The figure is an amplification curve of porcine epidemic diarrhea virus detected by the quadruple fluorescent quantitative PCR detection method provided by the present invention;

[0060] Figure 5 From left to right, 1×10 9 , 1×10 8 , 1×10 7 , 1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 , amplification curve of 1 copy / μL porcine epidemic diarrhea virus plasmid standard;

[0061] Figure 6 The figure is an amplification curve of porcine group A rotavirus detected by the quadruple fluorescent quantitative PCR detection method provided by the present invention;

[0062] Figure 6 From left to right, 1×10 9 , 1×10 8 , 1×10 7 , 1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 , amplification curve of 1 copy / μL porcine group A rotavirus plasmid standard;

[0063] Figure 7 The amplification curve of porcine transmissible gastroenteritis virus detected by the quadruple fluorescence quantitative PCR detection method provided by the present invention;

[0064] Figure 7 From left to right, 1×10 9 , 1×10 8 , 1×10 7 , 1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×101 , amplification curve of 1 copy / μL porcine transmissible gastroenteritis virus plasmid standard;

[0065] Figure 8 This is an amplification curve diagram of porcine deltacoronavirus detected using the quadruple fluorescent quantitative PCR detection method provided by the present invention;

[0066] Figure 8 From left to right, 1×10 9 , 1×10 8 , 1×10 7 , 1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 , amplification curve of 1 copy / μL porcine delta coronavirus plasmid standard;

[0067] Fig. 9 This is a graph showing the specific detection results of the quadruple fluorescence quantitative PCR detection method provided by the present invention;

[0068] Fig. 9 In the figure, from top to bottom are porcine deltacoronavirus (PDCoV) plasmid standards, porcine transmissible gastroenteritis virus (TGEV) plasmid standards, porcine group A rotavirus (PoRV-A) plasmid standards, and porcine epidemic diarrhea virus (PEDV) plasmid standards. DETAILED DESCRIPTION

[0069] In order to have a clearer understanding of the technical features, purposes and beneficial effects of the present invention, the technical scheme of the present invention is described in detail below in conjunction with specific embodiments. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. In the embodiments, each raw reagent material can be commercially obtained, and the experimental method without specifying the specific conditions is a conventional method and conventional conditions well known in the art, or according to the conditions recommended by the instrument manufacturer.

[0070] Example 1

[0071] Design and synthesis of primer and probe combinations for quadruple real-time quantitative PCR assays

[0072] By downloading and comparing the M protein gene of porcine epidemic diarrhea virus (PEDV), the VP6 protein gene of porcine group A rotavirus (PoRV-A), the N protein gene of porcine transmissible gastroenteritis virus (TGEV), and the N protein gene of porcine deltacoronavirus (PDCoV) from GenBank, appropriate regions were selected and specific primers and probes capable of identifying PEDV, PoRV-A, TGEV, and PDCoV were designed using Primer Express 3.0.1 software:

[0073] PEDV forward primer: GGACACATTCTTGGTGGTCC, SEQ ID NO.1;

[0074] PEDV reverse primer: CGTTACACCAGTTGGTGCTC, SEQ ID NO. 2;

[0075] PEDV probe: FAM-TGCAGATCTGTCGGCCCATCACAG-BHQ1, SEQ ID NO. 3;

[0076] PoRV-A forward primer: ATCTGCAGTTTGTGAATCTG, SEQ ID NO. 4;

[0077] PoRV-A reverse primer: GGTATTGCATACTCTTGACG, SEQ ID NO.5;

[0078] PoRV-A probe: VIC-AAGTTTCTGAAGCATCCGCAAGCA-BHQ1, SEQ ID NO.6;

[0079] TGEV forward primer: ATGGAGCTAGAAGCAGTTCA, SEQ ID NO. 7;

[0080] TGEV reverse primer: CCAGTTGTGGGTAATGCTTG, SEQ ID NO. 8;

[0081] TGEV probe: CY5-GCTCCCATTGGCAACGAGGTCAGT-MGB, SEQ ID NO. 9;

[0082] PDCoV forward primer: TTAACTCCAGAGGCACAGGC, SEQ ID NO.10;

[0083] PDCoV reverse primer: GTAAAGTCCGCTTGGGAGCT, SEQ ID NO.11;

[0084] PDCoV probe: ROX-CGTACCGCAGCGGGTGCAGATTGG-MGB, SEQ ID NO.12.

