Primer probe composition for human rhinovirus detection and application thereof

Abstract

The invention provides a primer probe composition for human rhinovirus detection and application thereof, and relates to the technical field of biology. The primer probe composition comprises forward primers with nucleotide sequences shown as SEQ ID NO.1-3 respectively, and reverse primers with nucleotide sequences shown as SEQ ID NO.2-4 respectively, a reverse primer with a nucleotide sequence as shown in SEQ ID NO.4; the nucleotide sequence of the probe is shown as SEQ ID NO.5, and the probe marks a luminous group and a quenching group. The primer probe composition can detect various serotypes of human rhinoviruses, and has no cross reaction with enteroviruses.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a primer-probe combination for detecting human rhinovirus and an application thereof. Background Art

[0002] The following statements merely provide background information related to the present disclosure and do not necessarily constitute prior art.

[0003] Respiratory infections are infectious diseases caused by a variety of microorganisms, including bacteria, viruses, mycoplasmas, fungi, and parasites. Approximately 90% of respiratory infections are caused by viruses, and bacterial infections often follow viral infections. Respiratory infections pose a significant threat to human health and social activities, and large-scale epidemics caused by them are common. The rapid spread and mutability of respiratory diseases greatly increase the difficulty of prevention and control. Respiratory infections are primarily caused by pathogens that invade the patient's body through the nasal cavity, trachea, pharynx, and bronchi. These pathogens include various bacteria, viruses, mycoplasmas, and chlamydia, and are primarily transmitted through airborne, droplet, and contact.

[0004] Human rhinoviruses (HRVs) are RNA viruses belonging to the genus Enterovirus in the family Picornaviridae. They are divided into three types (A to C) and more than 160 serotypes. HRVs are small single-stranded RNA viruses with an icosahedral symmetrical capsid. HRVs are the most common cause of respiratory tract infections in children and adults. HRV-A and HRV-C are common types of HRVs that can cause lower respiratory tract diseases, wheezing, and acute asthma, and can cause more severe symptoms than HRV-B in children. The genomic sequence variation between human rhinovirus serotypes is extremely high, and their 5'UTR conserved sequences have a high degree of sequence similarity with the 5'UTR conserved sequences of enteroviruses, making them prone to cross-reaction. Traditional human rhinovirus nucleic acid testing is prone to missed detections on the one hand, and cross-reactions with enteroviruses on the other hand, making it ineffective in detecting human rhinoviruses.

[0005] Based on the above situation, it is necessary to provide a human rhinovirus nucleic acid detection composition that can reduce missed detection and has lower cross-reaction with enterovirus. Summary of the Invention

[0006] The present invention aims to provide a primer-probe combination for human rhinovirus detection to alleviate the defects of human rhinovirus detection in the prior art. Based on the above primer-probe combination, another object of the present invention is to provide applications of the above primer-probe combination and products using the same.

[0007] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0008] It should be noted that:

[0009] In the present invention, unless otherwise specified, all the embodiments and preferred implementation methods mentioned herein can be combined with each other to form a new technical solution.

[0010] In the present invention, unless otherwise specified, all technical features and preferred features mentioned herein can be combined with each other to form a new technical solution.

[0011] In the present invention, unless otherwise specified, the components or preferred components involved can be combined with each other to form new technical solutions. In the present invention, unless otherwise specified, the numerical range "a-b" is an abbreviation for any combination of real numbers between a and b, where a and b are both real numbers. For example, the numerical range "6-22" means that all real numbers between "6-22" are listed herein, and "6-22" is merely an abbreviation for these numerical combinations.

[0012] The "range" disclosed in the present invention is in the form of lower limit and upper limit, which can be one or more lower limits, and one or more upper limits respectively.

[0013] As used herein, "optionally," "optional," "optional," or "optional" means that the subsequently described event or circumstance may but need not occur, and the description includes instances where the event or circumstance occurs or does not occur.

[0014] In the present invention, the terms "comprise" or "include" are intended to include stated elements, integers or steps, but not to exclude any other elements, integers or steps.

[0015] In the present invention, the terms "each... is independently selected from" and "... are each independently selected from" and "... are independently selected from" are interchangeable and should be understood in a broad sense, which means that when selecting elements from a set, the selection of each element is independent of each other and is not affected by the selection of other elements.

[0016] In a first aspect, the present invention provides a primer-probe combination for detecting human rhinovirus, which comprises forward human rhinovirus primers 1 to 3, reverse human rhinovirus primer 1, and human rhinovirus probe 1 as shown in Table 1.

