Tobacco NtTPS21 gene as well as encoding protein and application thereof

Abstract

The invention discloses a tobacco NtTPS21 gene as well as an encoding protein and application thereof. According to the application of the tobacco NtTPS21 gene in regulating the growth period of the tobacco, the nucleotide sequence of the tobacco NtTPS21 gene is shown as SEQ ID NO. 1. According to the invention, NtTPS21 overexpressed transgenic tobacco is created through an agrobacterium tumefaciens-mediated transgenic technology, and three homozygous strains are obtained through screening. Investigation and analysis of field agronomic traits of wild type and transgenic tobaccos show that overexpression of the NtTPS21 can reduce the plant height of the tobaccos and postpone the growth period for 15-25 days, but main field economic traits such as leaf number, leaf length, leaf width and the like are not affected, which indicates that the NtTPS21 may participate in the regulation and control process from vegetative growth to reproductive growth of the tobaccos. The NtTPS21 gene is expected to be used as a target gene for adjusting the growth period of tobacco.

Description

Technical Field

[0001] The invention belongs to the field of biological agriculture and relates to a tobacco NtTPS21 gene and a coded protein and application thereof. Background Art

[0002] Terpenoids play an essential role in plant growth, development and stress resistance [1] A large number of studies have found that terpenoids can directly or indirectly participate in plant defense and have many physiological and ecological effects in plants. Some volatile terpenoids can act as an attractant, which is beneficial for pollinators to forage, or increase the aroma of food and improve the flavor. At the same time, many natural terpenoid compounds have been shown to have certain pharmacological effects. [2] , such as the diterpenoid compound paclitaxel, which plays an important role in tumor immunity and has good anticancer activity [3] Terpene synthase is the most important downstream catalytic enzyme in the biosynthesis of terpene compounds in plants, mainly including monoterpene synthase, sesquiterpene synthase, diterpene synthase, etc. In plants, terpene synthase is encoded by a large number of TPS family genes. Different member genes in the family catalyze the production of terpene end products with diverse structures. These large and complex TPS family genes are an important reason for the diversification of natural terpene compounds in plants. [4] At present, TPS genes in many plants such as Arabidopsis, rice, wheat, yew, Artemisia annua, cotton and morning glory have been well cloned and identified. [5] There are also a large number of TPS genes in the tobacco genome. However, there are very limited reports on the cloning of tobacco TPS genes and their role in regulating plant growth and development. TPS genes in tobacco need to be further explored and identified.

[0003] Leaves are the main organs for photosynthesis in plants, and plants invest a lot of energy and substances to promote leaf growth. Once the flowering period begins, the plant's vegetative growth will shift to reproductive growth, and nutrients and energy will be transferred to flower organs and seeds. The leaves begin to age, and the photosynthetic efficiency decreases significantly. [6-9] The process of plant aging can greatly affect the benefits of agricultural production, such as food yield and quality. According to estimates on major crops (corn, soybeans, cotton, rice, wheat), if the late functional leaves age one day later, the yield can increase by 2-10%. Therefore, appropriately extending the growth period of crops is of great significance to agricultural production. [6-9] In recent years, due to abnormal climate or environmental stress

[10] , the phenomenon of early flowering of tobacco occurs from time to time. Tobacco is an economic crop mainly based on leaves. Early flowering will cause tobacco to prematurely switch from vegetative growth to reproductive growth, resulting in reduced tobacco leaf yield, a higher proportion of upper leaves and a higher nicotine content.

[11] , causing heavy economic losses to tobacco farmers.

[0004] Dwarfing is an important agronomic trait that has attracted more and more attention because it can improve planting density, make full use of space and land, enhance photosynthetic efficiency, increase yield, reduce pruning rate, reduce water consumption rate, and resist lodging. Therefore, appropriately reducing crop height and cultivating new dwarf crop varieties are also hot topics in current crop breeding. For example, dwarfing and dense planting can promote the growth of ginkgo, improve nutrient absorption, cultivate high-yield tree shapes, increase pollination rates, and facilitate management, thereby promoting high yields of ginkgo.

[12] Dwarfing increases the light transmittance of corn fields, fully enables photosynthesis, increases nutrient accumulation, enhances stress resistance, and thus increases yield.

[13] .

[0005] In summary, growth period and plant height are important agronomic traits of crops. Regulating tobacco growth period and plant height is crucial to tobacco leaf production, but so far, research on the regulation of tobacco growth period and plant height is relatively scarce. Summary of the invention

[0006] The purpose of the present invention is to provide a method for regulating tobacco growth period and plant height by using tobacco NtTPS21 gene in response to the needs of modern agricultural breeding.