[0085] Example 2

[0086] Preparation of recombinant plasmid standards

[0087] PEDV-M protein gene target gene sequence:

[0088] GATGCATGGGCTAGCTTTCAGGTCAATTGGGTCTTTTTTGCTTTCAGCATCCTTATGGCTTGCATCACTCTTATGCTGTGGATAATGTACTTTGTCAACAGCATTCGGTTGTGGCGCAGGACACATTCTTGGTGGT CCTTCAATCCTGAAACAGACGCGCTTCTCACTACTTCTGTGATGGGCCGACAGATCTGCATTCCAGTGCTTGGAGCACCAACTGGTGTAACGCTAACACTCCTTAGTGGTACATTGCTTGTAGAGGGCTATAA, SEQ ID NO.13;

[0089] PoRV-A-VP6 protein gene target gene sequence:

[0090] ACGATGCGCATTGAATCTGCAGTTTGTGAATCTGTGCTTGCGGATGCTTCAGAAACTTTATTGGCAAATGTGACCTCGGTACGTCAAGAGTATGCAATACCAGTAGGACCAGTATTTCCACCAGGTATGAATTGGACA GAATTAATTACCAATTATTCACCTTCAAGAGAAGATAACTTGCAACGTGTTTTTACAGTAGCTTCCATTAGAAGCATGTTGATTAAGTGAGGACTAGGCTAACTACCTGGTATCCGATCTTAACCAGCATGTAA,SEQ ID NO.14;

[0091] TGEV-N protein gene target gene sequence:

[0092] AAGCTGTTCTTGCCGCACTTAAAAAGTTAGGTGTTGACACAGAAAAACAACAGCAACGCTCTCGTTCTAAATCTAAAGAACGTAGTAACTCTAAGACAAGAGATACTACACCTAAGAATGAAAACAAACACACC TGGAAGAGAACTGCAGGTAAAGGTGATGTGACAAGATTTTATGGAGCTAGAAGCAGTTCAGCCAATTTTGGTGACACTGACCTCGTTGCCAATGGGAGCAGTGCCAAGCATTACCCACAACTGGCTGAAT, SEQ. ID NO.15;

[0093] PDCoV-N protein gene target gene sequence:

[0094] AGCTCAAGGTTTTTAGAGTTGACCCCTTCAACGCTAGAGGAAGACCTCAGGAGCGTGGAAGTGGCCCAAGATCTCAATCTGTTAACTCCAGAGGCACAGGCAATCAGCCTAGGAAACGCGACCAATCTGCACCCGCTGCGGTACGTCGTAAGACCCAACATCAAGTCCCCAAGCGGACTTTACCCAAGGGTAAAACCATTTCCCAAGTATTTGGCAACCGGTCTCGTACTGGTGCCAATGTCG, SEQ ID NO.16.

[0095] The fragments containing the target genes of PEDV, PoRV-A, TGEV and PDCoV were synthesized by Sangon Biotechnology Co., Ltd. and ligated into the pUC57 vector to obtain the positive plasmids of PEDV, PoRV-A, TGEV and PDCoV.

[0096] Example 3

[0097] Reaction system and reaction conditions of quadruple real-time fluorescence quantitative PCR

[0098] The 25 μL reaction system for the quadruple real-time quantitative PCR is as follows:

[0099] 2×One Step U +Mix 12.5μL, One Step U+Enzyme Mix 2μL, PEDV forward primer 0.5μL, PEDV reverse primer 0.5μL, PEDV probe 0.5μL; PoRV-A forward primer 0.25μL, PoRV-A reverse primer 0.25μL, PoRV-A probe 0.5μL; TGEV forward primer 0.5μL, TGEV reverse primer 0.5μL, TGEV probe 0.5μL; PDCoV forward primer 0.5μL, PDCoV reverse primer 0.5μL, PDCoV probe 0.5μL, 5μL sample RNA to be tested;

[0100] The reaction conditions for the quadruple real-time quantitative PCR were:

[0101] 52℃ for 5min, pre-denaturation at 95℃ for 20s, denaturation at 95℃ for 5s, annealing and extension at 60℃ for 20s, a total of 40 cycles of denaturation and annealing and extension.

