RND superfamily transporter inactivation and use thereof in production of L-amino acids

Abstract

The invention belongs to the technical field of biology, and particularly relates to corynebacterium glutamicum for producing L-amino acid, and RND superfamily transporter in the strain cannot normally play a role. Compared with a wild strain, the strain of which the RND superfamily transporter cannot function normally has the advantages that the yield and the conversion rate of L-amino acid, especially glutamic acid, are improved, the production cost of the L-amino acid can be reduced in production, and a new strategy is provided for large-scale production.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an L-amino acid, especially L-glutamic acid high-yielding strain constructed by inactivating or weakening the expression of RND superfamily transporter and its application. Background Art

[0002] Corynebacterium glutamicum is an important industrial microorganism, widely used in the fermentation production of bulk chemicals such as L-glutamic acid and L-lysine. The cell wall of Corynebacterium glutamicum is divided into two layers, the inner and outer layers. The inner layer is mainly composed of peptidoglycan, arabinogalactose and mycolic acid covalently linked to form mAGP complex, which constitutes the main permeability barrier, among which the lipid components mainly composed of mycolic acid play a key role. Mycolic acid is synthesized intracellularly and is mainly composed of long-chain α-alkyl-β-hydroxy fatty acids. It is transported to the outside of the cell membrane in the form of trehalose corynomycolates (TMCM), converted into trehalose dicorynomycolates (TDCM) and participates in the synthesis of the cell wall. The resistance–nodulation–cell division (RND) superfamily transporter is mainly responsible for the efflux of TMCM. This type of protein is called MmpLs (Mycobacterial membrane protein Large) in mycobacteria. There are 14 mmpL genes in the genome of mycobacterium, among which MmpL3 is essential in mycobacteria. Its deletion will lead to the loss of TDCM in the cell wall, resulting in increased sensitivity of the bacteria to antibiotics (Chemistry & Biology, 2012, 19(4), 498-506).

[0003] There are 4 genes CmpL1 (GeneID is cgl2867 or NCgl2769), CmpL2 (GeneID is cgl0924 or NCgl0887), CmpL3 (GeneID is cgl0625 or NCgl0559) and CmpL4 (GeneID is cgl0231 or NCgl0228) annotated as MmpL homologues in the Corynebacterium glutamicum genome, wherein CmpL1 and CmpL4 have the predicted topological structure (12 TM domains and 2 non-TM loops) similar to MmpL3 of Mycobacterium tuberculosis. Four kinds of efflux proteins are all involved in the synthesis and transport of lipid components in the cell wall of Corynebacterium glutamicum, but there are certain differences in substrate specificity and transport efficiency (Microbiology Open, 2014, 3 (4), 484-496).

[0004] Since the cell membrane wall structure of Corynebacterium glutamicum has an important influence on the synthesis and secretion of L-amino acids, however, there are currently few reports on the modification of cell membrane wall-related genes of Corynebacterium glutamicum. Therefore, the art needs to further modify targets that may affect the membrane wall structure, thereby increasing the yield of L-amino acids in the strain. Summary of the invention

[0005] Since the RND superfamily transporter is responsible for the efflux of TMCM, we speculate that the transformation of the RND superfamily transporter may improve the L-amino acid, especially the L-glutamic acid output of the strain. Therefore, the present invention has found through experiments that the inactivation of the RND superfamily transporter (CmpL1, CmpL2, CmpL3 and CmpL4) in Corynebacterium glutamicum can improve the L-glutamic acid output and conversion rate of the strain, and reduce production costs. On this basis, the present invention is completed.

[0006] In a first aspect, the present invention provides an L-amino acid-producing Corynebacterium glutamicum, in which an RND superfamily transporter protein cannot function normally. Specifically, the RND superfamily transporter protein cannot function normally means that the RND superfamily transporter protein is inactivated or the expression of its encoding gene is weakened.

