Nucleic acid composition, kit and detection method for simultaneously and rapidly detecting 16 respiratory pathogens

Abstract

The invention relates to the technical field of gene engineering, in particular to a nucleic acid composition, a kit and a detection method for simultaneously and rapidly detecting 16 respiratory tract pathogens. The method specifically comprises the following steps: detecting influenza A virus, influenza B virus, novel coronavirus (ORF1ab gene, N gene), haemophilus influenzae, universal human parainfluenza virus, respiratory syncytial virus, human metapneumovirus, enterovirus, mycoplasma pneumoniae, group A streptococcus, bordetella pertussis, common coronavirus, rhinovirus, bocavirus and adenovirus; a forward primer, a reverse primer and a specific fluorescent probe of streptococcus pneumoniae. Through the PCR reaction, whether respiratory tract pathogens exist or not can be rapidly detected from a specimen at the same time, typing identification of 16 respiratory tract pathogens is carried out at the same time, and compared with a single fluorescent quantitative PCR method, the method is more convenient and rapid, and the cost is lower.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering technology, and in particular to a nucleic acid composition, a kit and a detection method thereof for simultaneously and rapidly detecting 16 respiratory pathogens. Background Art

[0002] Respiratory infections are highly contagious and spread rapidly, with significant impacts on morbidity and mortality. The etiology of respiratory infections is complex, including bacteria, viruses, mycoplasma, chlamydia, fungi, etc., of which 80% to 90% are caused by viruses; viruses can be transmitted through droplets, mist, or contaminated utensils, and can cause illness regardless of season and age. Its clinical manifestations are diverse, mainly symptoms such as rhinitis, pharyngitis, laryngitis, tonsillitis, etc., and the severity ranges from self-limiting upper respiratory tract infections to severe or even life-threatening lower respiratory tract infections, such as tracheitis, bronchitis and pneumonia.

[0003] Studies have shown that 80% of acute upper respiratory tract diseases and most lower respiratory tract diseases are caused by pathogens other than bacteria, among which respiratory viruses are the most common. At least 7 virus families, more than 10 categories and a total of 239 types of viruses can cause acute respiratory tract infections. Common viruses that can cause respiratory infections in clinic include influenza A virus, influenza B virus, new coronavirus, Haemophilus influenzae, universal human parainfluenza virus, respiratory syncytial virus, human metapneumovirus, enterovirus, Mycoplasma pneumoniae, group A Streptococcus, Bordetella pertussis, common coronavirus, rhinovirus, bocavirus, adenovirus, Streptococcus pneumoniae, etc. Because these viruses are highly contagious, spread quickly, have a short incubation period, and have similar clinical symptoms, clinicians cannot accurately distinguish them, which causes great difficulties in clinical diagnosis and treatment. Therefore, it is extremely important to identify the infectious pathogens to control the transmission route, take preventive measures for the population, select targeted drugs for clinical use, and avoid the abuse of antibiotics.

[0004] At present, the detection methods of respiratory pathogens mainly include three categories: virus isolation and culture, immunological methods, and molecular biological methods. Virus isolation and culture is the gold standard for the diagnosis of viral diseases, but its operation is cumbersome, the detection time is long, and the positive rate is low. Immunological methods are the main methods of traditional typing, but the source of antiserum is very limited and cannot meet the requirements of clinical pathogen diagnosis. Molecular biological methods based on PCR and other related technologies have been greatly developed due to their advantages such as sensitivity and speed. Multiplex real-time fluorescence quantitative PCR technology has overcome the defects of previous clinical diagnosis with its advantages such as fully closed single-tube amplification, simplicity and speed, good repeatability, real-time quantification, and less contamination. It has high specificity and sensitivity, provides an accurate and reliable laboratory basis for clinical diagnosis, and can be used as an effective and rapid detection method for clinical pathogen diagnosis.

[0005] However, with the advent of the post-COVID era, the time requirements for screening unknown fever pathogens are getting higher and higher, and the fluorescent quantitative PCR method, which normally takes about an hour, has gradually failed to meet the requirements. Based on the fluorescent quantitative PCR method, the present invention breaks through the time limitations and provides a kit that can complete experimental amplification within 15 minutes, further improving the amplification efficiency of fluorescent PCR. Summary of the invention

[0006] The purpose of the present invention is to propose an ultra-fast liquid fully packaged kit, a primer probe set and a detection method for multiple nucleic acid detection of 16 respiratory pathogens. Through PCR reaction, the presence of respiratory pathogens can be simultaneously detected from the specimen, and the typing and identification of 16 respiratory pathogens can be performed at the same time. It is more convenient, rapid and has lower cost than the single-plex fluorescent quantitative PCR method.

[0007] The present invention provides a nucleic acid composition for rapid simultaneous detection of 16 respiratory pathogens, characterized in that it comprises the following primer and probe sequences: Divide into 4 tubes of reaction solution, including: Tube 1: The upstream primer of influenza A virus is sequence IAV-F, the downstream primer is sequence IAV-R, and the specific probe is sequence IAV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 1; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 2; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 3; The upstream primer of influenza B virus is sequence IBV-F, the downstream primer is sequence IBV-R, and the specific probe is sequence IBV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:4; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:5; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:6; The upstream primer of the novel coronavirus ORF1ab gene is the sequence nCoV OF, the downstream primer is the sequence nCoV OR, and the specific probe is the sequence nCoV OP, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 7; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 8; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 9; The upstream primer of the novel coronavirus N gene is the sequence nCoV NF, the downstream primer is the sequence nCoV NR, and the specific probe is the sequence nCoV NP, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 10; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 11; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 12; The upstream primer of Haemophilus influenzae is sequence HI-F, the downstream primer is sequence HI-R, and the specific probe is sequence HI-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 13; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 14; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 15; Tube 2: The upstream primer of the universal human parainfluenza virus is the sequence HPIV-F, the downstream primer is the sequence HPIV-R, and the specific probe is the sequence HPIV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 16; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 17; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 18; The upstream primer of respiratory syncytial virus is the sequence RSV-F, the downstream primer is the sequence RSV-R, and the specific probe is the sequence RSV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 19; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 20; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 21; The upstream primer of human metapneumovirus is the sequence HMPV-F, the downstream primer is the sequence HMPV-R, and the specific probe is the sequence HMPV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 22; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 23; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 24; The upstream primer of enterovirus is sequence EV-F, the downstream primer is sequence EV-R, and the specific probe is sequence EV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 25; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 26; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 27; Tube 3: The upstream primer of Mycoplasma pneumoniae is sequence MP-F, the downstream primer is sequence MP-R, and the specific probe is sequence MP-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 28; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 29; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 30; The upstream primer for group A streptococci is the sequence GAS-F, the downstream primer is the sequence GAS-R, and the specific probe is the sequence GAS-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:31; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:32; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:33; The upstream primer of Bordetella pertussis is sequence BP-F, the downstream primer is sequence BP-R, and the specific probe is sequence BP-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:34; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:35; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:36; The upstream primer of the common coronavirus is the sequence HCoV-F, the downstream primer is the sequence HCoV-R, and the specific probe is the sequence HCoV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 37; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 38; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 39; Tube 4: The upstream primer of rhinovirus is sequence RV-F, the downstream primer is sequence RV-R, and the specific probe is sequence RV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:40; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:41; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:42; The upstream primer of Boca virus is sequence BoV-F, the downstream primer is sequence BoV-R, and the specific probe is sequence BoV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:43; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:44; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:45; The upstream primer of adenovirus is sequence AdV-F, the downstream primer is sequence AdV-R, and the specific probe is sequence AdV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:46; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:47; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:48; The upstream primer of Streptococcus pneumoniae is sequence SP-F, the downstream primer is sequence SP-R, and the specific probe is sequence SP-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:49; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:50; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:51.