[0102] Example 4

[0103] Judgment criteria for quadruple real-time fluorescence quantitative PCR

[0104] (1) After the PCR reaction is completed, the corresponding Ct value is read by the software of the fluorescence quantitative PCR instrument to determine whether the sample is positive or negative;

[0105] (2) The conditions for the RT-PCR reaction are as follows:

[0106]

[0107] Meanwhile, the positive control showed a clear exponential growth, showing a typical S-shaped curve;

[0108] (3) The test results of the samples to be tested are determined as follows:

[0109] The sample FAM channel Ct≤40, with obvious exponential growth and a typical S-shaped curve, was judged as positive, indicating that PEDV nucleic acid was detected in the sample;

[0110] The sample VIC / HEX channel Ct≤40, with obvious exponential growth and a typical S-shaped curve, was judged as positive, indicating that PoRV-A nucleic acid was detected in the sample;

[0111] The sample CY5 channel Ct≤40, with obvious exponential growth and a typical S-shaped curve, was judged as positive, indicating that TGEV nucleic acid was detected in the sample;

[0112] The sample ROX channel Ct≤40, with obvious exponential growth and a typical S-shaped curve, was judged as positive, indicating that PDCoV nucleic acid was detected in the sample;

[0113] The sample test results had no Ct value or a Ct value greater than 40 and were judged to be negative, indicating that PEDV, PoRV-A, TGEV, and PDCoV nucleic acids were not detected in the sample.

[0114] Example 5

[0115] Establishment of standard curves for PEDV, PoRV-A, TGEV, and PDCoV positive plasmids

[0116] The PEDV, PoRV-A, TGEV and PDCoV positive plasmids obtained in Example 2 were concentrated according to the following concentration gradient: 1×10 9 , 1×10 8 , 1×10 7 , 1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 , 1 copies / μL, using the primers and probes in Example 1, the reaction system and reaction conditions given in Example 3 to perform fluorescence quantitative PCR detection, and establish a standard curve.

[0117] The results are as follows Figure 1-Figure 4 As shown, from Figure 1 and Figure 4 It can be seen from the results that the four positive plasmids all have standard curves and amplification curves, indicating that the primers and probes provided by the present invention can successfully identify and amplify the target DNA sequence, verifying the effectiveness of the detection system of the present invention.

[0118] Example 6

[0119] Sensitivity testing of quadruple real-time quantitative PCR

[0120] The PEDV, PoRV-A, TGEV and PDCoV positive plasmids obtained in Example 2 were concentrated according to the following concentration gradient: 1×10 9 , 1×10 8 , 1×10 7 , 1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 , 1 copies / μL, using the primers and probes in Example 1, the reaction system and reaction conditions given in Example 3 to perform fluorescence quantitative PCR detection, and obtain Figures 5 to 8 Amplification curve.

[0121] from Figure 5-Figure 8 It can be seen from the results that the four positive plasmids all have amplification curves under different concentration gradients, and the lower limit of detection is 1 copies / μL, indicating that the real-time fluorescence quantitative PCR established in the present invention has excellent sensitivity.

[0122] Example 7

[0123] Specific detection of real-time fluorescence quantitative PCR

[0124] The nucleic acids of porcine reproductive and respiratory syndrome virus (PRRSV), classical swine fever virus (CSFV), porcine circovirus type 2 (PCV2) and pseudorabies virus (PRV) were extracted using a nucleic acid extraction kit as templates for fluorescence quantitative PCR detection using the primers and probes in Example 1, the reaction system and reaction conditions given in Example 3, and positive and negative controls were set at the same time.

[0125] The results are as follows Fig. 9 As shown, from Fig. 9 It can be seen that only the positive control showed an obvious amplification curve, while other porcine-derived viruses and the negative control had no amplification curve, indicating that the real-time fluorescence quantitative PCR established in the present invention has good specificity.

