Electrochemical aptasensor for uric acid detection
By modifying the uric acid aptamer on the gold electrode surface and introducing a complementary auxiliary chain to form a dual-affinity electrochemical aptamer sensor, the problem of narrow dynamic range of traditional sensors is solved, and uric acid detection with a wide dynamic range is achieved with high sensitivity and specificity, which is suitable for medical diagnosis and food safety testing.
Patent Information
- Application Number
- CN202411007215.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-25
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2044-07-25
AI Technical Summary
Existing electrochemical aptamer sensors have a narrow dynamic range in uric acid detection, making it difficult to adapt to changes in uric acid levels in different individuals or the same person at different times. They are also easily affected by diet, metabolic status and drugs, resulting in insufficient detection specificity and sensitivity.
A uric acid aptamer was modified on the surface of a gold electrode and a complementary auxiliary chain was introduced to form a dual-affinity sensor. By labeling the 5' end of the uric acid aptamer with a redox reporter, methylene blue, and the auxiliary chain concentration was 10nM to 300nM, a wide dynamic range detection of the sensor was achieved.
The dynamic range of the sensor has been broadened to 3000 times, covering the uric acid concentration range of 0.25μM to 750μM, improving the sensitivity and specificity of detection, reducing background signal interference, and is low-cost and simple to operate.
Smart Images

Figure CN119165022B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of electrochemical biosensors, and in particular relates to a dual-affinity aptamer sensor with a wide dynamic range and the preparation and application thereof. Background Art
[0002] Uric acid is the end product of purine metabolism and plays a key role in the diagnosis of various diseases including gout, kidney disease and hyperuricemia. In addition, uric acid levels are also closely related to various metabolic diseases, such as diabetes and obesity. Although diagnostic technology has made significant progress, accurately monitoring uric acid levels remains a challenge. This is mainly because uric acid concentration is affected by multiple factors such as diet, metabolic status and renal function, resulting in large differences in uric acid levels between different individuals and the same person at different times. In addition, the use of certain drugs can affect uric acid metabolism and excretion, and differences in uric acid levels need to be closely monitored during drug treatment. Therefore, the development of a biosensor technology with a wide dynamic range and the ability to accurately assess changes in uric acid levels is of great significance for disease status monitoring and drug efficacy evaluation.
[0003] Currently, the main methods for measuring uric acid include enzymatic methods, voltammetry, and liquid chromatography. While enzymatic methods are stable and reliable, they rely on a single enzymatic reaction to determine uric acid levels, resulting in a limited detection range and high cost. Voltammetry offers excellent sensitivity, but the voltammetric responses of glutathione and ascorbic acid in the test fluid overlap with those of uric acid molecules, resulting in poor sensor specificity. High-performance liquid chromatography offers a wide detection range and sensitivity, but requires specialized techniques and cumbersome operation. Against this backdrop, electrochemical aptamer-based sensors (EABs), with their excellent specificity and robustness, hold promise as advanced analytical tools for uric acid detection. These sensors rely on conformational changes in aptamers, end-labeled with redox reporters, upon binding to their target, resulting in changes in the redox current for detection. Furthermore, serum analysis based on EABs does not require any extraction or separation steps, making them potentially adaptable to automated assay systems. However, due to their reliance on a single binding site recognition mechanism, they only have an 81-fold useful dynamic range. Therefore, there is an urgent need for an effective means to adjust the dynamic range of EAB sensors so as to improve their performance in practical applications. Summary of the Invention
[0004] In view of the current technical status that traditional electrochemical aptamer sensors for detecting uric acid rely on a single binding site recognition mechanism, resulting in a narrow useful dynamic range, there is an urgent need for a method that can effectively adjust the dynamic range of electrochemical aptamer sensors. The present invention aims to provide an electrochemical aptamer sensor with a wide dynamic range for uric acid detection, as well as its preparation and application.