[0007] Among them, the "RND superfamily transporter" described in this article refers to the protein responsible for the efflux transporter TMCM from Corynebacterium glutamicum, including 4 proteins, namely CmpL1 (amino acid sequence as shown in SEQ ID NO: 1, nucleotides as shown in SEQ ID NO: 5), CmpL2 (amino acid sequence as shown in SEQ ID NO: 2, nucleotides as shown in SEQ ID NO: 6), CmpL3 (amino acid sequence as shown in SEQ ID NO: 3, nucleotides as shown in SEQ ID NO: 7) and CmpL4 (amino acid sequence as shown in SEQ ID NO: 4, nucleotides as shown in SEQ ID NO: 8). As used herein, the RND superfamily transporter is not specifically limited as long as it has the corresponding activity, and it may be derived from Corynebacterium glutamicum, but is not limited thereto, for example, in Corynebacterium glutamicum ATCC13869, CmpL1 is encoded by a gene with Gene ID BBD29_RS14025, CmpL2 is encoded by a gene with Gene ID BBD29_RS05080, CmpL3 is encoded by a gene with Gene ID BBD29_RS03570, and CmpL4 is encoded by a gene with Gene ID BBD29_RS01380. For example, the RND superfamily transporter may be a wild-type sequence of an amino acid sequence such as SEQ ID NO: 1-4 or an amino acid sequence having at least 75%, specifically at least 80%, more specifically 85%, and even more specifically 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher homology. In addition, if the amino acid sequence has homology with the above-mentioned sequence and has substantially the same or corresponding biological activity with the protein of SEQ IDNO:1-4, it is obvious that the amino acid sequence with deletion, modification, substitution or addition should also belong to the scope of the present disclosure. In the present invention, any polynucleotide sequence encoding the RND superfamily transporter can belong to the scope of the present disclosure. For example, the polynucleotide sequence can be a polynucleotide sequence with at least 75%, specifically at least 80%, more specifically 85%, and even more specifically 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher homology with the polynucleotide sequence of SEQ IDNO:5-8. In addition, based on codon degeneracy or considering the preferred codons of organism expression protein, the polynucleotide sequence of encoding protein can have various variants on the coding region within the scope of not changing the amino acid sequence of the protein expressed from the coding region.

[0008] The term "homology" of the present invention refers to the percentage of identity between two polynucleotides or polypeptide parts. The homology between the sequence of one part and another part can be measured by techniques known in the art. For example, homology can be measured by directly arranging the sequence information of two polynucleotide molecules or two polypeptide molecules using an easily available computer program. Examples of computer programs can include BLAST (NCBI), CLC Main Workbench (CLCbio), MegAlignTM (DNASTAR Inc.), etc. In addition, the homology between polynucleotides can be measured by the following steps: hybridizing polynucleotides under conditions of forming stable double chains between homologous regions, decomposing using single-stranded specific nucleases, and then measuring the size of the decomposed fragments.

[0009] The "polypeptide", "peptide" and "protein" are used interchangeably herein and are amino acid polymers of any length. The polymer may be linear or branched, it may contain modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).

[0010] The "failure to function normally" means that, compared with the wild-type strain, the expression of the gene encoding the RND superfamily transporter is reduced, weakened or even completely eliminated, or that a gene is not expressed, or that although expressed, the expression product is inactive or has reduced activity.

[0011] In a specific embodiment, compared to the wild-type or endogenous polypeptide, the transcription, expression or activity of the encoded protein of the mutated gene is reduced by at least 30%, preferably at least 40%, more preferably at least 50%, for example at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%, or the gene encoding the wild-type or endogenous polypeptide is removed.

[0012] The "cannot function normally" can be achieved by modification, including but not limited to by deleting part or all of the coding genes, gene reading frame shift mutation, weakening transcription or translation intensity, or using the corresponding enzyme or protein with lower activity or alleles encoded, or making the corresponding gene or enzyme inactive, and optionally using these methods in combination. The reduction of gene expression can be achieved by adopting the genetic modification (mutation) of the signal structure of suitable culture method or gene expression, for example, the signal structure of gene expression is a repressor gene, an active gene, an operator, a promoter, a weakener, a ribosome binding site, a start codon and a terminator. Based on the teaching of the present disclosure, those skilled in the art know that the output of L-amino acid can be increased by inactivating the coding gene of the RND superfamily transporter, or making the RND superfamily transporter unable to function normally in the cell. Those skilled in the art can achieve the above purpose by technical means known in the art.