[0007] The purpose of the present invention can be achieved through the following technical solutions:

[0008] The application of tobacco NtTPS21 gene in regulating tobacco plant height and growth period, the nucleotide sequence of the tobacco NtTPS21 gene is shown in SEQ ID NO.1.

[0009] As a preferred embodiment of the present invention, overexpression of tobacco NtTPS21 gene can reduce tobacco plant height and delay growth period.

[0010] A method for delaying the growth period of tobacco and reducing plant height, wherein a tobacco NtTPS21 gene overexpression vector is introduced into wild-type tobacco to obtain transgenic tobacco with reduced plant height and extended growth period, but main field agronomic traits such as leaf number, leaf length and leaf width are not affected.

[0011] Beneficial effects:

[0012] The present invention isolates and identifies the NtTPS21 gene in tobacco, creates transgenic tobacco with overexpression of NtTPS21 through Agrobacterium-mediated transgenic technology, and screens and obtains three homozygous strains. Investigation and analysis of the field agronomic traits of wild-type and transgenic tobacco found that overexpression of NtTPS21 can reduce tobacco plant height and delay the growth period by 15-25 days, but major field agronomic traits such as leaf number, leaf length, and leaf width are not affected, indicating that NtTPS21 may be involved in the regulation process of tobacco from vegetative growth to reproductive growth. The NtTPS21 gene is expected to be used as a target gene to regulate the growth period of tobacco. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Schematic diagram of part of NtTPS21 overexpression vector

[0014] Figure 2 Detection of expression levels of different strains of T2 generation NtTPS21 overexpression materials

[0015] WT represents wild-type control; OE-1 to OE-8 represent different strains overexpressing NtTPS21. Different letters indicate significant differences at the P<0.05 level.

[0016] Figure 3 Field phenotypes of NtTPS21 overexpression lines and wild-type controls (a) Wild-type control single plant in the field; (b) NtTPS21 overexpression line single plant in the field; (c) Wild-type control (WT) and NtTPS21 overexpression line (OE) field population

[0017] Figure 4 .Plant height of NtTPS21 overexpressing strains and wild-type controls

[0018] WT represents wild-type control; OE-2, OE-3, and OE-4 represent different strains overexpressing NtTPS21. Different letters indicate significant differences at the P<0.05 level.

[0019] Figure 5 Other agronomic traits of NtTPS21 overexpression lines and wild-type controls

[0020] WT represents wild-type control; OE-2, OE-3, and OE-4 represent different strains overexpressing NtTPS21. Different letters indicate significant differences at the P < 0.05 level. (a) Leaf length of the middle leaf of the NtTPS21 overexpressing strain and the wild-type control; (d) Leaf width of the middle leaf of the NtTPS21 overexpressing strain and the wild-type control; (c) Leaf number of the NtTPS21 overexpressing strain and the wild-type control. DETAILED DESCRIPTION

[0021] The tobacco used in the experiment was common cultivated tobacco (Nicotiana tabacum.L). Homologous recombinase and DH5α competent cells were purchased from Nanjing Novozyme Biotechnology Co., Ltd., LB4404 competent cells were purchased from Weidi Biotechnology Co., Ltd., MS medium, kanamycin (Kan), NAA, 6-BA, and ceftriaxone were purchased from Solebao Biotechnology Co., Ltd.

[0022] Example 1 Creation and identification of NtTPS21 overexpression material

[0023] (1) Construction of plant expression vector overexpressing NtTPS21 and preparation of Agrobacterium

[0024] The commercial plant binary expression vector pCAMBIA1305.1 was used as the basic skeleton to construct a plant expression vector for overexpression of NtTPS21. The schematic diagram of the vector construction is shown in Figure 1 As shown. The pCAMBIA1305.1 vector was digested with EcoRI and PstI, and the linearized pCAMBIA1305.1 vector was recovered with a DNA recovery kit (for specific methods, refer to the instructions for EcoRI and PstI restriction endonucleases of Quanshijin and the Novagen gel recovery kit). Specific primers NtTPS21-F: GACATAGACTACCTAATTCGTC and NtTPS21-R: TACCTTTCGTTGAGATGCTG were designed. Using the cDNA of common tobacco leaves as a template, NtTPS21-F and NtTPS21-R as primers, the CDS sequence of NtTPS21 was amplified. The specific PCR reaction system was: cDNA 2.5μL, 2×Phanta Max Master Mix 25μL, NtTPS21-F and NtTPS21-R primers 2.5μL each, and ddH2O was added to the reaction system to 50uL. The PCR reaction program was: 95℃ pre-denaturation for 3min; 95℃ denaturation for 15s, 55℃ annealing for 15s, 72℃ extension for 100s, for a total of 35 cycles; 72℃ extension for 10min, and the product size was 1671bp. After the PCR product was verified by agarose gel electrophoresis and sequencing, the CDS sequence of NtTPS21 was obtained and named NtTPS21-CDS.