[0017] Table 1 Primer probe combination sequence

[0018] Sequence ID Primers Sequence (5'→3') SEQ ID NO.1 Forward human rhinovirus primer 1 TGTGCTCRCTTTGAGTCCTCC SEQ ID NO.2 Forward human rhinovirus primer 2 TGTGCTTGATTGTGAGTCCTCC SEQ ID NO.3 Forward human rhinovirus primer 3 TGTGCTACCAATGAGTCCTCC SEQ ID NO.4 Reverse human rhinovirus primer 1 CGGACACCCAAAGTAGTYGGTC SEQ ID NO.5 Human rhinovirus probe 1 GCCCCTGAATGYGGCTAAYCTTAAMCC

[0019] *R: base A / G; Y: base C / T; M: base A / C.

[0020] For example, forward human rhinovirus primer 1 is a mixture of two nucleotide sequences: TGTGCTCACTTTGAGTCCTCC and TGTGCTCGCTTTGAGTCCTCC, with the ratio of each sequence being 1:1. Similarly, human rhinovirus probe 1 is a mixture of eight nucleotide sequences. The same applies to all other sequences unless otherwise specified.

[0021] In an optional embodiment, the working concentration of the forward human rhinovirus primer 1 is 0.1 to 0.6 μM (mixture concentration, the same applies to the others), for example, but not limited to 0.1, 0.2, 0.3, 0.4, 0.5 or 0.6 μM, preferably 0.2 μM.

[0022] In an optional embodiment, the working concentration of the forward human rhinovirus primer 2 is 0.1 to 0.6 μM, for example, but not limited to, 0.1, 0.2, 0.3, 0.4, 0.5 or 0.6 μM, preferably 0.2 μM.

[0023] In an optional embodiment, the working concentration of the forward human rhinovirus primer 3 is 0.1 to 0.6 μM, for example, but not limited to, 0.1, 0.2, 0.3, 0.4, 0.5 or 0.6 μM, preferably 0.2 μM.

[0024] In an optional embodiment, the working concentration of the reverse human rhinovirus primer 1 is 0.1 to 0.6 μM, for example, but not limited to, 0.1, 0.2, 0.3, 0.4, 0.5 or 0.6 μM, preferably 0.4 μM.

[0025] The probe is labeled with a luminescent group and a quencher group.

[0026] In an optional embodiment, the luminescent group includes but is not limited to quantum dots, FAM, VIC, TET, JOE, HEX, CY3, CY5, TAMRA, ROX, Texas Red or Cy5.

[0027] In an optional embodiment, the quenching group includes but is not limited to BHQ1, BHQ2, BHQ3 or MGB.

[0028] In an optional embodiment, the luminescent group is labeled at the 5' end of the probe.

[0029] In an optional embodiment, the quencher group is labeled at the 3' end of the probe.

[0030] In an optional embodiment, the luminescent group is FAM (6-carboxyfluorescein) and the quenching group is BHQ1 (BHQ-1 acid butyrate, 4-[[4-[2-[2-methoxy-5-methyl-4-[2-(4-methyl-2-nitrophenyl)diazo]phenyl]diazo]phenyl]methylamino]).

[0031] In an optional embodiment, the working concentration of the human rhinovirus probe 1 is 0.05-0.4 μM, for example, but not limited to, 0.05, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35 or 0.4 μM, preferably 0.2 μM.

[0032] In an optional embodiment, the working concentration of each forward primer in the primer-probe composition is independently 0.1-0.6 μM, the working concentration of the reverse primer is 0.1-0.6 μM, the working concentration of the probe is 0.05-0.4 μM, the 5' end of the probe is labeled with FAM, and the 3' end of the probe is labeled with BHQ1.

[0033] In an optional embodiment, the working concentration of each forward primer in the primer-probe composition is 0.2 μM, the working concentration of the reverse primer is 0.4 μM, the working concentration of the probe is 0.2 μM, the 5' end of the probe is labeled with FAM, and the 3' end of the probe is labeled with BHQ1.

[0034] In a second aspect, the invention also provides the use of the primer-probe combination for human rhinovirus detection according to the first aspect in the preparation of a human rhinovirus detection product.

[0035] In a third aspect, a human rhinovirus detection kit is also provided, wherein the human rhinovirus detection kit comprises the primer-probe combination for human rhinovirus detection described in the first aspect.