[0013] The "wild type" refers to objects that can be found in nature, including natural strains, natural genes and proteins, etc. For example, a polypeptide or polynucleotide sequence that exists in an organism, can be isolated from a source in nature and has not been intentionally modified by humans in the laboratory is naturally occurring. As used in the present disclosure, "naturally occurring" and "wild type" are synonyms. In some embodiments, the wild-type RND superfamily transporter in the present disclosure refers to wild-type RND superfamily transporters, i.e., CmpL1, CmpL2, CmpL3, CmpL4, and polypeptides having amino acid sequences such as the amino acid sequences shown in SEQ ID NOs: 1-4.

[0014] The Corynebacterium glutamicum of the present invention includes but is not limited to Corynebacterium glutamicum ATCC 13869, Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067, and mutants or strains produced by the above strains for producing L-glutamic acid.

[0015] In some embodiments, the glutamate producing strain may be a strain obtained by transformation based on Corynebacterium glutamicum ATCC 13032 or Corynebacterium glutamicum ATCC13869, wherein the transformation includes but is not limited to one or more genes selected from the following being enhanced or overexpressed:

[0016] a. yggB gene encoding mechanosensitive channel protein (CN108250278A);

[0017] b. fxpk gene encoding phosphoketolase (WO2006016705A1);

[0018] c. pyc gene encoding pyruvate carboxylase (WO2004069996A2);

[0019] d. gdh gene encoding glutamate dehydrogenase (CN103205390A);

[0020] e. Gene encoding carbonic anhydrase (WO2011024583A1).

[0021] In some embodiments, the glutamate producing strain may also have one or more genes selected from the group consisting of, but not limited to, the following attenuated or reduced in expression:

[0022] a. odhA gene encoding α-ketoglutarate dehydrogenase (WO2006028298A2);

[0023] b. amtR gene encoding a transcriptional regulatory gene (EP2276845A1);

[0024] c. acnR gene encoding a transcription repressor (CN111334535A).

[0025] In a specific embodiment of the present invention, the host cell is Corynebacterium glutamicum, which is further improved by introducing A111V mutation into the NCgl1221 homologous gene (BBD29_06760 or yggB) in the bacteria and C361Y into the GltA coding gene to obtain the glutamate producing strain SCgGC7.

[0026] In some embodiments, the lysine production strain may be a strain expressing aspartate kinase LysC that releases feedback inhibition based on Corynebacterium glutamicum ATCC 13032. In some embodiments, the lysine production strain may also have one or more genes selected from the group consisting of, but not limited to, the following weakened or reduced in expression:

[0027] a. adhE gene encoding alcohol dehydrogenase;

[0028] b. ackA gene encoding acetate kinase;

[0029] c. pta gene encoding phosphate acetyltransferase;

[0030] d. ldhA gene encoding lactate dehydrogenase;

[0031] e. focA gene encoding formate transporter;

[0032] f. pflB gene encoding pyruvate formate lyase;

[0033] g. poxB gene encoding pyruvate oxidase;

[0034] h. thrA gene encoding the bifunctional enzyme aspartate kinase I / homoserine dehydrogenase I;

[0035] i. thrB gene encoding homoserine kinase;

[0036] j. ldcC gene encoding lysine decarboxylase; and

[0037] h. cadA gene encoding lysine decarboxylase.