[0008] The specific sequence is as follows: SEQ ID NO: 1 (PQ142752: 14-32, this is the sequence number and primer location in NCBI, the same below) IAV-F:ccgaggtcgaaacgtaygt SEQ ID NO:2 (PQ142752:46-65) IAV-R:agtytctgygcgatctcg SEQ ID NO:3(PQ142752:83-66) IAV-P:ccrtcaggccccctcaaagc SEQ ID NO:4(PQ113366:1438-1461) IBV-F:gctgtaagaagaatgctgtcaatg SEQ ID NO:5(PQ113366:1469-1493) IBV-R:cattgartcattcatcttg SEQ ID NO:6(PQ113366:1524-1503) IBV-P:cctttgacatctgcatcacgyccct SEQ ID NO:7(CP043770:1028-1048) nCoV OF:ggctttatgggtagaattcga SEQ ID NO:8(CP043770:1094-1076) nCoV OR:ggcacatttggttgcattc SEQ ID NO:9(CP043770:1049-1071) nCoV OP:tctgtctatccagttgcgtcacc SEQ ID NO:10(CP043770:29258-29277) nCoV NF:cagagacagaagaacagca SEQ ID NO:11(CP043770:29343-29324) nCoV NR:ctcatggattgttgcaattg SEQ ID NO:12(CP043770:29280-29303) nCoV NP:ctgtgactcttcttcctgctgcag SEQ ID NO:13(CP043770:1466185-1466207) HI-F:cccaggttggtatatgttagtta SEQ ID NO:14(CP043770:1466300-1466283) HI-R:gcacggtgtaaggatgca SEQ ID NO:15(CP043770:1466219-1466248) HI-P:tccaaacctgataatattgtgtacactccg SEQ ID NO:16(PP886699:6436-6456) HPIV-F:ggttaaagacamtccagycaa SEQ ID NO:17(PP886699:6580-6559) HPIV-R:ctgctggtgtrttaatgtgtgt SEQ ID NO:18(PP886699:6518-6542) HPIV-P:catattggtctacaacccgaaatga SEQ ID NO:19(PQ117678:3209-3231) RSV-F:aatatggaaacatacgtgaayaa SEQ ID NO:20(PQ117678:3281-3260) RSV-R:ctagracattgtaytgaacagc SEQ ID NO:21(PQ117678:3233-3258) RSV-P:cttcacgarggctccacatacacagc SEQ ID NO:22(MN306028:4061-4079) HMPV-F:aatgttgctgagcartcra SEQ ID NO:23(MN306028:4161-44142) HMPV-R:agtgcaaccatrctkatrgg SEQ ID NO:24(MN306028:4113-4135) HMPV-P:tacccrtgcaaagtcagcacagg SEQ ID NO:25(PQ119796:417-438) EV-F:ggtgygaagagyctaytgagct SEQ ID NO:26(PQ119796:560-541) EV-R:ggacacccaaagtagtyggt SEQ ID NO:27(PQ119796:451-475) EV-P:tccggcccctgaatgcggctaatcc SEQ ID NO:28(CP039761:441332-441350) MP-F:caagtaccaccacgacgct SEQ ID NO:29(CP039761:441332-441350) MP-R:gaaaagctcgtgttacgat SEQ ID NO:30(CP039761:441458-441440) MP-P:cgccacaccaatgccatcaac SEQ ID NO:31(LR590483:130579-130599) GAS-F:ctggctcaactactgaaatag SEQ ID NO:32(LR590483:130671-130648) GAS-R:gtgtcttctgttgtgtcaa SEQ ID NO:33(LR590483:130645-130619) GAS-P:acttcaccttgaccgccaatgataacg SEQ ID NO:34(PP991508:50113-50134) BF-F:cccagttcactcaaggagcccg SEQ ID NO:35(PP991508:50232-50213) BF-R:cgcttcaggcacacaaactt SEQ ID NO:36(PP991508:50145-50163) BF-P:cacccataagcatgcccga SEQ ID NO:37(ON554069:15107-15126) HCoV-F:gatgtygacaaycctgtwct SEQ ID NO:38(ON554069:15153-15128) HCoV-R:arwakrtttggcatrgcacg SEQ ID NO:39(ON554069:15174-15155) HCoV-P:tcacayttwggrtartcccaacccat SEQ ID NO:40(PP991508:322-339) RV-F:gacarggtgygaagagcc SEQ ID NO:41(PP991508:461-444) RV-R:aagtagtyggtcccatcc SEQ ID NO:42(PP991508:361-383) RV-P:tccggcccctgaatgtggctaac SEQ ID NO:43(LC832987:2354-2375) BoV-F:ctctgtaagtactattactttc SEQ ID NO:44(LC832987:2428-2409) BoV-R:tcatattccctgagctcatc SEQ ID NO:45(LC832987:2381-2400) BoV-P:cacttggcacgcacagccac SEQ ID NO:46(OR130173:15371-15390) AdV-F:taccaccgtcagtgaaaacg SEQ ID NO:47(OR130173:15503-15484) AdV-R:ggccttgtaaacgtagggac SEQ ID NO:48(OR130173:15406-15431) AdV-P: atcacgggacctgccgttacgcagc SEQ ID NO:49 (CP155800:763906-763927) SP-F: tgccgaaaacgcttgatacaggga SEQ ID NO:50(CP155800: 764000-763979) SP-R:gttggttattcgtgcaatactc SEQ ID NO:51(CP155800:763974-763951) SP-P: acgcaatctagcagatgaagca Note: R:A / G; Y:C / T; M:A / C; K:G / T; S:G / C; W:A / T; H:A / T / C; B:G / T / C; V:G / A / C; D:G / A / T; N:A / T / C / G.