[0036] In an optional embodiment, the kit further comprises one or more of an enzyme, a buffer, metal ions, dNTPs, a negative control, a positive control and a blank control, wherein the enzyme comprises a DNA polymerase, which can be selected from optional DNA polymerases known in the art, preferably comprising a Tth enzyme (Tth DNA Polymerase, Tth DNA polymerase).

[0037] In an optional embodiment, the kit further comprises an enzyme for preventing false positives.

[0038] In an optional embodiment, the enzyme for preventing false positives includes UNG enzyme (Uracil-N-glycosylase) and / or UDG enzyme (Uracil DNA Glycosylase).

[0039] In an optional embodiment, the enzyme includes Tth enzyme and UNG enzyme.

[0040] In an optional embodiment, the metal ions include manganese ions.

[0041] In an optional embodiment, the working concentration of manganese ions is 2.0 to 3.0 mM, for example, but not limited to 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9 or 3.0 mM, preferably 2.6 mM.

[0042] The above-mentioned substances for PCR reaction can be packaged separately or premixed in the same reagent, for example, premixed into a reaction buffer. The substances or reagents in the kit can be present as working reagents or stock reagents. When used as stock reagents, they are diluted to a working concentration before use.

[0043] In a fourth aspect, there is provided the use of the primer-probe combination for human rhinovirus detection described in the first aspect, or the human rhinovirus detection kit described in the third aspect in detecting human rhinovirus for non-diagnostic and therapeutic purposes.

[0044] In an optional embodiment, the application includes using the primer-probe combination for human rhinovirus detection described in the first aspect, or the human rhinovirus detection kit described in the third aspect to perform PCR amplification on the sample to be tested.

[0045] In an optional embodiment, the PCR reaction program is: (a) 50°C, 2 min, 1 cycle; (b) 60°C, 20 min, 1 cycle; (c) 95°C, 1 min, 1 cycle; (d) 95°C 10 sec, 58°C 45 sec (collecting fluorescence), 45 cycles.

[0046] In an optional embodiment, the determination of the test results in the application can be based on mature and well-known methods in the art, such as judging whether human rhinovirus is present in the test sample based on the appearance of an amplification curve. A standard curve can be further constructed for quantitative detection, and the present invention does not impose any restrictions on this.

[0047] Compared with the prior art, the present invention has the following beneficial effects:

[0048] The present invention provides a highly specific human rhinovirus nucleic acid detection composition capable of detecting multiple human rhinovirus genotypes. This composition offers significant advantages, including specificity and coverage for serotypes A, B, and C, as well as multiple genotypes of human rhinovirus. The composition has a detection limit as low as 200 copies / mL, significantly reducing missed detections. Furthermore, it exhibits no cross-reactivity with enteroviruses, facilitating rapid, sensitive, and accurate detection of human rhinovirus. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0050] Figure 1 This is the amplification curve of samples with human rhinovirus plasmid concentrations 1 to 3 and NTC in Example 1;

[0051] Figure 2 The amplification curves of different types of human rhinovirus samples using different primer sets in Example 2 are shown;

[0052] Figure 3 4 shows the amplification curves of the human rhinovirus combination of four pairs of samples with different concentrations in Example 4. DETAILED DESCRIPTION

[0053] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0054] The Tth enzyme, UNG enzyme, human rhinovirus primer probe pair, and human rhinovirus pseudovirus template used in the following examples are all commercially available raw materials; the reaction buffer (containing dNTPs and not containing manganese ions) was purchased from Zhuhai Baorui Biotechnology Co., Ltd.; the enzyme mixture consists of Tth enzyme and UNG enzyme, and the model is commercially available Tth Premix (Probe qRT-PCR).

[0055] Example 1

[0056] (1) Screening of primer-probe combinations for single target genes:

[0057] 1. Screening of human rhinovirus primer probe combinations:

[0058] (1) Preparation of detection system:

[0059] The human rhinovirus detection system is as follows:

[0060] Table 2. Reaction system

[0061]

[0062]

[0063] The forward human rhinovirus primer concentration was 0.2 μM (the concentration of each primer), the reverse human rhinovirus primer concentration was 0.4 μM, and the probe concentration was 0.2 μM.

[0064] The sequence information of the human rhinovirus pseudovirus template in the detection system of this embodiment is shown in Table 3;

[0065] Table 3. Sequences of pseudovirus templates used in this detection system

[0066]

[0067] (2) Detection results of different primer sets for human rhinovirus pseudovirus templates

[0068] Prepare the reaction solution according to the detection system in Table 2, using the primers corresponding to the different primer-probe combinations shown in Tables 4 and 5. Aliquot into eight PCR tubes and place in a real-time fluorescence quantitative PCR instrument for amplification detection.