[0005] In order to achieve the above object, the specific technical solutions adopted by the present invention are as follows:
[0006] The present invention provides a dual-affinity aptamer sensor for uric acid detection with a wide dynamic range. The dual-affinity aptamer sensor is a three-electrode system sensor. The working electrode of the dual-affinity aptamer sensor is obtained by sequentially modifying a uric acid aptamer and an auxiliary chain on the surface of a gold electrode; the auxiliary chain is a sequence partially complementary to the uric acid aptamer; the auxiliary chain is 13 to 34 bp in length; the uric acid aptamer is labeled with a thiol group at the 5' end and a redox reporter methylene blue at the 3' end.
[0007] The auxiliary chain is any one of the nucleotide sequences shown in SEQ ID NOs: 2-7, and the auxiliary chain concentration is 10 nM to 300 nM.
[0008] The nucleotide sequence of the uric acid aptamer is shown in SEQ ID NO: 1, and the concentration of the uric acid aptamer is 1×10 -7 mol / L~1×10 -6 mol / L.
[0009] The present invention provides a method for preparing the dual-affinity aptamer sensor for uric acid detection with a wide dynamic range, comprising:
[0010] (1) preparing a reduced thiolated uric acid aptamer;
[0011] (2) using the reduced thiolated uric acid aptamer obtained in step (1) to modify the gold electrode, freezing, thawing, washing, and blocking to obtain a gold electrode modified with the uric acid aptamer;
[0012] (3) Auxiliary chain hybridization is introduced on the gold electrode modified with the uric acid aptamer in step (2) to obtain a dual-affinity electrochemical aptamer sensor.
[0013] The preparation of the reduced thiolated uric acid aptamer includes: mixing the reducing agent tris(2-carboxyethyl)phosphine and the thiolated uric acid aptamer in a volume ratio of 2:3, and standing at room temperature in the dark for 1-2 hours; the concentration of the tris(2-carboxyethyl)phosphine is 100mM, and the concentration of the thiolated uric acid aptamer is 100μM.
[0014] The freezing temperature is -20°C, the time is 7 min to 15 min, and the blocking is carried out by incubating at room temperature for 1 h to 2 h using 10 mM Tris-HCl buffer containing 1 mM MCH.
[0015] The concentration of the introduced auxiliary chain is 10 nM-300 nM, and the amount of the auxiliary chain added is 7 μL-10 μL.
[0016] The hybridization condition is room temperature reaction for 60 minutes.
[0017] The method for detecting uric acid using the dual-affinity aptamer sensor with a wide dynamic range for uric acid detection comprises:
[0018] The method comprises the following steps: treating a uric acid sample to be tested; dripping a uric acid sample solution to be tested onto the working electrode surface of the dual-affinity aptamer sensor for uric acid detection with a wide dynamic range to react; placing the working electrode, counter electrode, and reference electrode in a buffer solution, and detecting the electrical signal of the working electrode by square wave voltammetry; and plotting a standard curve based on the electrical signal versus uric acid concentration to achieve quantitative detection of uric acid.
[0019] The uric acid sample to be tested is treated with a buffer solution having a pH value of 8.3, which is a 20mMTris-HCl solution containing 10mM MgCl2; the standard curve is drawn by dropping a uric acid sample solution to be tested with a concentration ranging from 0.01μM to 1000μM onto the surface of the working electrode for a reaction of 30 minutes; the buffer solution is a phosphate buffer solution containing 100mM NaCl.
[0020] Compared with the prior art, the present invention has the following beneficial technical effects:
[0021] The present invention provides a portable electrochemical aptamer sensor with dual affinity properties. The sensor is formed by fixing a uric acid aptamer with a redox reporter MB at its end and introducing an auxiliary chain complementary to the 5' terminal region of the uric acid aptamer, so that the probe portion on the sensing interface hybridizes, thereby reducing the sensor background signal and significantly improving the sensitivity. At the same time, the introduction of the auxiliary chain causes the aptamer probe on the sensor surface to have two different affinities, which widens the dynamic range of the sensor from 81 times to approximately 3000 times (0.25-750 μM); it solves the limitation of traditional E-AB sensors that only have a limited dynamic range, thereby expanding its application in a wider concentration range. The electrochemical aptamer sensor of the present invention is based on the specific binding of the aptamer to the target uric acid and has strong specificity, which can effectively avoid interference from the complex components of the actual sample during the detection process. In addition, the present invention is low in cost, simple to manufacture, and has good stability, and has good market value.