[0038] In some embodiments, the lysine-producing strain may also have one or more genes selected from the following enhanced or overexpressed, including but not limited to:

[0039] a. dapA gene encoding dihydrodipyridine synthase that relieves lysine feedback inhibition;

[0040] b. dapB gene encoding dihydrodipicolinate reductase;

[0041] c. ddh gene encoding diaminopimelate dehydrogenase;

[0042] d. dapD encoding tetrahydropicolinate succinylase and dapE encoding succinyl diaminopimelate deacylase;

[0043] e. asd gene encoding aspartate-semialdehyde dehydrogenase;

[0044] f. ppc gene encoding phosphoenolpyruvate carboxylase;

[0045] g. pntAB gene encoding nicotinamide adenine dinucleotide transhydrogenase;

[0046] i. The gene encoding the lysine transport protein lysE.

[0047] In a second aspect, the present invention provides the use of the RND superfamily transporter or its encoding nucleotide in improving the yield and conversion rate of L-amino acids. Specifically, the L-amino acids are glutamic acid, L-lysine, L-threonine, L-isoleucine, L-leucine, L-proline, L-hydroxyproline, L-arginine, L-ornithine, L-citrulline, and 5-aminolevulinic acid.

[0048] In a third aspect, the present invention provides a method for producing L-amino acids, the method comprising culturing the host cell of the first aspect to produce L-amino acids, and further comprising the step of separating, extracting or recovering the L-amino acids from the culture medium.

[0049] In the present invention, the host cells can be cultured according to conventional methods in the art, including but not limited to well plate culture, shake flask culture, batch culture, continuous culture and fed-batch culture, etc., and various culture conditions such as temperature, time and pH value of the culture medium can be appropriately adjusted according to actual conditions.

[0050] Beneficial effects of the present invention: The strain in which the RND superfamily transporter protein cannot function normally provided by the present invention has improved production and conversion rate of L-amino acids, especially L-glutamic acid, compared with the wild-type strain, which can reduce the production cost of L-amino acids in production and provide a new strategy for large-scale production. DETAILED DESCRIPTION

[0051] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used to implement or test the present invention, the methods and materials provided herein are preferred.

[0052] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental techniques and experimental methods used in the examples are all conventional technical methods unless otherwise specified. For example, the experimental methods in the following examples that do not specify specific conditions are usually carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. The materials, reagents, etc. used in the examples can be obtained through regular commercial channels unless otherwise specified.

[0053] The culture medium used in the examples is as follows:

[0054] The components of TSB plate culture medium are (g / L): glucose, 5g / L; yeast powder, 5g / L; soy peptone, 9g / L; urea, 3g / L; succinic acid, 0.5g / L; K2HPO4·3H2O, 1g / L; MgSO4·7H2O, 0.1g / L; biotin, 0.01mg / L; vitamin B1, 0.1mg / L; MOPS, 20g / L; agar powder, 15g / L.

[0055] The components of TSB liquid culture medium are (g / L): glucose, 5g / L; yeast powder, 5g / L; soy peptone, 9g / L; urea, 3g / L; succinic acid, 0.5g / L; K2HPO4·3H2O, 1g / L; MgSO4·7H2O, 0.1g / L; biotin, 0.01mg / L; vitamin B1, 0.1mg / L; MOPS, 20g / L.

[0056] The components of the seed culture medium used in the glutamate fermentation experiment are: glucose, 25g / L; KH2PO4·3H2O, 2.2g / L; urea, 3g / L; corn steep liquor, 33mL; MgSO4·7H2O, 0.9g / L; soybean cake hydrolyzate, 22mL; MOPS, 20g / L; initial pH 7.2.

[0057] The components of the fermentation medium used in the glutamate fermentation experiment are: glucose, 80g / L; KH2PO4, 1g / L; urea, 10g / L; corn steep liquor powder, 5g / L; MgSO4·7H2O, 0.4g / L; FeSO4·7H2O, 10mg / L; MnSO4·4H2O, 10mg / L; VB1, 200μg / L; MOPS, 40g / L; initial pH 7.5.

[0058] Example 1. Construction of a CmpLs-deficient strain of Corynebacterium glutamicum

[0059] In order to verify the effect of knocking out CmpLs on glutamate synthesis, we modified a strain with the ability to synthesize glutamate, SCgGC7 (for strain information and construction process, refer to CN115927325A).