[0025] Design the following homologous recombination primers:

[0026] T21-1305-F:GTGGATTGATGTGATAATGGATTTGAGCAAAGGCTTGC;

[0027] T21-1305-R:GCCAAGCTTGCATGCCTGCAGTTATGGAACAGGATCAACCAATATTG;

[0028] 35S-1305-F:TATGACCATGATTACGAATTCGTGGAGCACGACACACTTGTCTA;

[0029] 35S-1305-R:CCATTATCACATCAATCCACTTGCTTTGA

[0030] The pCAMBIA1305.1 vector plasmid was used as a template, and 35S-1305-F and 35S-1305-R were used as primers for PCR to amplify the 35S promoter fragment for homologous recombination. The specific PCR system was: 2.5 μL of pCAMBIA1305.1 plasmid, 25 μL of 2×PhantaMax Master Mix, 2.5 μL of 35S-1305-F and 35S-1305-R primers, and ddH2O was added to the reaction system to 50 uL. The PCR reaction program was: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 55°C annealing for 15 s, 72°C extension for 1 min, for a total of 35 cycles; 72°C extension for 5 min. The PCR product of NtTPS21-CDS was used as a template, T21-1305-F and T21-1305-R were used as primers to amplify the CDS fragment of NtTPS21 for homologous recombination. The 35S promoter fragment and the CDS fragment of NtTPS21 were recombined into the linearized pCAMBIA1305.1 vector using the ClonExpress II OneStep Cloning Kit of Novozymes to obtain the recombinant product (for specific operation steps, refer to the ClonExpress II OneStep Cloning Kit of Novozymes). Take out the DH5α competent cells from the -80℃ refrigerator and place them on ice to melt; when the competent cells are in a molten state, add 2uL of the recombinant product, flick with your fingers to mix, and let it stand on ice for 30min; heat shock in a 42℃ water bath for 30s, and let it stand on ice for 2min; add 900uL of empty LB culture medium to the clean bench, shake at 37℃, and culture at 200rpm for 1h; centrifuge at 4000rpm for 2min to separate the supernatant and bacterial precipitate; aspirate 800uL of supernatant, resuspend the remaining supernatant and precipitate evenly, aspirate 100uL and evenly apply it to the LB solid culture medium containing Kan resistance, and incubate it in an incubator at 37℃ for 10-14h. Pick a single colony for sequencing verification. After sequence alignment, shake the correct colony and extract the plasmid to obtain the NtTPS21 overexpression vector plasmid, named NtTPS21-1305.

[0031] Take the competent Agrobacterium tumefaciens LB4404 stored at -80℃ and melt it on ice. When it is in an ice-water mixing state, add 3uL of NtTPS21-1305 plasmid, flick to mix, and stand on ice for 5min; quick freeze in liquid nitrogen for 5min; heat shock in a 37℃ water bath for 5min, and immediately stand on ice for 5min; add 700uL of antibiotic-free LB liquid culture medium to the clean bench, shake at 28℃, and shake at 200rpm for 2h; aspirate 600uL of supernatant, resuspend the remaining supernatant and the precipitate evenly, aspirate 100uL and evenly apply it to LB solid culture medium containing 50mg / L kanamycin and 25mg / L rifampicin, incubate in a 37℃ incubator, invert and culture for 2-3d, then pick a single colony for sequencing verification. Add 30% glycerol to the positive Agrobacterium with correct sequence at a ratio of 1:1 and store at -80℃ for use.

[0032] (2) Creation of transgenic tobacco overexpressing NtTPS21

[0033] Place common cultivated tobacco seeds in a 2mL sterile EP tube, add 1.5mL 75% ethanol to disinfect for 30s in a clean bench; use a sterile pipette to suck out the ethanol, rinse with sterile water 3 times; add 1.5mL 15% H2O2 to disinfect for 10-15min; use a pipette to suck out the H2O2 and rinse with sterile water 3 times. Use a pipette to suck out the sterile water used to wash the seeds, pour the washed seeds on sterile filter paper, and dry the water on the seeds; use a sterile toothpick to point the seeds on the MS culture medium, and culture them in an artificial climate room at 28℃, 16h light, 8h dark photoperiod. About 15 days after the seeds germinate, transfer the seedlings to MS culture bottles and continue to culture and grow until they have 5-8 leaves, and then use them.