[0009] Preferably, the 5' end of the specific probe sequence of Haemophilus influenzae, enterovirus, common coronavirus and Streptococcus pneumoniae is modified with ROX, and the 3' end is modified with BHQ2; The 5' end of the specific probe sequence of the novel coronavirus N gene, novel coronavirus ORF1ab gene, human metapneumovirus, Bordetella pertussis, and rhinovirus is modified with CY5, and the 3' end is modified with BHQ2; The 5' end of the specific probe sequence of influenza B virus, respiratory syncytial virus, group A streptococcus, and bocavirus is modified with JOE, and the 3' end is modified with BHQ1; The 5' end of the specific probe sequence of influenza A virus, universal human parainfluenza, Mycoplasma pneumoniae, and adenovirus is modified with FAM, and the 3' end is modified with BHQ1.

[0010] The present invention also provides a kit for simultaneously and rapidly detecting 16 respiratory pathogens, comprising the nucleic acid composition.

[0011] Preferably, the kit further comprises a positive control and a negative control.

[0012] Preferably, the positive control includes influenza A virus, influenza B virus, novel coronavirus (ORF1ab gene, N gene), Haemophilus influenzae, universal human parainfluenza virus, respiratory syncytial virus, human metapneumovirus, enterovirus, Mycoplasma pneumoniae, group A Streptococcus, Bordetella pertussis, common coronavirus, rhinovirus, bocavirus, adenovirus, and Streptococcus pneumoniae-derived nucleic acid that amplifies the target fragment of the primer probe set.

[0013] Preferably, the negative control is TE solution.

[0014] Preferably, the molar ratio of the forward primer, the reverse primer and the specific fluorescent probe in the nucleic acid composition in the kit is: Influenza A virus: 180~220: 180~220: 150~170; Influenza B virus: 380~420: 180~220: 50~700; Novel coronavirus ORF1ab gene: 180~220: 280~320: 50~700; Novel coronavirus N gene: 180~220: 180~220: 50~70; Haemophilus influenzae: 140~160: 50~70: 80~120; Universal type of human parainfluenza virus: 280~320: 140~160: 80~120; Respiratory syncytial virus: 380~420: 280~320: 50~70; Human metapneumovirus: 50~70:50~70:180~220; Enterovirus: 50~700: 80~120: 80~120; Mycoplasma pneumoniae 50~700:50~700:280~320; Group A Streptococcus: 50-70: 50-70: 80-120; Bordetella pertussis: 50~70:50~70:50~70; Common coronavirus: 380~420: 380~420: 180~220; Rhinovirus: 80-120: 180-220: 50-70; Bocavirus: 180~220: 80~120: 80~120; Adenovirus: 80~120: 80~120: 80~120 Streptococcus pneumoniae: 180~220: 80~120: 80~120.

[0015] Further preferably, the molar ratio of the forward primer, the reverse primer and the specific fluorescent probe is: Influenza A virus: 200:200:160; Influenza B virus: 400:200:600; Novel coronavirus ORF1ab gene: 200:300:600; Novel coronavirus N gene: 200:200:60; Haemophilus influenzae: 150:60:100; Universal human parainfluenza virus: 300:150:100; RSV: 400:300:60; Human metapneumovirus: 60:60:200; Enterovirus: 600:100:100; Mycoplasma pneumoniae 600:600:300; Group A Streptococcus: 60:60:100; Bordetella pertussis: 60:60:60; Common coronavirus: 400:400:200; Rhinovirus: 100:200:60; Bocavirus: 200:100:100; Adenovirus: 100:100:100 Streptococcus pneumoniae: 200:100:100.

[0016] Preferably, the kit is stored at -20°C away from light.

[0017] The present invention also provides a method for simultaneously and rapidly detecting 16 respiratory pathogens, comprising the following steps: (1) Extracting total nucleic acid from the sample to be tested; (2) performing PCR amplification on the total nucleic acid using the nucleic acid composition; (3) Collect the fluorescence signals of FAM, JOE, CY5, and ROX detection channels to obtain the detection results.

[0018] Preferably, the quality control standard for the detection in step (3) is: 1) The fluorescence signals of FAM, JOE, CY5, and ROX in the positive control showed fluorescence exponential growth, and the Ct value was ≤32; the fluorescence signals of the negative control and blank control showed no fluorescence exponential growth, and the Ct value was ≥40; 2) Positive samples: When step 1) is established, one or more of FAM, JOE, CY5, and ROX have a fluorescence exponential increase, and the Ct value is ≤37, indicating that influenza A virus or / and influenza B virus or / and novel coronavirus ORF1ab gene or / and novel coronavirus N gene or / and Haemophilus influenzae or / and universal human parainfluenza virus or / and respiratory syncytial virus or / and human metapneumovirus or / and enterovirus or / and Mycoplasma pneumoniae or / and group A Streptococcus or / and Bordetella pertussis or / and common coronavirus or / and rhinovirus or / and bocavirus or / and adenovirus or / and Streptococcus pneumoniae are detected in the sample; 3) Negative samples: When step 1) is established, one or more of FAM, JOE, CY5, and ROX have no fluorescence exponential growth, and the Ct value is ≥40, indicating that influenza A virus or / and influenza B virus or / and novel coronavirus ORF1ab gene or / and novel coronavirus N gene or / and Haemophilus influenzae or / and universal human parainfluenza virus or / and respiratory syncytial virus or / and human metapneumovirus or / and enterovirus or / and Mycoplasma pneumoniae or / and group A Streptococcus or / and Bordetella pertussis or / and common coronavirus or / and rhinovirus or / and bocavirus or / and adenovirus or / and Streptococcus pneumoniae are not detected in the sample; 4) Suspected samples: When step 1) is met, one or more of FAM, JOE, CY5, and ROX has an exponential increase in fluorescence, and the Ct value is 37≤Ct value≤40, and the test is repeated once; if the re-test result is still 37≤Ct value≤40, and there is an obvious exponential increase, it is judged as positive, otherwise it is negative.