[0060] The homologous proteins of CmpL1-CmpL4 in Corynebacterium glutamicum ATCC13869 are encoded by genes with Gene IDs BBD29_RS14025, BBD29_RS05080, BBD29_RS03570, and BBD29_RS01380, respectively. According to the reported sequence in Corynebacterium glutamicum ATCC 13869 (the amino acid sequence is shown in SEQ ID NOs: 1-4, and the nucleotide sequence is shown in SEQ ID NOs: 5-8), primers cmpL1-UH-F / cmpL1-UH-R and cmpL1-DH-F / cmpL1-DH-R, cmpL2-UH-F / cmpL2-UH-R and cmpL2-DH-F / cmpL2-DH-R, cmpL3-UH-F / cmpL3-UH-R and cmpL3-DH-F / cmpL3-DH-R, cmpL4-UH-F / cmpL4-UH-R and cmpL4-DH-F / cmpL4-DH-R were designed respectively, and the upstream and downstream homologous arms of CmpL1, CmpL2, CmpL3 and CmpL4 were obtained by PCR amplification using the ATCC 13869 genome as a template. Primers pK-F / R were designed based on the sequence information of plasmid pK18mobsacB, and the linearized vector fragment was obtained by reverse PCR amplification using plasmid pK18mobsacB as a template. The upstream homology arm and downstream homology arm fragments were purified and recombined with the linearized vector fragment to obtain the editing vectors pK18-ΔCmpL1, pK18-ΔCmpL2, pK18-ΔCmpL3, and pK18-ΔCmpL4 for deleting the CmpL1, CmpL2, CmpL3, and CmpL4 genes.

[0061] SCgGC7 competent cells were prepared by the method reported in the literature (Biotechnology Letters, 2015, 37: 2445-52.), and 1 μg of pK18-ΔCmpL1, pK18-ΔCmpL2, pK18-ΔCmpL3, and pK18-ΔCmpL4 plasmids were electroporated into the competent cells prepared above, 1 mL of TSB medium preheated at 46°C was added, incubated at 46°C for 6 min, incubated at 30°C for 3 h, coated with TSB solid medium containing 25 μg / mL kanamycin, and cultured at 30°C for 1 day to obtain the first recombinant transformants. The correct transformants were transferred to TSB medium containing 5 g / L glucose for overnight culture, and then transferred to TSB medium containing 100 g / L sucrose. After culturing at 30°C for 6 h, they were coated on TSB medium supplemented with 100 g / L sucrose for screening, and L-glutamic acid producing strains SCgGC7-ΔCmpL1, SCgGC7-ΔCmpL2, SCgGC7-ΔCmpL3, and SCgGC7-ΔCmpL4 were obtained. The primers used in this example are shown in Table 1.

[0062] Table 1. Primers used in this example

[0063] Primer Nucleotide sequence cmpL1-UH-F tgacatgattacgaattcCCCTGAAAGTGTCCTTCTAGTGTG cmpL1-UH-R aatgacaaacaaagccaaaatcgcg cmpL1-DH-F ttggctttgtttgtcattggtttgagcacgcaggaaaac cmpL1-DH- cgacggccagtgccaagcttGATCAGTGACCATAAGTTCAGCGAT cmpL2-UH-F tgacatgattacgaattcCATCGAACTTGTCAAGGTCTTTGTC cmpL2-UH-R cccaacgttgatgttgaaggtg cmpL2-DH-F aacatcaacgttggggatacctatgagaatcacgagccag cmpL2-DH-R cgacggccagtgccaagcttGATTATCCTCGCTCAGGATGGATTT cmpL3-UH-F tgacatgattacgaattcTGCCAAGTCACGGAGAAAGTTAATT cmpL3-UH-R gtgcctgctttgttctacgaca cmpL3-DH-F gtagaacaaagcaggcacgacctcactaaccttgccaaaat cmpL3-DH-R cgacggccagtgccaagcttGGGTGAGTTTCTTGATGTGGGATTA cmpL4-UH-F tgacatgattacgaattcCAAAGTAAGAACCGGTTCTCAGGTA cmpL4-UH-R aacaatggccaaaataagtagccat cmpL4-DH-F cttattttggccattgttcctaagtggctggatcgaattctg cmpL4-DH-R cgacggccagtgccaagcttCCATCGATAACAGATTTGAAATCCA pK-F AAGCTTGGCACTGGCCGTCG pK-R GAATTCGTAATCATGTCATAGCTGT