[0126] Example 8

[0127] Repeatability testing of real-time fluorescence quantitative PCR

[0128] Four standard plasmids with known concentrations (1E6 copies / μL, 1E4 copies / μL, and 1E2 copies / μL) were used as templates and the test was repeated 6 times on the same day to verify the intra-group repeatability of real-time fluorescence quantitative PCR; the operation was performed 3 times at different times to verify the inter-group repeatability of real-time fluorescence quantitative PCR.

[0129] Table 1 Repeatability of fluorescence quantitative PCR method

[0130]

[0131]

[0132] The results obtained are shown in Table 1. The results in Table 1 show that the method has good intra-group and inter-group repeatability, and the coefficient of variation is between 0.46% and 1.27%, both less than 2%, indicating that the real-time fluorescence quantitative PCR established in the present invention has good repeatability.

[0133] Example 9

[0134] Real-time fluorescence quantitative PCR test sample detection

[0135] Serum samples, tissue samples and secretion cotton swabs of infected pigs were collected respectively, and viral RNA was extracted according to the instructions of nucleic acid extraction kits respectively. The quadruple real-time fluorescence quantitative PCR detection method established by the present invention was used to detect them respectively.

[0136] Table 2 Results of samples tested by fluorescence quantitative PCR method

[0137]

[0138]

[0139] As can be seen from Table 2, the method of the present invention is a fluorescent quantitative PCR detection method that can sensitively, quickly, accurately and specifically identify and detect PEDV, PoRV-A, TGEV and PDCoV in samples such as blood, tissue and secretion cotton swabs.

Claims

1. A primer-probe combination for detecting porcine diarrhea-related viruses, characterized in that: The porcine diarrhea-related viruses are porcine epidemic diarrhea virus PEDV, porcine group A rotavirus PoRV-A, porcine transmissible gastroenteritis virus TGEV and porcine deltacoronavirus PDCoV; The primer-probe combination comprises: PEDV primer and PEDV probe combination, PoRV-A primer and PoRV-A probe combination, TGEV primer and TGEV probe combination, and PDCoV primer and PDCoV probe combination; The forward primer sequence of the PEDV primer is shown in SEQ ID NO.1; The reverse primer sequence of the PEDV primer is shown in SEQ ID NO.2; The sequence of the PEDV probe is shown in SEQ ID NO.3; The forward primer sequence of the PoRV-A primer is shown in SEQ ID NO.4; The reverse primer sequence of the PoRV-A primer is shown in SEQ ID NO.5; The sequence of the PoRV-A probe is shown in SEQ ID NO.6; The forward primer sequence of the TGEV primer is shown in SEQ ID NO.7; The reverse primer sequence of the TGEV primer is shown in SEQ ID NO.8; The sequence of the TGEV probe is shown in SEQ ID NO.9; The forward primer sequence of the PDCoV primer is shown in SEQ ID NO.10; The reverse primer sequence of the PDCoV primer is shown in SEQ ID NO.11; The sequence of the PDCoV probe is shown in SEQ ID NO.

12.

2. The primer-probe combination according to claim 1, characterized in that: The 5' end of the PEDV probe is labeled with a FAM group, and the 3' end is labeled with a BHQ1 group; The 5' end of the PoRV-A probe is labeled with a VIC group, and the 3' end is labeled with a BHQ1 group; The TGEV probe is labeled with a CY5 group at the 5' end and a MGB group at the 3' end; The 5' end of the PDCoV probe is labeled with a ROX group, and the 3' end is labeled with a MGB group.

3. The primer-probe combination according to claim 1, characterized in that: The target gene sequence of the PEDV primer is shown in SEQ ID NO.13; The target gene sequence of the PoRV-A primer is shown in SEQ ID NO.14; The target gene sequence of the TGEV primer is shown in SEQ ID NO.15; The target gene sequence of the PDCoV primer is shown in SEQ ID NO.

16.

4. Use of the primer-probe combination according to any one of claims 1 to 3 in preparing a kit for detecting porcine diarrhea-related viruses, characterized in that: The porcine diarrhea-related viruses are porcine epidemic diarrhea virus PEDV, porcine group A rotavirus PoRV-A, porcine transmissible gastroenteritis virus TGEV and porcine deltacoronavirus PDCoV.