[0019] Preferably, the reaction conditions of the PCR amplification are: reverse transcription at 55°C for 2 min; pre-denaturation at 95°C for 1 min; PCR stage: 95°C for 1 s; 55°C for 6 s; 42 cycles.

[0020] Preferably, the PCR amplification in step (2) uses a real-time fluorescence quantitative PCR instrument or an ultra-fast fluorescence quantitative PCR instrument.

[0021] Preferably, the ultra-fast fluorescence quantitative PCR instrument comprises: a power module, a heating module, an excitation light source module, a fluorescence signal detection module, a data analysis software, a sample tube placement nest and a PCR reaction tube; each module is connected by a cable, an optical fiber or an internal circuit; the heating module is composed of a TE-P heating module and an infrared heating module.

[0022] Further preferably, the ultra-fast fluorescence quantitative PCR instrument uses a dual heating system of semiconductor heating combined with infrared heating.

[0023] Further preferably, the ultra-fast fluorescent quantitative PCR instrument uses an infrared heating system with a wavelength of 1.5 to 4.5 μm.

[0024] Preferably, when a real-time fluorescence quantitative PCR instrument is used for detection, the fluorescence PCR detection reaction solution comprises the following components: a buffer, four dNTPs, taqDNA polymerase, reverse transcriptase, RNase inhibitor, UNG enzyme and water; Further preferably, when a real-time fluorescence quantitative PCR instrument is used for detection, the fluorescence PCR detection reaction solution comprises the following components: 50-100 mmol Tris-HCl buffer with a pH value of 8.0-9.5, 2-3 mmol 4 kinds of dNTPs, 1-10 U taq DNA polymerase, 10-250 U reverse transcriptase, 5-50 U RNase inhibitor and 0.1-2 U UNG enzyme Preferably, when an ultra-fast fluorescent quantitative PCR instrument is used for PCR amplification reaction, the fluorescent PCR detection reaction solution includes the following components: buffer, KCl, MgCl 2 , (NH 4 ) 2 SO 4 , 4 dNTPs, glycerol, gelatin, ethylphenyl polyethylene glycol, polyethylene glycol, acetamide, DMSO, trehalose, Tween 20, 1,3-propanediol, dextran, taqDNA polymerase, reverse transcriptase, RNase inhibitor and UNG enzyme.

[0025] Further preferably, when an ultra-fast fluorescent quantitative PCR instrument is used for PCR amplification reaction, the fluorescent PCR detection reaction solution comprises the following components: 50-100 mmol Tris-HCl buffer with a pH value of 8.0-9.5, 20-100 mmol KCl, 1-4 mmol MgCl 2 、10~50mmol(NH 4 ) 2 SO 4 , 2~3mmol of 4 kinds of dNTPs, 15%~50% glycerol, 1%~10% gelatin, 0.001%~0.01% ethylphenyl polyethylene glycol (NP40), 5%~30% polyethylene glycol (PEG), 10~200ug / mL acetamide (BSA), 1%~10% DMSO, 1%~10% trehalose, 0.05%~1% Tween 20, 1%~10% 1,3-propanediol, 0.5%~10% dextran, 1~10U taqDNA polymerase, 10~250U reverse transcriptase, 5~50U RNase inhibitor, 0.1~2U UNG enzyme, and the balance is water.

[0026] The fluorescent PCR detection reaction solution provided by the present invention comprises ethylphenyl polyethylene glycol (NP40) and gelatin. The two components are combined as a water surface binder to improve the absorption efficiency of infrared heat.

[0027] Compared with the prior art, the present invention has the following beneficial effects: The present invention uses a one-step real-time fluorescence quantitative RT-PCR technology, and can use both a conventional real-time fluorescence quantitative PCR instrument for detection and an ultra-fast fluorescence quantitative PCR instrument for detection. The amplification time of a conventional real-time fluorescence quantitative PCR instrument is 80 to 120 minutes, and the ultra-fast fluorescence quantitative PCR instrument can complete the entire fluorescence PCR amplification within 15 minutes, read the results ultra-fast, and greatly shorten the experimental time.

[0028] The main difference between the ultra-fast fluorescent quantitative PCR instrument provided by the present invention and the conventional PCR instrument is that the heating module in the ultra-fast PCR instrument is a dual heating module combining TE-P semiconductor heating and infrared heating, which can make the PCR amplification temperature rise faster and accelerate the PCR amplification, thereby achieving the effect of shortening the amplification time.

[0029] The present invention uses highly specific primers and fluorescent labeled probes for influenza A virus, influenza B virus, new coronavirus (ORF1ab gene, N gene), Haemophilus influenzae, universal human parainfluenza virus, respiratory syncytial virus, human metapneumovirus, enterovirus, Mycoplasma pneumoniae, group A streptococcus, Bordetella pertussis, common coronavirus, rhinovirus, bocavirus, adenovirus, and Streptococcus pneumoniae to develop a multiplex real-time fluorescent quantitative RT-PCR detection kit for detecting 16 respiratory diseases.