[0022] The portable electrochemical aptasensor with dual affinity, provided by the present invention, is used for uric acid detection. A thiol-modified uric acid aptamer probe is assembled onto a gold electrode. The 3' end of the uric acid aptamer probe is labeled with a signal molecule, MB, and an auxiliary chain is introduced to construct a dual-affinity electrochemical aptamer sensor with a wide dynamic range. The electrical signal from the modified electrode is recorded and used as a baseline value. A serum sample containing uric acid is then dropped onto the modified electrode surface. Uric acid specifically binds to the aptamer probe on the sensor surface, bringing the aptamer signal molecule MB close to the electrode surface and promoting efficient electron transfer. Finally, the uric acid content in the serum is determined based on the changes in the electrical signal. The change in the detected electrical signal and the logarithm of the uric acid concentration show a good linear relationship in the range of 0.25μM to 750μM, with a detection limit of 0.1μM. The sensor has the advantages of wide dynamic range, high sensitivity, high selectivity, and easy preparation and operation. Therefore, it has broad application prospects in medical diagnosis (such as monitoring of diseases such as hyperuricemia and gout), food safety testing (such as detecting the uric acid content in food), and biochemical research. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 Schematic diagram of the dual-affinity electrochemical aptamer sensor of the present invention for recognizing uric acid (UA);
[0024] Figure 2 Figure 1 is a comparison of the performance of the present invention for detecting uric acid (uric acid concentration is 0.25 μM), wherein A is a square wave voltammetry curve of the electrochemical aptamer sensor for detecting uric acid, and B is a square wave voltammetry curve of the sensor before and after binding to the target uric acid after the introduction of the auxiliary chain 5'-13mer;
[0025] Figure 3 Optimization diagram of auxiliary chain parameters for constructing a dual-affinity electrochemical aptasensor for uric acid detection. Figure A shows the signal gain for uric acid recognition after the auxiliary chain binds to different positions of the aptamer, and Figure B shows the signal gain for uric acid binding after introducing auxiliary chains of varying lengths (13 bp to 34 bp).
[0026] Figure 4 Figures demonstrating the stability and selectivity of a dual-affinity electrochemical aptasensor for uric acid detection. Figure A shows the signal attenuation before and after two weeks of storage, Figure B shows the repeatability of a dual-affinity aptasensor constructed using five electrodes, and Figure C shows the signal response of the electrochemical aptasensor to other interfering substances in body fluids.
[0027] Figure 5 This is a linear relationship diagram between the signal gain of the dual-affinity electrochemical aptamer sensor and the logarithm of the uric acid concentration.
[0028] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts should fall within the scope of protection of the present invention.
[0029] Example 1: Dual-affinity aptamer sensor for wide dynamic range uric acid detection
[0030] This embodiment provides a dual-affinity aptamer sensor for uric acid detection with a wide dynamic range. The dual-affinity aptamer sensor is a three-electrode system sensor. The working electrode is obtained by sequentially modifying a uric acid aptamer and an auxiliary chain on the surface of a gold electrode. The auxiliary chain has a sequence that is partially complementary to the uric acid aptamer. The auxiliary chain is 13 to 34 bp in length. The uric acid aptamer is labeled with a thiol group at the 5' end and a redox reporter, methylene blue, at the 3' end.