5. A quadruple fluorescence quantitative PCR kit for simultaneous detection and identification of porcine epidemic diarrhea virus PEDV, porcine group A rotavirus PoRV-A, porcine transmissible gastroenteritis virus TGEV and porcine deltacoronavirus PDCoV, wherein: The quadruple fluorescent quantitative PCR kit comprises the primer-probe combination according to claim 1 or 2.

6. The quadruple fluorescence quantitative PCR kit according to claim 5, characterized in that: When the quadruple fluorescent quantitative PCR kit is used for PCR detection, the reaction system per 25 μL is: 2×One Step U+Mix 12.5 μL, One Step U+Enzyme Mix 2 μL, PEDV forward primer 0.5 μL, PEDV reverse primer 0.5 μL, PEDV probe 0.5 μL; PoRV-A forward primer 0.25 μL, PoRV-A reverse primer 0.25 μL, PoRV-A probe 0.5 μL; TGEV forward primer 0.5 μL, TGEV reverse primer 0.5 μL, TGEV probe 0.5 μL; PDCoV forward primer 0.5 μL, PDCoV reverse primer 0.5 μL, PDCoV probe 0.5 μL, and 5 μL detection sample RNA.

7. The quadruple fluorescence quantitative PCR kit according to claim 6, characterized in that: The reaction conditions of the quadruple fluorescence quantitative PCR kit for PCR detection are: 52°C for 5 min, pre-denaturation at 95°C for 20 s, denaturation at 95°C for 5 s, annealing and extension at 60°C for 20 s, and a total of 40 cycles of denaturation and annealing and extension.

8. The quadruple fluorescence quantitative PCR kit according to claim 7, characterized in that: The detection conditions for the quadruple fluorescent quantitative PCR kit when used for PCR detection are as follows: The reading result of the negative control FAM channel was No Ct, the reading result of the VIC / HEX channel was No Ct, the reading result of the CY5 channel was No Ct, and the reading result of the ROX channel was No Ct; Meanwhile, the reading result of the FAM channel of the positive control was Ct≤30, the reading result of the VIC / HEX channel was Ct≤30, the reading result of the CY5 channel was Ct≤30, and the reading result of the ROX channel was Ct≤30.

9. The quadruple fluorescence quantitative PCR kit according to claim 8, characterized in that: When the quadruple fluorescent quantitative PCR kit is used for PCR detection, the criteria for determining the detection results are as follows: When the reading result of the FAM channel of the test sample is Ct≤40, and the test curve has an obvious exponential growth, showing a typical S-shaped curve, the test result is judged to be positive and the PEDV virus is detected in the test sample; When the reading result of the VIC / HEX channel of the test sample is Ct≤40, and the test curve has an obvious exponential growth, showing a typical S-shaped curve, the test result is judged to be positive and PoRV-A virus is detected in the test sample; When the reading result of the CY5 channel of the test sample is Ct≤40, and the test curve has an obvious exponential growth, showing a typical S-shaped curve, the test result is judged to be positive and TGEV virus is detected in the test sample; When the reading result of the ROX channel of the test sample is Ct≤40, and the test curve has an obvious exponential growth, showing a typical S-shaped curve, the test result is judged to be positive and the PDCoV virus is detected in the test sample; When the reading results of the FAM channel, VIC / HEX channel, CY5 channel and ROX channel of the test sample are all No Ct or Ct value>40, the test result is judged to be negative and PEDV, PoRV-A, TGEV and PDCoV viruses are not detected in the test sample.

10. A method for detecting and identifying porcine epidemic diarrhea virus PEDV, porcine group A rotavirus PoRV-A, porcine transmissible gastroenteritis virus TGEV and porcine deltacoronavirus PDCoV for non-diagnostic purposes, characterized in that: The detection and identification method comprises the following steps: (1) Obtaining RNA of test samples; (2) preparing reagents according to the reaction system described in claim 6; (3) performing a PCR reaction under the reaction conditions described in claim 7; (4) determining whether the test result is established according to the test establishment condition described in claim 8; (5) After the test result is determined to be established, the test result is determined according to the test result determination standard described in claim 9.

Images