[0069] Table 4. Summary of human rhinovirus primer-probe combinations

[0070] Detection of genes Upstream primer Downstream primer probe Combination 1 F1, F2, F3 R1 P1 Combination 2 F4 R2 P2 Combination 3 F5 R3 P3 Combination 4 F5, F6, F7 R3 P3

[0071] In detail, the human rhinovirus detection primer and probe sequences are shown in Table 5:

[0072] Table 5. Primer and probe sequences for human rhinovirus detection

[0073]

[0074]

[0075] *R: base A / G; Y: base C / T; M: base A / C.

[0076] Forward human rhinovirus primer 1, for example, is a mixture of two nucleotide sequences: TGTGCTCACTTTGAGTCCTCC and TGTGCTCGCTTTGAGTCCTCC, directly synthesized at a 1:1 ratio. Similarly, human rhinovirus probe 1 is a mixture of eight nucleotide sequences, and the same applies to the remaining primers. Each primer mentioned above refers to a mixture of these sequences; for example, F5 refers to a single primer.

[0077] The 5' end of probes P1, P2, P3 and P4 are labeled with a fluorescent marker group FAM and the 3' end is labeled with a fluorescence quencher group BHQ1.

[0078] Amplification conditions are shown in Table 6:

[0079] Table 6. Amplification conditions

[0080]

[0081] The detection results of the above different primer-probe combinations are shown in Table 7 and Figure 1 As shown:

[0082] Table 7. Test results

[0083]

[0084]

[0085] The test results show that, when the human rhinovirus pseudovirus template is used as the template, combinations 2 to 4 can effectively detect human rhinovirus plasmids of different concentrations, among which combination 4 has the best effect.

[0086] Example 2 Detection results of different primer sets on different types of human rhinovirus samples

[0087] The human rhinovirus pseudovirus template in the detection system of Table 2 was replaced with nucleic acids of different human rhinovirus samples (see Table 8), and a negative control (NTC) was set. Other conditions remained unchanged, and the detection results of each primer set for nucleic acids of different human rhinovirus samples were tested. The test results are shown in Tables 9 and Figure 2 As shown:

[0088] Table 8. Amplification curves

[0089] Rhinovirus strain name Sample concentration strain HRV A2 <![CDATA[1.6×10 3 TCID 50 / mL]]> HRV-A2 / GZ / 1812-79 HRV A30 <![CDATA[1.4×10 3 TCID 50 / mL]]> HRV A30 / GZ389 / 201710 HRV A31 <![CDATA[1.0×10 3 TCID 50 / mL]]> HRV A31 / GZ / 1803-115 HRV A81 <![CDATA[1.5×10 3 TCID 50 / mL]]> HRV-A81 / GZ / 1804-197 HRV B52 <![CDATA[2.0×10 3 TCID 50 / mL]]> HRV B52 / GZ / 1901-87 HRV B70 <![CDATA[1.0×10 3 TCID 50 / mL]]> FO2-2547[V-172-001-021] HRV B72 <![CDATA[1.2×10 3 TCID 50 / mL]]> K2207

[0090] Table 9. Test results

[0091]

[0092]

[0093] Conclusion: The results showed that when no nucleic acid was added to the system, all four primer-probe combinations showed no nonspecific amplification. Based on the plasmid experimental results, combination 4 was the best, followed by combinations 2 and 3, and the worst was combination 1. In the screening experiment for rhinovirus primer-probe inclusivity, combinations 1 and 3 were unable to include HRV-B70, while combinations 2 and 4 could detect HRV-A2 / HRV-A30 / HRV-A31 / HRV-A81 / HRV-B52 / HRV-B70 / HRV-B72, with combination 4 having the lowest Ct value. In summary, combination 4 is the optimal primer-probe combination for human rhinovirus.

[0094] Example 3 Verification of cross-reaction between human rhinovirus and enterovirus

[0095] Human rhinovirus primer-probe combinations 1-4 in Table 3 were tested using the detection system in Table 2, with the enterovirus strains in Table 10 as the template. The samples were aliquoted into eight PCR tubes and placed in a real-time fluorescence quantitative PCR instrument for amplification. The cross-strain types and concentrations were shown in Table 10.