[0034] Take out NtTPS21-1305 Agrobacterium from the -80℃ refrigerator, use a sterilized toothpick to dip the bacterial solution and streak it into LB solid medium containing 50mg / L kanamycin and 25mg / L rifampicin, invert and culture at 28℃ for 24h, pick a single colony and shake it in LB liquid medium (containing 50mg / L kanamycin and 25mg / L rifampicin), 28℃, 200rpm, culture for 24h, then take 100uL of the small shaking bacterial solution and add it back into 50mL LB liquid medium (containing 50mg / L kanamycin and 25mg / L rifampicin), 28℃, 200rpm, culture until OD600 = about 0.6. Cut off the edge of the sterile leaves with sterile scissors, cut the sterile seedling leaves into 1cm along the main vein 2Leaves, with the back of the leaves facing upward, are laid flat on the co-cultivation (G) medium and cultured in the dark at 28°C for 3 days. Add 1 / 1000 acetosyringone (AS) to the activated Agrobacterium culture solution. Place the pre-cultured leaves in the culture solution, wrap them with tin foil to avoid light, and infect them at 28°C for 8 minutes. Remove the infected leaves with sterile tweezers, dry the Agrobacterium culture solution on sterile filter paper, lay the leaves facing downward on the co-cultivation (G) medium, and culture them in the dark at 28°C in an artificial climate chamber for 3 days. Add cephalosporin (Cef) to sterile water to a final concentration of 500 mg / L, rinse the co-cultivated tobacco leaves with the sterile water, wash them 3 times in total, and dry them with sterile filter paper. The washed co-cultured leaves were placed with the front side facing up and spread on differentiation (S) medium (MS+6-BA1mg / L+NAA0.1 mg / L+Cef 500mg / L+Kan 50mg / L), and cultured in an artificial climate chamber at 28°C for 2-3 weeks. When callus tissue was differentiated, the callus tissue was cut and transferred to a new differentiation medium for further culture. The callus tissue that differentiated into seedlings was cut open, and the individual seedlings were transferred to rooting (R) medium (MS+Cef 500mg / L+Kan 50mg / L) for further culture. When the sterile seedlings grew to the 5-leaf stage, the lid of the culture bottle was opened, an appropriate amount of sterile water was added, and the seedlings were hardened for 2 days. Then the roots were rinsed with sterile water and transferred to a sterile matrix for culture until harvest.

[0035] Medium formulation (PH 5.8-6.0)

[0036]

[0037] (3) Identification of transgenic tobacco overexpressing NtTPS21

[0038] Since the pCAMBIA1305.1 vector contains a GUS tag, the GUS staining method was used to identify the positive seedlings of the obtained T2 generation NtTPS21 overexpressing tobacco plants. The qRT-PCR method was further used to detect the overexpression effect of NtTPS21: the leaves of the same part of the positive seedlings were sampled, RNA was extracted, and the expression of NtTPS21 was identified after reverse transcription into cDNA. Using the tobacco α-tubulin gene as an internal reference, the quantitative PCR primers of the internal reference gene were designed: Actin-qF (5'-CAAGGAAATCACCGCTTTGG-3') and Actin-qR (5'-AAGGGATGCGAGGATGGA-3'), and the quantitative PCR primers of NtTPS21: NtTPS21-qF (5'-GCTAAGTTCTATTACAAGGTGGTG-3) and NtTPS21-qR (5'-AAAGTACACTCCCAATGCCC-3'). qRT-PCR detection was performed using 2×ChamQ SYBR Color qPCR Master Mix. The experiment was set up with 3 biological replicates and 3 technical replicates, using 2 -△△CT Methods The relative expression level of NtTPS21 was calculated.

[0039] Depend on Figure 2 It can be seen that the expression level of NtTPS21 gene in 8 overexpression transgenic strains increased by 22-132 times compared with the wild type. Among them, three strains with better overexpression effects, OE-2, OE-3, and OE-4, were selected for subsequent gene function research.