[0031] The auxiliary chain is any one of the nucleotide sequences shown in SEQ ID NOs: 2-7, the auxiliary chain length is 13 to 34 bp, and the auxiliary chain concentration is 10 nM to 300 nM; the nucleotide sequence of the auxiliary chain 5'-13mer is CTTGCCCTGTCGT (as shown in SEQ ID NO: 2); the nucleotide sequence of the auxiliary chain 5'-16mer is CCT CTT GCC CTGTCG T (as shown in SEQ ID NO: 3); the nucleotide sequence of the auxiliary chain 5'-19mer is AAA CCT CTT GCC CTG TCGT (as shown in SEQ ID NO: 4); the nucleotide sequence of the auxiliary chain 5'-22mer is GTAAAA CCT CTT GCC CTG TCGT (as shown in SEQ ID NO: 5); the nucleotide sequence of the auxiliary chain 5'-28mer is AGG TAAGTAAAA CCT CTT GCCCTG TCG T (as shown in SEQ ID NO: 6); the nucleotide sequence of the auxiliary chain 5'-34mer is TTC CTTAGG TAAGTAAAA CCT CTT GCC CTG TCG T (as shown in SEQ ID NO: 7);
[0032] The nucleotide sequence of the uric acid aptamer is ACGACAGGGCAAGAGGTTTTACTTACCTAAGGAATGTCGT (as shown in SEQ ID NO: 1), and the concentration of the uric acid aptamer is 1×10 -7 mol / L~1×10 -6mol / L.
[0033] The construction process is shown in the attached Figure 1 As shown, the dual-affinity aptamer sensor uses a uric acid aptamer (UA-apt) as the aptamer and a 5'-13mer auxiliary strand. The specific preparation process is as follows:
[0034] (1) Reduction of thiolated uric acid aptamers
[0035] To reduce the disulfide bonds in the thiolated uric acid aptamer, 4 μL of 100 mM TCEP was mixed with 6 μL of 100 μM thiolated probe and allowed to stand at room temperature in the dark for 1 h. 6 μL of 1 μM reduced thiolated uric acid aptamer probe was dissolved in 20 mM Tris-HCl (pH 7.4) and dropped onto the freshly cleaned electrode surface. The electrode was then placed in a laboratory freezer (-20°C) for 15 min. After thawing to room temperature (approximately 22°C) for 1 min, the surface was washed three times with 20 mM Tris-HCl (pH 7.4). To block the uric acid aptamer probe-modified electrode, the prepared electrode was incubated in 10 mM Tris-HCl buffer containing 1 mM MCH at room temperature for 1 h. Subsequently, the electrode was rinsed with an excess of Tris-HCl buffer (20 mM, pH 7.4) and stored at 4°C before use. The reduced thiolated uric acid aptamer was obtained.
[0036] (2) Preparation of dual-affinity aptamer sensors
[0037] Using 0.5M sulfuric acid as the electrolyte, cyclic voltammetry was used to scan the gold screen-printed electrode. The parameters were set as the starting potential of -0.1V, the highest potential of 1.4V, the lowest potential of -0.1V, the end potential of 1.4V, 10 scans, and a scan rate of 0.05V / s. Then, 6μL of reduced thiolated uric acid aptamer probe with a molar concentration of 1μM was dropped on the surface of the gold screen-printed electrode. The electrode was then placed in a -20℃ environment and frozen for 15min. After thawing and washing at room temperature, it was blocked with 1mM 6-mercaptohexanol for 1 hour. Subsequently, 8μL of 50nM auxiliary chain was added and hybridized at room temperature for 60min to obtain a dual-affinity electrochemical aptamer sensor, which was stored at 4℃ for future use.
[0038] (3) Electrical signal acquisition method
[0039] Testing was performed using a screen-printed gold electrode system with an integrated three-electrode system. The working electrode was a gold electrode, the counter electrode was a platinum wire electrode, and the reference electrode was an Ag / AgCl electrode. These electrodes were immersed in a phosphate buffer solution containing 100 mM NaCl. Square-wave voltammetry (SWV) analysis was performed using a PalmSens4 portable electrochemical workstation with a potential range of 0 to -0.5 V (VsAg / AgCl), an amplitude of 50 mV, a step potential of 1 mV, and a frequency of 60 Hz to detect the electrical signal generated on the working electrode surface.