[0064] Example 2: Effect of CmpLs Deficiency on L-Glutamate Production

[0065] In order to verify the effect of knocking out CmpLs on glutamate production, fermentation tests were carried out on the above-constructed strains SCgGC7-ΔCmpL1, SCgGC7-ΔCmpL2, SCgGC7-ΔCmpL3, and SCgGC7-ΔCmpL4, and strain SCgGC7 was used as a control.

[0066] Strains SCgGC7, SCgGC7-ΔCmpL1, SCgGC7-ΔCmpL2, SCgGC7-ΔCmpL3, and SCgGC7-ΔCmpL4 were inoculated into seed medium and cultured for 8 h. The cultures were inoculated as seeds into 24-well plates containing 800 μL of fermentation medium per well, and the initial OD 600 The control was about 0.5, the speed of the well plate shaker was 800 rpm, 3 parallels were made for each strain, cultured at 30°C, 5 g / L urea was added after 23 hours, and the fermentation was completed after 25 hours. The OD at the end of the fermentation was detected. 600 , L-glutamic acid production and glucose consumption, and calculated the sugar acid conversion rate from glucose to L-glutamic acid. The results are shown in Table 2.

[0067] Table 2. L-glutamic acid yield and sugar-acid conversion rate

[0068] Strain <![CDATA[OD 600 ]]> L-Glutamic acid (g / L) Glucose consumption (g / L) Glucose-acid conversion rate (g / g, %) SCgGC7 12.05±0.55 10.47±0.23 74.53±0.95 14.04±0.23 SCgGC7-ΔCmpL1 9.22±0.50 10.13±0.42 64.80±0.20 15.64±0.63 SCgGC7-ΔCmpL2 12.23±0.13 11.07±0.23 76.33±0.95 14.50±0.30 SCgGC7-ΔCmpL3 11.53±0.18 10.80±0.31 80.00±0.00 14.43±0.38 SCgGC7-ΔCmpL4 12.12±0.35 12.00±0.20 76.60±1.20 15.67±0.26

[0069] As can be seen from the table, CmpL2, CmpL3 and CmpL4 deletions can improve L-glutamic acid output and sugar acid conversion rate, and although CmpL1 deletion does not improve L-glutamic acid output, the sugar acid conversion rate is significantly improved. In view of the fact that CmpL1-CmpL4 all have the function of trehalose monomycolate efflux, the deletion of any protein can reduce the function of the entire RND transport system, so the above results show that the RND transport system of weakened Corynebacterium glutamicum is conducive to the production of glutamic acid, and has a good application prospect in the production of L-glutamic acid and its derivatives. In addition, because the cell membrane wall structure of Corynebacterium glutamicum has an important impact on the synthesis and secretion of L-amino acid, therefore, it is known that the RND transport system of weakened Corynebacterium glutamicum is equally conducive to the production of L-amino acids such as L-lysine, L-threonine, L-isoleucine, L-leucine, L-proline, L-hydroxyproline, L-arginine, L-ornithine, L-citrulline, 5-aminolevulinic acid.

Claims

1. A Corynebacterium glutamicum producing L-amino acids, wherein the RND superfamily transporter in the strain cannot function normally, specifically, the RND superfamily transporter cannot function normally refers to the inactivation of the RND superfamily transporter or the weakened expression of the RND superfamily transporter gene.

2. The Corynebacterium glutamicum according to claim 1, characterized in that The RND superfamily transporter is one or more of CmpL1, CmpL2, CmpL3 and CmpL4.