[0030] The present invention can simultaneously detect the presence of respiratory pathogens through a one-person PCR reaction, and simultaneously perform influenza A virus, influenza B virus, new coronavirus, Haemophilus influenzae, universal human parainfluenza virus, respiratory syncytial virus, human metapneumovirus, enterovirus, Mycoplasma pneumoniae, group A streptococcus, Bordetella pertussis, common coronavirus, rhinovirus, bocavirus, adenovirus, and pneumococcal typing identification, which is more convenient, rapid, and has lower cost than the single-plex fluorescence quantitative PCR method. At the same time, the detected pathogens are accurately quantified in real time, and early diagnosis is provided for clinical patients according to the titer of viral infection, providing a reference basis for the formulation of clinical treatment plans. It can be applied to the fields of laboratory emergency diagnosis of outbreaks caused by respiratory pathogens, ultra-fast screening and typing of respiratory pathogens, clinical diagnosis, and epidemiological research of respiratory diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1This is an example of the test kit detecting positive influenza A virus in throat swab specimens from patients with confirmed respiratory pathogen infection; Figure 2 This is an example of the test kit detecting positive influenza B virus in throat swab specimens from patients with confirmed respiratory pathogen infection; Figure 3 This is an example of this kit testing a positive novel coronavirus in a throat swab specimen from a patient with confirmed respiratory pathogen infection; Figure 4 This is an example of this kit detecting positive Haemophilus influenzae in throat swab specimens from patients with confirmed respiratory pathogen infection; Figure 5 This is an example of the universal type of parainfluenza virus in the throat swab sample of a patient diagnosed with respiratory pathogen infection tested positive by this kit; Figure 6 This is an example of the test kit detecting positive respiratory syncytial virus in throat swab specimens from patients with confirmed respiratory pathogen infection; Figure 7 This is an example of the test kit detecting positive human metapneumovirus in a throat swab sample from a patient with confirmed respiratory pathogen infection; Figure 8 This is an example of this kit testing positive for enterovirus in a throat swab specimen from a patient with confirmed respiratory pathogen infection; Fig. 9 This is an example of the test kit detecting positive Mycoplasma pneumoniae in throat swab specimens from patients with confirmed respiratory pathogen infection; Fig.10 This is an example of this kit detecting positive group A streptococcus in throat swab specimens from patients with confirmed respiratory pathogen infection; Fig.11 This is an example of this kit detecting positive Bordetella pertussis in throat swab specimens from patients with confirmed respiratory pathogen infection; Fig.12 This is an example of this kit testing positive for common coronavirus in throat swab specimens from patients with confirmed respiratory pathogen infection; Fig.13 This is an example of adenovirus positivity in throat swab specimens from patients with confirmed respiratory pathogen infection detected by this kit; Fig.14 This is an example of this kit testing the positive results of Bocavirus in the throat swab specimen of a patient with confirmed respiratory pathogen infection; Fig.15 This is an example of this kit testing rhinovirus-positive in throat swab specimens of patients with confirmed respiratory pathogen infection; Fig.16 This is an example of this kit detecting positive Streptococcus pneumoniae in a throat swab specimen from a patient with confirmed respiratory pathogen infection; Fig.17 This is an example of a positive control for this kit; Fig.18 This is an example of a negative control for this kit; Fig.19 This is a structural diagram of the ultra-fast fluorescent quantitative PCR instrument provided by the present invention; the lower figure is a schematic diagram of the PCR reaction tube, which is connected to a heating module, an excitation input, and transmits the emitted fluorescent signal to a detection module. DETAILED DESCRIPTION

[0032] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0033] Example 1

[0034] 1. Use the nucleic acid extraction kit (Shengling Nucleic Acid Extraction Kit) to extract pathogen specimens containing influenza A virus, influenza B virus, new coronavirus, Haemophilus influenzae, universal human parainfluenza virus, respiratory syncytial virus, human metapneumovirus, enterovirus, Mycoplasma pneumoniae, group A Streptococcus, Bordetella pertussis, common coronavirus, rhinovirus, bocavirus, adenovirus, and Streptococcus pneumoniae for testing.

[0035] 2. Primer solution, probe solution and positive control are the main components of the kit described in this patent, and the concentration of each component is: 1.RT-PCR reaction solution includes: 80 mmol Tris-HCl buffer (pH 8.5), 80 mmol KCl, 3 mmol MgCl 2 、30mmol(NH 4 ) 2 SO 4 , 3mmol DNTP, 40% glycerol, 8% gelatin, 0.01% ethylphenyl polyethylene glycol (NP40), 10% PEG, 100ug / mL BSA, 5% DMSO, 5% trehalose, 1% Tween 20, 5% 1,3-propylene glycol, 8% dextran, 5U taqDNA polymerase, 250U reverse transcriptase, 50U RNase inhibitor, 2U UNG enzyme, primer probe mixture, and the rest is water; The specific primer and probe sequences are: Tube 1: The upstream primer of influenza A virus is sequence IAV-F, the downstream primer is sequence IAV-R, and the specific probe is sequence IAV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 1; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 2; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 3; The upstream primer of influenza B virus is sequence IBV-F, the downstream primer is sequence IBV-R, and the specific probe is sequence IBV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:4; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:5; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:6; The upstream primer of the novel coronavirus ORF1ab gene is the sequence nCoV OF, the downstream primer is the sequence nCoV OR, and the specific probe is the sequence nCoV OP, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 7; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 8; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 9; The upstream primer of the novel coronavirus N gene is the sequence nCoV NF, the downstream primer is the sequence nCoV NR, and the specific probe is the sequence nCoV NP, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 10; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 11; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 12; The upstream primer of Haemophilus influenzae is sequence HI-F, the downstream primer is sequence HI-R, and the specific probe is sequence HI-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 13; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 14; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 15; Tube 2: The upstream primer of the universal human parainfluenza virus is the sequence HPIV-F, the downstream primer is the sequence HPIV-R, and the specific probe is the sequence HPIV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 16; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 17; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 18; The upstream primer of respiratory syncytial virus is the sequence RSV-F, the downstream primer is the sequence RSV-R, and the specific probe is the sequence RSV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 19; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 20; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 21; The upstream primer of human metapneumovirus is the sequence HMPV-F, the downstream primer is the sequence HMPV-R, and the specific probe is the sequence HMPV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 22; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 23; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 24; The upstream primer of enterovirus is sequence EV-F, the downstream primer is sequence EV-R, and the specific probe is sequence EV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 25; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 26; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 27; Tube 3: The upstream primer of Mycoplasma pneumoniae is sequence MP-F, the downstream primer is sequence MP-R, and the specific probe is sequence MP-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 28; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 29; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 30; The upstream primer for group A streptococci is the sequence GAS-F, the downstream primer is the sequence GAS-R, and the specific probe is the sequence GAS-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:31; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:32; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:33; The upstream primer of Bordetella pertussis is sequence BP-F, the downstream primer is sequence BP-R, and the specific probe is sequence BP-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:34; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:35; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:36; The upstream primer of the common coronavirus is the sequence HCoV-F, the downstream primer is the sequence HCoV-R, and the specific probe is the sequence HCoV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 37; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 38; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 39; Tube 4: The upstream primer of rhinovirus is sequence RV-F, the downstream primer is sequence RV-R, and the specific probe is sequence RV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:40; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:41; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:42; The upstream primer of Boca virus is sequence BoV-F, the downstream primer is sequence BoV-R, and the specific probe is sequence BoV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:43; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:44; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:45; The upstream primer of adenovirus is the sequence AdV-F, the downstream primer is the sequence AdV-R, and the specific probe is the sequence AdV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:46; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:47; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:48.