[0096] Table 10. Enterovirus strains used for cross-validation

[0097] Cross virus strain name Sample concentration strain EV70 <![CDATA[3.1×10 5 TCID 50 / mL]]> J670 / 71 EV71 <![CDATA[4.3×10 5 TCID 50 / mL]]> EV71 / GZ / 0401 / 2011 CA24 <![CDATA[2.0×10 5 TCID 50 / mL]]> DN-19 CB1 <![CDATA[1.1×10 5 TCID 50 / mL]]> Conn-5 CA6 <![CDATA[1.8×10 5 TCID 50 / mL]]> ATCC VR-1801

[0098] (1) Extraction of cross-strain nucleic acid

[0099] Each strain in the table above was heat-inactivated in a 60°C water bath for 20 minutes. The inactivated strains were diluted 10-fold and nucleic acid was extracted and purified using magnetic beads. The purified nucleic acid was directly used for cross-validation of human rhinovirus primers.

[0100] (2) Detection:

[0101] Take 10 μL of each enterovirus nucleic acid sample used for cross-validation and add it to the prepared reaction reagent. The total volume of the reaction system is 25 μL.

[0102] Amplification conditions:

[0103] Table 11. Amplification conditions

[0104]

[0105]

[0106] (3) Experimental results:

[0107] Table 12. Experimental results

[0108] Ct value* CA24 CA6 CB1 EV70 EV71 NTC Combination 1 NoCt NoCt NoCt NoCt 40.7 NoCt Combination 2 NoCt NoCt NoCt 39.5 NoCt NoCt Combination 3 NoCt NoCt NoCt NoCt NoCt NoCt Combination 4 NoCt NoCt NoCt NoCt NoCt NoCt Rn value CA24 CA6 CB1 EV70 EV71 NTC Combination 1 -1.392 -0.014 1.617 -7.862 386.970 -3.560 Combination 2 -1.108 -3.592 7.587 160.764 6.905 6.905 Combination 3 -2.828 -3.710 -0.677 -14.854 -10.201 -6.614 Combination 4 -10.070 -14.759 -15.109 -14.624 -14.624 -12.125

[0109] (4) Conclusion:

[0110] Experimental verification found that enterovirus EV70, EV71, CA24, CB1, and CA6 did not cross-react with combinations 3 and 4. Enterovirus EV70 did cross-react with combination 2, and enterovirus EV71 did cross-react with combination 1.

[0111] Example 4: Determination of the detection limit of human rhinovirus

[0112] (1) Preparation of quality control products

[0113] Table 13. Quality Control Products

[0114]

[0115] Table 14. Sequences of human rhinovirus C pseudovirus templates

[0116]

[0117]

[0118] The sample was serially diluted, and 300 μL of the diluted sample was used for nucleic acid purification using a magnetic bead-based nucleic acid extraction reagent (purchased from Zhuhai Livzon Reagent Co., Ltd.). Detection reagents corresponding to each target were prepared, and 10 μL of the purified nucleic acid was added to the reaction reagent for detection. A detection rate >100% was considered stable.

[0119] (2) Amplification conditions:

[0120] Further testing was performed using the human rhinovirus primer probe combination 4 in Table 3 according to the detection system in Table 2, with the template replaced with each rhinovirus quality control product in Table 13 above.

[0121] Table 15. Amplification conditions

[0122]

[0123] (3) Experimental results:

[0124] The test results are shown in Table 16 and Figure 3 shown.

[0125] Table 16. Detection values ​​of human rhinovirus combination 4

[0126]

[0127]

[0128] (4) Conclusion: The detection limit of rhinovirus primer-probe combination 4 for human rhinovirus A31 / B70 / C is 200 copies / mL.

[0129] In summary, after multiple rounds of screening, the optimal primer-probe combination 4 for detecting human rhinoviruses was selected. It specifically detects human rhinoviruses A, B, and C, covering human rhinoviruses A2, A30, A31, A81, B52, B70, B72, and human rhinovirus C, with no significant cross-talk with closely related enteroviruses EV70, EV71, CA24, CB1, and CA6. The lower limits of detection are 200 copies / mL for human rhinovirus A31, 200 copies / mL for human rhinovirus B70, and 200 copies / mL for human rhinovirus C.

[0130] Example 5

[0131] Referring to Table 2, the detection system was used to detect nucleic acids of different types of human rhinovirus samples (see Table 8, types A31, B70, and C in Table 13) and enterovirus (see Table 10) using primers of different concentrations (see Table 17 below). A negative control (NTC) was also set up. The test results are shown in Table 18.