3. The Corynebacterium glutamicum according to any one of claims 1 to 2, characterized in that The starting bacteria are Corynebacterium glutamicum ATCC 13869, Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067, and mutants or strains producing L-amino acids prepared from the above strains.

4. The Corynebacterium glutamicum according to claim 3, characterized in that The starting bacteria are L-glutamic acid producing strains obtained by transformation on the basis of Corynebacterium glutamicum ATCC13032 and Corynebacterium glutamicum ATCC13869, wherein the transformations include but are not limited to one or more genes selected from the following being enhanced or overexpressed: a. Encoding mechanosensitive channel proteins ygB Gene; b. Encoding phosphoketolase fxpk Gene; c. Encoding pyruvate carboxylase pyc Gene; d. Encoding glutamate dehydrogenase gd Gene; e. Gene encoding carbonic anhydrase.

5. The Corynebacterium glutamicum according to claim 4, characterized in that The starting bacteria may also include, but are not limited to, one or more genes selected from the following being weakened or having reduced expression: a. Encoding α-ketoglutarate dehydrogenase odhA Gene; b. Encoding transcriptional regulatory genes ikB Gene; c. Encoding transcriptional repressors acn Gene.

6. The Corynebacterium glutamicum according to claim 5, characterized in that The starting bacteria are further improved, wherein NCgl1221 The A111V mutation was introduced into the homologous gene, and the C361Y mutation was introduced into the GltA encoding gene.

7. The Corynebacterium glutamicum according to claim 3, characterized in that The starting bacteria is a strain expressing aspartate kinase LysC that releases feedback inhibition based on Corynebacterium glutamicum ATCC13032 to obtain a lysine producing strain; preferably, one or more genes selected from the following in the lysine producing strain are weakened or the expression is reduced: a. Encoding alcohol dehydrogenase adhE Gene; b. Encoding acetate kinase ackA Gene; c. Encoding phosphate acetyltransferase pta Gene; d. Encoding lactate dehydrogenase oeLh Gene; e. Encoding formate transporter foc Gene; f. Encoding pyruvate formate lyase pB Gene; g. Encoding pyruvate oxidase poxB Gene; h. Encoding bifunctional aspartate kinase I / homoserine dehydrogenase I thrA Gene; i. Encoding homoserine kinase tB Gene; j. Encoding lysine decarboxylase LqCy Gene; and h. Encoding lysine decarboxylase cadA Gene; Further preferably, in the lysine-producing strain, one or more genes selected from the following may be enhanced or overexpressed, including but not limited to: a. Encoding a dihydrodipyridine synthase that relieves lysine feedback inhibition dapA Gene; b. Encoding dihydrodipicolinate reductase dapB Gene; c. Encoding diaminopimelate dehydrogenase dhdh Gene; d. Encoding tetrahydropicolinate succinylase dapD and a gene encoding succinyldiamidinopimelate deacylase dapE ; e. Encoding aspartate semialdehyde dehydrogenase asd Gene; f. Encoding phosphoenolpyruvate carboxylase ppc Gene; g. Encoding nicotinamide adenine dinucleotide transhydrogenase pntAB Gene; i. Lysine transport protein lysE Gene.

8. A method for producing L-amino acids, characterized in that The method comprises culturing the Corynebacterium glutamicum as claimed in any one of claims 1 to 7 to produce L-amino acids, and further comprises the step of separating, extracting or recovering the L-amino acids from the culture medium.

9. Use of RND superfamily transporter proteins or their encoding polynucleotides in producing L-amino acids in Corynebacterium glutamicum.

10. The use according to claim 9, characterized in that The RND superfamily transporter is one or more of CmpL1, CmpL2, CmpL3 and CmpL4 proteins; preferably, the L-amino acid is L-glutamic acid, L-lysine, L-threonine, L-isoleucine, L-leucine, L-proline, L-hydroxyproline, L-arginine, L-ornithine, L-citrulline, 5-aminolevulinic acid.