[0036] The upstream primer of Streptococcus pneumoniae is sequence SP-F, the downstream primer is sequence SP-R, and the specific probe is sequence SP-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:49; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:50; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:51.

[0037] The 5' end of the specific probe sequence of Haemophilus influenzae, enterovirus, common coronavirus and Streptococcus pneumoniae is modified with ROX, and the 3' end is modified with BHQ2; The 5' end of the specific probe sequence of the novel coronavirus N gene, novel coronavirus ORF1ab gene, human metapneumovirus, Bordetella pertussis, and rhinovirus is modified with CY5, and the 3' end is modified with BHQ2; The 5' end of the specific probe sequence of influenza B virus, respiratory syncytial virus, group A streptococcus, and bocavirus is modified with JOE, and the 3' end is modified with BHQ1; The 5' end of the specific probe sequence of influenza A virus, universal human parainfluenza, Mycoplasma pneumoniae, and adenovirus is modified with FAM, and the 3' end is modified with BHQ1.

[0038] The ratio and specific molar amount (in mmol) of the primer-probe mixture forward primer: reverse primer: specific fluorescent probe in the RT-PCR reaction solution are: Influenza A virus: 200:200:160; Influenza B virus: 400:200:600; Novel coronavirus ORF1ab gene: 200:300:600; Novel coronavirus N gene: 200:200:60; Haemophilus influenzae: 150:60:100; Universal human parainfluenza virus: 300:150:100; RSV: 400:300:60; Human metapneumovirus: 60:60:200; Enterovirus: 600:100:100; Mycoplasma pneumoniae 600:600:300; Group A Streptococcus: 60:60:100; Bordetella pertussis: 60:60:60; Common coronavirus: 400:400:200; Rhinovirus: 100:200:60; Bocavirus: 200:100:100; Adenovirus: 100:100:100 Streptococcus pneumoniae: 200:100:100.

[0039] 2. The negative control is TE solution.

[0040] Configure according to Table 1, set relevant parameters according to Table 2 and test on the machine (ultra-fast fluorescence quantitative PCR instrument).

[0041] Among them, the ultra-fast fluorescence quantitative PCR instrument is a laboratory device used to quickly and accurately detect and quantify DNA molecules. The following is the basic structure of the ultra-fast fluorescence quantitative PCR instrument and the connection relationship between each module and its function: 1. Power module: - Function: Provide stable power supply for the entire PCR instrument.

[0042] - Connection relationship: All other modules connected to the instrument to ensure they are functioning properly.

[0043] 2. Heating module: - Function: Provide precise temperature control during the PCR process, usually including a denaturation temperature of 95°C, an annealing temperature of around 55°C, and other required temperatures.

[0044] - Connection relationship: connected to the power module to receive power supply, and connected to the temperature sensor to achieve temperature control. The heating module structure of this instrument is different from the heating modules of other common fluorescent quantitative PCR instruments in that this heating module is a combined heating module composed of a TE-P heating module and an infrared heating module, which can make the PCR amplification temperature change faster, so the PCR reaction speed is faster and takes less time.

[0045] 3. Excitation light source module: - Function: Provides light of a specific wavelength to excite fluorescently labeled probes or dyes to emit fluorescent signals.

[0046] - Connection relationship: adjacent to the fluorescence signal detection module so that light can directly irradiate the reaction tube.

[0047] 4. Fluorescence signal detection module: - Function: Detect the fluorescence signals stimulated by the excitation light source module and convert these signals into electrical signals.

[0048] - Connection relationship: Close to the excitation light source module, receives and detects fluorescent signals, and then sends electrical signals to the data analysis software.

[0049] 5. Data analysis software: - Function: Receive the electrical signal sent by the fluorescence signal detection module, analyze the data through a specific algorithm, and generate quantitative results.

[0050] - Connection relationship: Connect to the fluorescence signal detection module, receive data, and display the results through a computer or built-in display.

[0051] 6. Sample tube placement nest: - Function: Fix the PCR reaction tube to keep it in a fixed position during the entire PCR process.

[0052] - Connection relationship: It is closely connected with the heating module, receives the heat transferred by the heating module, and is adjacent to the excitation light and detection module, converting the excitation light signal into the detection signal through the sample and transmitting it to the signal detection module.

[0053] The connection between the modules is achieved through cables, optical fibers or internal circuits to ensure stable transmission of data and power. During the PCR process, the heating module changes the temperature according to the preset program cycle, and the fluorescence signal detection module detects the fluorescence signal during the annealing phase of each cycle. The data analysis software records and analyzes these signals in real time to determine the amount of target DNA in the sample. It also includes a PCR reaction tube, which is connected to the heating module, excitation input, and transmits the emission fluorescence signal to the detection module.

[0054] Table 1 Reaction system Table 2 Reaction conditions

[0055] 3. Test results are shown in Table 3: 1. Quality control standard: positive control such as Fig.17As shown: FAM, JOE, Cy5, and ROX fluorescence signals have a logarithmic increase in fluorescence, and the Ct value is ≤30, and the CT value is around 28, and the positive result is normal.