[0132] Table 17. Different primer probe concentrations (μM)

[0133] F5 F6 F7 R3 P3 Concentration 1 0.1 0.1 0.1 0.1 0.05 Concentration 2 0.6 0.6 0.6 0.6 0.4 Concentration 3 0.2 0.4 0.3 0.35 0.2 Concentration 4 0.3 0.2 0.5 0.4 0.3

[0134] Table 18. Detection results of primers at different concentrations

[0135]

[0136]

[0137] In Table 18, “-” indicates not detected, and “+” indicates detected.

[0138] The above results show that the forward primer concentration range is 0.1-0.6μM, the reverse primer concentration range is 0.1-0.6μM, and the probe concentration range is 0.05-0.4μM. All types of human rhinovirus sample nucleic acids can be detected, and there is no cross reaction with enterovirus within the above concentration range.

[0139] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer-probe composition for detecting human rhinovirus, characterized in that: It comprises forward primers whose nucleotide sequences are shown in SEQ ID NO.1 to 3 respectively; a reverse primer whose nucleotide sequence is shown in SEQ ID NO.4; and a probe whose nucleotide sequence is shown in SEQ ID NO.5, wherein the probe is labeled with a luminescent group and a quenching group; According to the 5'→3' direction, SEQ ID NO.1 is TGTGCTCRCTTTGAGTCCTCC, SEQ ID NO.2 is TGTGCTTGATGTGAGTCCTCC, SEQ ID NO.3 is TGTGCTACCAATGAGTCCTCC, SEQ ID NO.4 is CGGACACCCAAAGTAGTYGGTC, SEQ ID NO.5 is GCCCCTGAATGYGGCTAAYCTTAAMCC, Among them, R is A or G; Y is C or T; M is A or C.

2. The primer-probe combination according to claim 1, characterized in that The luminescent group is labeled at the 5' end of the probe, and / or the quenching group is labeled at the 3' end of the probe; Optionally, the luminescent group includes quantum dots, FAM, VIC, TET, JOE, HEX, CY3, CY5, TAMRA, ROX, TexasRed or Cy5; Optionally, the quenching group includes BHQ1, BHQ2, BHQ3 or MGB; Optionally, the luminescent group is FAM and the quenching group is BHQ1.

3. The primer-probe combination according to claim 1 or 2, characterized in that: The working concentration of each forward primer is independently 0.1 to 0.6 μM; the working concentration of the reverse primer is 0.1 to 0.6 μM; Optionally, the working concentration of each forward primer is independently 0.2 μM; Optionally, the working concentration of the reverse primer is 0.4 μM.

4. The primer-probe combination according to claim 3, characterized in that: The working concentration of the probe was 0.05–0.4 μM; Optionally, the working concentration of the probe is 0.2 μM.

5. The primer-probe combination according to any one of claims 1 to 4, characterized in that: The working concentration of each forward primer is independently 0.1-0.6 μM, the working concentration of the reverse primer is 0.1-0.6 μM, the working concentration of the probe is 0.05-0.4 μM, the 5' end of the probe is labeled with FAM, and the 3' end of the probe is labeled with BHQ1; Optionally, the working concentration of each forward primer is 0.2 μM, the working concentration of the reverse primer is 0.4 μM, and the working concentration of the probe is 0.2 μM.

6. Use of the primer-probe combination for human rhinovirus detection according to any one of claims 1 to 5 in the preparation of a human rhinovirus detection product.

7. A human rhinovirus detection kit, characterized in that: A primer-probe composition for detecting human rhinovirus comprising the primer-probe composition according to any one of claims 1 to 5.

8. The human rhinovirus detection kit according to claim 7, characterized in that: Also include one or more of an enzyme, a buffer, a metal ion, dNTPs, a negative control, a positive control and a blank control, wherein the enzyme includes a DNA polymerase; Optionally, the DNA polymerase comprises Tth enzyme; Optionally, the enzyme also includes an enzyme for preventing false positives; Optionally, the enzyme for preventing false positives includes UNG enzyme and / or UDG enzyme; Optionally, the enzyme comprises Tth enzyme and UNG enzyme.

9. The human rhinovirus detection kit according to claim 8, characterized in that: The metal ions include manganese ions; Optionally, the working concentration of manganese ions is 2.0 to 3.0 mM; Optionally, the working concentration of manganese ions is 2.6 mM.

10. Use of the primer-probe combination for detecting human rhinovirus according to any one of claims 1 to 5, or the human rhinovirus detection kit according to any one of claims 7 to 9 in detecting human rhinovirus for non-diagnostic and therapeutic purposes.

Images