[0040] (4) Determination of uric acid
[0041] Take 5 μL of UA binding buffer (20 mM Tris-HCl pH 8.3, 10 mM Mg 2+ ) was dropped on the surface of the screen-printed gold electrode of the modified probe, reacted at room temperature for 30 minutes, and the electrical signal of the modified electrode was collected as the blank value; different concentrations of uric acid (final concentration was 0.01μM~1000μM) were dissolved in binding buffer, dropped on the surface of the sensing electrode, reacted at room temperature for 30 minutes, rinsed with buffer, blown dry with N2, and the corresponding electrical signal was detected; a standard curve was drawn by plotting the electrical signal against the uric acid concentration.
[0042] 4 μL of 100 mM TCEP was mixed with 6 μL of 100 μM thiolated probe and allowed to stand at room temperature in the dark for 1 hour. 6 μL of 1 μM reduced thiolated uric acid aptamer probe was dissolved in 20 mM Tris-HCl (pH 7.4) and dropped onto the freshly cleaned electrode surface. The electrode was then placed in a laboratory freezer (-20°C) and frozen for 15 minutes. After thawing to room temperature (approximately 22°C) for 1 minute, the surface was washed three times with 20 mM Tris-HCl (pH 7.4). To block the uric acid aptamer probe-modified electrode, the prepared electrode was incubated in 10 mM Tris-HCl buffer containing 1 mM MCH at room temperature for 1 hour. Subsequently, the electrode was rinsed with an excess of Tris-HCl buffer (20 mM, pH 7.4) and stored at 4°C before use.
[0043] Example 3: Application of electrochemical aptasensor for uric acid detection
[0044] The present invention discloses a method for measuring uric acid using a portable sensor based on a dual-affinity electrochemical aptamer:
[0045] (1) Detection principle
[0046] First, a thiol-modified uric acid aptamer probe was assembled on a gold electrode by freezing. The 3' end of the uric acid aptamer probe was labeled with the signal molecule methylene blue (MB). After introducing an auxiliary chain, an aptamer sensor with a wide dynamic range was obtained. The electrical signal of the modified electrode was collected and the signal value was used as the blank value. A serum sample containing uric acid was dropped onto the surface of the modified electrode. Uric acid specifically bound to the aptamer probe on the sensor surface. The signal molecule MB of the aptamer was close to the electrode surface, supporting efficient electron transfer. The electrical signal of the modified electrode was collected, and the serum uric acid was determined based on the change in the electrical signal.
[0047] Attachment Figure 2 The changes of electrical signals when the electrochemical aptasensor is used for detection are demonstrated. Figure 2 The data shows that Figure 2 In the figure, A shows the square wave voltammetry curve of the electrochemical aptamer sensor detecting uric acid, and B shows the square wave voltammetry curve before and after binding to the target uric acid after the introduction of the auxiliary chain 5'-13mer. Without the auxiliary chain, the change in the electrical signal before and after binding of the electrochemical aptamer sensor to the target uric acid was not obvious, making it difficult to use for quantitative analysis. However, the introduction of the auxiliary chain reduced the sensor's background signal, and the signal gain before and after target binding reached 56.5%, a significant improvement compared to the interface without the auxiliary chain. This demonstrates that the electrochemical aptamer sensor designed for uric acid detection can significantly improve sensing performance.
[0048] (2) Optimization of detection conditions
[0049] During the experiment, the effects of the auxiliary chain binding position and the auxiliary chain length on the performance of the constructed electrochemical aptamer sensor were investigated. For specific test results, please refer to the attached Figure 3 .
[0050] By the attached Figure 3 As shown in the data, Figure A shows the effect of varying the auxiliary chain binding position on the electrical signal change, and Figure B shows the effect of varying the auxiliary chain length on the electrical signal change. When the auxiliary chain binding position is closer to the electrode end, the background signal is more effectively suppressed, and the sensor achieves greater signal gain. The 5′-13mer auxiliary chain performed best. Using auxiliary chains of varying lengths (13-34 bp) that were partially complementary to the aptamer, the data showed that signal gain depends on auxiliary chain length. Longer auxiliary chains produce weaker signal changes, as the equilibrium shifts more toward the unbound state, thereby reducing target affinity. Therefore, the 5′-13mer auxiliary chain was selected as the auxiliary chain for subsequent experiments.