[0056] 2. Test samples: 1. Influenza A virus positive samples such as Figure 1 As shown: FAM has a logarithmic increase in fluorescence, while JOE, CY5, and ROX have no logarithmic increase. The Ct value of FAM is 30.73, and the test results are completely consistent with the reported results. 2. Influenza B virus positive samples such as Figure 2 As shown: JOE has a logarithmic increase in fluorescence, while FAM, CY5, and ROX have no logarithmic increase. The Ct value of JOE is 27.65, and the test results are completely consistent with the reported results. 3. Samples positive for the novel coronavirus ORF1ab gene and N gene Figure 3 As shown: CY5 has a logarithmic increase in fluorescence, while FAM, JOE, and ROX have no logarithmic increase. The Ct value of CY5 (overlay detection) is 27.7, and the detection results are completely consistent with the reported results. 4. Haemophilus influenzae positive samples such as Figure 4 As shown: ROX has a logarithmic increase in fluorescence, while FAM, JOE, and CY5 have no logarithmic increase. The Ct value of ROX is 33.19, and the test results are completely consistent with the reported results. 5. Human parainfluenza virus positive samples such as Figure 5 As shown: FAM has a logarithmic increase in fluorescence, while JOE, CY5, and ROX have no logarithmic increase. The Ct value of FAM is 37.78, and the test results are completely consistent with the reported results. 6. Respiratory syncytial virus positive samples such as Figure 6 As shown: JOE has a logarithmic increase in fluorescence, while FAM, CY5, and ROX have no logarithmic increase. The Ct value of JOE is 33.78, and the test results are completely consistent with the reported results. 7. Human metapneumovirus positive samples such as Figure 7 As shown: CY5 has a logarithmic increase in fluorescence, while FAM, JOE, and ROX have no logarithmic increase. The Ct value of CY5 is 27.06, and the test results are completely consistent with the reported results. 8. Enterovirus positive samples such as Figure 8 As shown: ROX has a logarithmic increase in fluorescence, while FAM, JOE, and CY5 have no logarithmic increase. The Ct value of ROX is 22.58, and the test results are completely consistent with the reported results. 9. Mycoplasma pneumoniae positive samples such as Fig. 9 As shown: FAM has a logarithmic increase in fluorescence, while JOE, CY5, and ROX have no logarithmic increase. The Ct value of FAM is 37.1, and the test results are completely consistent with the reported results. 10. Group A Streptococcus positive samples such as Fig.10 As shown: JOE has a logarithmic increase in fluorescence, while FAM, CY5, and ROX have no logarithmic increase. The Ct value of JOE is 26.15, and the test results are completely consistent with the reported results. 11. Positive samples of Bordetella pertussis such as Fig.11 As shown: CY5 has a logarithmic increase in fluorescence, while FAM, JOE, and ROX have no logarithmic increase. The Ct value of CY5 is 37.24, and the test results are completely consistent with the reported results; 12. Common coronavirus positive samples such as Fig.12 As shown: ROX has a logarithmic increase in fluorescence, while FAM, JOE, and CY5 have no logarithmic increase. The Ct value of ROX is 32.93, and the test results are completely consistent with the reported results; 13. Adenovirus positive samples such as Fig.13 As shown: FAM has a logarithmic increase in fluorescence, while JOE, CY5, and ROX have no logarithmic increase. The Ct value of FAM is 34.78, and the test results are completely consistent with the reported results. 14. Bocavirus positive samples such as Fig.14 As shown: JOE has a logarithmic increase in fluorescence, while FAM, CY5, and ROX have no logarithmic increase. The Ct value of JOE is 25.65, and the test results are completely consistent with the reported results. 15. Rhinovirus positive samples such as Fig.15 As shown: CY5 has a logarithmic increase in fluorescence, while FAM, JOE, and ROX have no logarithmic increase. The Ct value of CY5 is 22.58, and the test results are completely consistent with the reported results; 16. Positive samples of Streptococcus pneumoniae Fig.16 As shown: ROX has a logarithmic increase in fluorescence, while FAM, JOE, and CY5 have no logarithmic increase. The Ct value of ROX is 24.43, and the test results are completely consistent with the reported results. 3. Positive control such as Fig.17 As shown; negative control as Fig.18 As shown: FAM, JOE, Cy5, and ROX all had no fluorescence logarithmic growth, and the Ct value was ≥40.0, indicating that the negative result was normal, indicating the specificity and anti-interference of the method of the present invention.

[0057] Table 3 Experimental results

[0058]

[0059] The above Ct values ​​are all automatically read by the fluorescence quantitative PCR instrument based on the amplified fluorescence signal and curve morphology, ensuring the accuracy of the data.

[0060] The above description is only the preferred embodiment of the present invention.

Claims

1. A nucleic acid composition for rapid simultaneous detection of 16 respiratory pathogens, characterized in that: The following primer and probe sequences were included: Tube 1: The upstream primer of influenza A virus is sequence IAV-F, the downstream primer is sequence IAV-R, and the specific probe is sequence IAV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 1; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 2; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 3; The upstream primer of influenza B virus is sequence IBV-F, the downstream primer is sequence IBV-R, and the specific probe is sequence IBV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:4; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:5; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:6; The upstream primer of the novel coronavirus ORF1ab gene is the sequence nCoV OF, the downstream primer is the sequence nCoV OR, and the specific probe is the sequence nCoV OP, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 7; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 8; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 9; The upstream primer of the novel coronavirus N gene is the sequence nCoV NF, the downstream primer is the sequence nCoV NR, and the specific probe is the sequence nCoV NP, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 10; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 11; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 12; The upstream primer of Haemophilus influenzae is sequence HI-F, the downstream primer is sequence HI-R, and the specific probe is sequence HI-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 13; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 14; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 15; Tube 2: The universal upstream primer of human parainfluenza virus is sequence HPIV-F, the downstream primer is sequence HPIV-R, and the specific probe is sequence HPIV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 16; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 17; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 18; The upstream primer of respiratory syncytial virus is the sequence RSV-F, the downstream primer is the sequence RSV-R, and the specific probe is the sequence RSV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 19; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 20; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 21; The upstream primer of human metapneumovirus is the sequence HMPV-F, the downstream primer is the sequence HMPV-R, and the specific probe is the sequence HMPV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 22; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 23; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 24; The upstream primer of enterovirus is sequence EV-F, the downstream primer is sequence EV-R, and the specific probe is sequence EV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 25; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 26; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 27; Tube 3: The upstream primer of Mycoplasma pneumoniae is sequence MP-F, the downstream primer is sequence MP-R, and the specific probe is sequence MP-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 28; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 29; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 30; The upstream primer for group A streptococci is the sequence GAS-F, the downstream primer is the sequence GAS-R, and the specific probe is the sequence GAS-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:31; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:32; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:33; The upstream primer of Bordetella pertussis is sequence BP-F, the downstream primer is sequence BP-R, and the specific probe is sequence BP-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:34; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:35; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:36; The upstream primer of the common coronavirus is the sequence HCoV-F, the downstream primer is the sequence HCoV-R, and the specific probe is the sequence HCoV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 37; the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 38; and the nucleotide sequence of the specific probe is shown in SEQ ID NO: 39; Tube 4: The upstream primer of the rhinovirus is the sequence RV-F, the downstream primer is the sequence RV-R, and the specific probe is the sequence RV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:40; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:41; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:42; The upstream primer of Boca virus is sequence BoV-F, the downstream primer is sequence BoV-R, and the specific probe is sequence BoV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:43; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:44; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:45; The upstream primer of adenovirus is sequence AdV-F, the downstream primer is sequence AdV-R, and the specific probe is sequence AdV-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:46; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:47; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:48; The upstream primer of Streptococcus pneumoniae is sequence SP-F, the downstream primer is sequence SP-R, and the specific probe is sequence SP-P, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:49; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:50; and the nucleotide sequence of the specific probe is shown in SEQ ID NO:

51.

2. The nucleic acid composition according to claim 1, characterized in that The 5' end of the specific probe sequence of Haemophilus influenzae, enterovirus, common coronavirus and Streptococcus pneumoniae is modified with ROX, and the 3' end is modified with BHQ2; The 5' end of the specific probe sequence of the novel coronavirus N gene, novel coronavirus ORF1ab gene, human metapneumovirus, Bordetella pertussis, and rhinovirus is modified with CY5, and the 3' end is modified with BHQ2; The 5' end of the specific probe sequence of influenza B virus, respiratory syncytial virus, group A streptococcus, and bocavirus is modified with JOE, and the 3' end is modified with BHQ1; The 5' end of the specific probe sequence of influenza A virus, universal human parainfluenza, Mycoplasma pneumoniae, and adenovirus is modified with FAM, and the 3' end is modified with BHQ1.

3. A kit for rapid detection of 16 respiratory pathogens simultaneously, characterized in that: Comprising the nucleic acid composition of claim 1 or 2.

4. The kit according to claim 3, characterized in that The molar ratio of the forward primer, the reverse primer and the specific fluorescent probe in the nucleic acid composition of the kit is: Influenza A virus: 180~220: 180~220: 150~170; Influenza B virus: 380~420: 180~220: 50~700; Novel coronavirus ORF1ab gene: 180~220: 280~320: 50~700; Novel coronavirus N gene: 180~220: 180~220: 50~70; Haemophilus influenzae: 140~160: 50~70: 80~120; Universal type of human parainfluenza virus: 280~320: 140~160: 80~120; Respiratory syncytial virus: 380~420: 280~320: 50~70; Human metapneumovirus: 50~70:50~70:180~220; Enterovirus: 50~700: 80~120: 80~120; Mycoplasma pneumoniae 50~700:50~700:280~320; Group A Streptococcus: 50-70: 50-70: 80-120; Bordetella pertussis: 50~70:50~70:50~70; Common coronavirus: 380~420: 380~420: 180~220; Rhinovirus: 80-120: 180-220: 50-70; Bocavirus: 180~220: 80~120: 80~120; Adenovirus: 80~120:80~120:80~120; Streptococcus pneumoniae: 180~220: 80~120: 80~120.

5. A method for rapid simultaneous detection of 16 respiratory pathogens, characterized in that: The steps include: (1) Extracting total nucleic acid from the sample to be tested; (2) performing PCR amplification on the total nucleic acid using the nucleic acid composition according to claim 1 or 2; (3) Collect the fluorescence signals of the FAM, JOE, CY5, and ROX detection channels to obtain the detection results.

6. The detection method according to claim 5, characterized in that: The quality control standard for the detection in step (3) is: 1) The fluorescence signals of FAM, JOE, CY5, and ROX in the positive control showed fluorescence exponential growth, and the Ct value was ≤32; the fluorescence signals of the negative control and blank control showed no fluorescence exponential growth, and the Ct value was ≥40; 2) Positive samples: When step 1) is established, one or more of FAM, JOE, CY5, and ROX have a fluorescence exponential increase, and the Ct value is ≤37, indicating that influenza A virus or / and influenza B virus or / and novel coronavirus ORF1ab gene or / and novel coronavirus N gene or / and Haemophilus influenzae or / and universal human parainfluenza virus or / and respiratory syncytial virus or / and human metapneumovirus or / and enterovirus or / and Mycoplasma pneumoniae or / and group A Streptococcus or / and Bordetella pertussis or / and common coronavirus or / and rhinovirus or / and bocavirus or / and adenovirus or / and Streptococcus pneumoniae are detected in the sample; 3) Negative samples: When step 1) is established, one or more of FAM, JOE, CY5, and ROX have no fluorescence exponential growth, and the Ct value is ≥40, indicating that influenza A virus or / and influenza B virus or / and novel coronavirus ORF1ab gene or / and novel coronavirus N gene or / and Haemophilus influenzae or / and universal human parainfluenza virus or / and respiratory syncytial virus or / and human metapneumovirus or / and enterovirus or / and Mycoplasma pneumoniae or / and group A Streptococcus or / and Bordetella pertussis or / and common coronavirus or / and rhinovirus or / and bocavirus or / and adenovirus or / and Streptococcus pneumoniae are not detected in the sample; 4) Suspected samples: When step 1) is met, one or more of FAM, JOE, CY5, and ROX has an exponential increase in fluorescence, and the Ct value is 37≤Ct value≤40, and the test is repeated once; if the re-test result is still 37≤Ct value≤40, and there is an obvious exponential increase, it is judged as positive, otherwise it is negative.

7. The detection method according to claim 5, characterized in that: The reaction conditions of the PCR amplification are: reverse transcription at 55°C for 2 min; pre-denaturation at 95°C for 1 min; PCR stage: 95°C for 1 s; 55°C for 6 s; 42 cycles.

8. The detection method according to claim 5, characterized in that: The PCR amplification in step (2) uses a real-time fluorescence quantitative PCR instrument or an ultra-fast fluorescence quantitative PCR instrument.

9. The detection method according to claim 8, characterized in that: When a real-time fluorescence quantitative PCR instrument is used for detection, the fluorescence PCR detection reaction solution includes the following components: buffer, 4 dNTPs, taqDNA polymerase, reverse transcriptase, RNase inhibitor, UNG enzyme and water; When an ultra-fast fluorescent quantitative PCR instrument is used to perform a PCR amplification reaction, the fluorescent PCR detection reaction solution includes the following components: buffer, KCl, MgCl2, (NH4)2SO4, 4 dNTPs, glycerol, gelatin, ethylphenyl polyethylene glycol, polyethylene glycol, acetamide, DMSO, trehalose, Tween 20, 1,3-propylene glycol, dextran, taqDNA polymerase, reverse transcriptase, RNase inhibitor and UNG enzyme.

Images