[0051] (3) Feasibility analysis of sensors in practical applications:
[0052] A three-electrode system was used for the test, with a gold electrode modified with the uric acid aptamer as the working electrode, a platinum wire electrode as the counter electrode, and Ag / AgCl as the reference electrode. The electrodes were inserted into an electrolyte solution, and electrochemical testing was performed using square wave voltammetry (SWV) with a potential range of 0 to -0.5 V (VsAg / AgCl), an amplitude of 50 mV, a step potential of 1 mV, and a frequency of 60 Hz.
[0053] The serum sample containing uric acid needs to contain 10 mM MgCl2 and be adjusted to a pH of 8.3. The reaction time between uric acid and the electrochemical aptamer sensor is 30 minutes. The auxiliary chain concentration is 10 nM to 300 nM. The electrolyte used to collect the electrical signal from the modified electrode has a pH of 8.0 and consists of 20 mM Tris-HCl containing 100 mM NaCl.
[0054] The inventors have thoroughly evaluated the feasibility of the sensor in practical applications, and the experimental results can be found in the attached Figure 4 .
[0055] By the attached Figure 4 The data shows that Figure 4 In the figure, A is the signal attenuation diagram before and after storing the sensor for two weeks, B is the repeatability verification diagram of the dual-affinity aptamer sensor constructed using five electrodes, and C is the signal response diagram of the electrochemical aptamer sensor to other interfering substances in body fluids; within 15 days, the relative change in current was small, indicating that the dual-affinity aptamer sensor with a wide dynamic range for uric acid detection of the present invention has good stability; under the same experimental conditions, 5 electrodes were used to assemble the aptamer, and the current signal of the electrochemical aptamer sensor obtained by combining with the auxiliary chain to test different electrode assemblies showed a relative standard deviation (RSD) of 5.48%, indicating that the experimental results have good repeatability. In order to evaluate the anti-interference ability of the sensor, the inventors made the sensor combined with the auxiliary chain bind to different targets, including uric acid (UA), potassium chloride (KCl), sodium chloride (NaCl), ascorbic acid (AA) and dopamine (DA). Only when the binding target was uric acid, the signal of the sensor was enhanced, which showed that the dual-affinity aptamer sensor for uric acid detection in a wide dynamic range has strong specificity and anti-interference ability, which provides reliable support for detection in more complex body fluid samples.
[0056] (4) Detection effect of the sensor under optimized conditions
[0057] The introduction of auxiliary chains results in two different affinities for the aptamer probes on the sensor surface. The dynamic range of the electrochemical aptamer sensor with auxiliary chains introduced in the present invention was tested, and the effect can be seen in the attached figure. Figure 5 .
[0058] By the attached Figure 5The data show that the dynamic range of the sensor is widened from 81 times to about 3000 times (0.25-750 μM). The results show that the measurement dynamic range of the electrochemical aptamer sensor of the present invention is expanded to 3000 times, covering more than three orders of magnitude of uric acid concentration changes.
[0059] The above content is only for explaining the technical idea of the present invention and cannot be used to limit the protection scope of the present invention. Any changes made on the basis of the technical solution in accordance with the technical idea proposed by the present invention shall fall within the protection scope of the claims of the present invention.
Claims
1. A dual-affinity aptamer sensor for uric acid detection with a wide dynamic range, wherein the dual-affinity aptamer sensor is a three-electrode system sensor, characterized in that: The working electrode of the dual-affinity aptamer sensor is obtained by sequentially modifying a uric acid aptamer and an auxiliary chain on the surface of a gold electrode; the auxiliary chain is a sequence partially complementary to the uric acid aptamer; the auxiliary chain is 13 to 34 bp in length; the uric acid aptamer is labeled with a thiol group at its 5' end and a redox reporter, methylene blue, at its 3' end.
2. The dual-affinity aptamer sensor for uric acid detection with a wide dynamic range according to claim 1, characterized in that: The auxiliary chain is any one of the nucleotide sequences shown in SEQ ID NOs: 2-7, and the auxiliary chain concentration is 10 nM to 300 nM.
3. The dual-affinity aptamer sensor for uric acid detection with a wide dynamic range according to claim 1, characterized in that: The nucleotide sequence of the uric acid aptamer is shown in SEQ ID NO: 1, and the concentration of the uric acid aptamer is 1×10 - 7 mol / L~1×10 -6 mol / L.
4. The method for preparing the dual-affinity aptamer sensor for uric acid detection with a wide dynamic range according to any one of claims 1 to 3, characterized in that: include: (1) preparing a reduced thiolated uric acid aptamer; (2) using the reduced thiolated uric acid aptamer obtained in step (1) to modify the gold electrode, freezing, thawing, washing, and blocking to obtain a gold electrode modified with the uric acid aptamer; (3) Auxiliary chain hybridization is introduced on the gold electrode modified with the uric acid aptamer in step (2) to obtain a dual-affinity electrochemical aptamer sensor.
5. The method for preparing a dual-affinity aptamer sensor for uric acid detection with a wide dynamic range according to claim 4, characterized in that: The preparation of the reduced thiolated uric acid aptamer includes: mixing a reducing agent tris(2-carboxyethyl)phosphine and a thiolated uric acid aptamer in a volume ratio of 2:3, and standing at room temperature in the dark for 1 hour to 2 hours; the concentration of the tris(2-carboxyethyl)phosphine is 100 mM, and the concentration of the thiolated uric acid aptamer is 100 μM.
6. The method for preparing a dual-affinity aptamer sensor for uric acid detection with a wide dynamic range according to claim 4, characterized in that: The freezing temperature is -20°C, the freezing time is 7 minutes to 15 minutes, the blocking agent used is 10 mM Tris-HCl buffer containing 1 mM 6-mercaptohexanol (MCH), and the blocking condition is incubation at room temperature for 1 hour to 2 hours.
7. The method for preparing a dual-affinity aptamer sensor for uric acid detection with a wide dynamic range according to claim 4, characterized in that: The concentration of the introduced auxiliary chain is 10 nM-300 nM, and the amount of the auxiliary chain added is 7-10 μL.
8. The method for preparing a dual-affinity aptamer sensor for uric acid detection with a wide dynamic range according to claim 4, characterized in that: The hybridization condition is room temperature reaction for 1 hour.
9. The method for detecting uric acid using a dual-affinity aptamer sensor with a wide dynamic range for uric acid detection according to any one of claims 1 to 3, characterized in that: include: Processing of uric acid samples to be tested; The method comprises the following steps: adding a uric acid sample solution to be tested to the surface of a working electrode of the dual-affinity aptamer sensor for uric acid detection with a wide dynamic range according to any one of claims 1 to 3 to carry out a reaction; placing the working electrode, counter electrode, and reference electrode in a buffer solution, and detecting the electrical signal of the working electrode by square wave voltammetry; and plotting a standard curve based on the electrical signal versus uric acid concentration to achieve quantitative detection of uric acid.
10. The method for detecting uric acid using a dual-affinity aptamer sensor with a wide dynamic range for uric acid detection according to claim 9, characterized in that: The uric acid sample to be tested is treated with a buffer solution having a pH value of 8.3, which is a 20mM Tris-HCl solution containing 10mM MgCl2; the standard curve is drawn by dropping a uric acid sample solution to be tested with a concentration ranging from 0.01μM to 1000μM onto the surface of the working electrode and reacting for 30 minutes; the buffer solution is a phosphate buffer solution containing 100mM NaCl.
Citation Information
Patent Citations
Aptamer electrochemical sensor used for kanamycin A detection and production and application methods of aptamer electrochemical sensor
CN104880498A
Label-free aptamer sensor and method for detecting bisphenol A
CN105784810A