[0040] Example 2 Investigation and analysis of growth period and agronomic traits of NtTPS21 overexpressing materials

[0041] The NtTPS21 overexpression material and its wild-type control were planted in isolation, and their budding time and capsule maturity time were observed and recorded. When they grew to the full flowering period, 15 tobacco plants were selected from each strain, and their plant height, leaf number, leaf length and leaf width were measured. The plant height was measured based on the central flower height, the leaf number was measured from the bottom leaf number to the two leaves below the flowering bifurcation of the tobacco plant, the leaf length was measured based on the distance from the base of the middle leaf to the tip of the leaf, and the leaf width was measured based on the distance between the widest part of the middle leaf, and the average value was calculated in the final calculation.

[0042] The agronomic traits of flue-cured tobacco are closely related to its economic value. In order to clarify the effect of NtTPS21 on tobacco growth and development. The results of field investigation and analysis of the agronomic traits of three NtTPS21 overexpression lines and wild-type control materials showed that compared with the wild-type control, the plant height of the NtTPS21 overexpression material was shorter ( Figure 3 and Figure 4), but there were no significant differences in agronomic traits directly related to yield, such as leaf length, leaf width and leaf number ( Figure 5 ). The statistical results of bud formation time and growth period showed that the bud formation time of NtTPS21 overexpressing materials was delayed by 15-20 days (Table 1) and the growth period was delayed by 15-25 days (Table 2) compared with the wild-type control. The above results suggest that NtTPS21 may be involved in the regulation of tobacco vegetative growth to reproductive growth.

[0043] Table 1. Bud appearance time of NtTPS21 overexpression lines and wild-type controls

[0044]

[0045] Note: WT represents the wild-type control; OE-2, OE-3, and OE-4 represent different strains overexpressing NtTPS21.

[0046] Table 2. Growth period of NtTPS21 overexpression strains and wild-type controls

[0047]

[0048] Note: WT represents the wild-type control; OE-2, OE-3, and OE-4 represent different strains overexpressing NtTPS21.

[0049] References:

[0050] [1]Sharma E,Anand G,Kapoor R.Terpenoids in plant and arbuscularmycorrhiza-reinforced defense against herbivorous insects.Ann Bot.2017;

[0051] 119(5):791-801.doi:10.1093 / aob / mcw263

[0052] [2] Tan Jinyan, Cheng Yangang, Wang Jiamin, Wang Shihui, Liu Kaili, Wang Yingli, 2021. Chemical components and their relationship of sesquiterpenoids from Solanaceae.

[0053] Progress in research on pharmacological effects. Chinese Herbal Medicine, 52(16):5062-5077.

[0054] [3]Zhu L,Chen L.Progress in research on paclitaxel and tumorimmunotherapy.Cell Mol Biol Lett.2019;24:40.Published 2019Jun 13.doi:10.1186 / s11658-019-0164-y[4]VranováE,Coman D,Gruissem W.Network analysis of the MVAand MEP pathways for isoprenoid synthesis.Annu Rev Plant Biol.2013;64:665-700.

[0055] [5]Tholl D.Biosynthesis and biological functions of terpenoids inplants.AdvBiochem Eng Biotechnol.2015;148:63-106.doi:10.1007 / 10_2014_295

[0056] [6]Lee S,Masclaux-Daubresse C.Current Understanding of LeafSenescence in Rice.

[0057] Int JMol Sci.2021;22(9):4515.Published 2021Apr 26.doi:10.3390 / ijms22094515[7]Yadava P.,Singh A.,Kumar K.,Singh I.Senescence Signalling andControl in Plants.Academic Press;Cambridge,MA,USA:2019.Plant senescence andagriculture;

[0058] pp.283–302

[0059] [8]Havé M., Marmagne A., Chardon F., Masclaux-Daubresse C. Nitrogen remobilization during leaf senescence: Lessons from Arabidopsis tocrops.J.Exp.Bot.

[0060] 2017;68:2513–2529.

[0061] [9]Uauy C.,Distelfeld A.,Fahima T.,Blechl A.,Dubcovsky JAA NAC GeneRegulating Senescence Improves Grain Protein,Zinc,and Iron Content inWheat.Science.2006;

[0062] 314:1298–1301.doi:10.1126 / science.1133649.

[0063]

[10] Yang Jing, Chen Jie, Guo Hongyan, et al. Research progress on the mechanism of early flowering in tobacco[J]. Biotechnology Bulletin, 2013, No.246(01):8-15.

[0064] DOI:10.13560 / j.cnki.biotech.bull.1985.2013.01.001.

[0065]

[11] Jiang Jiarui, Deng Lele, Zhang Jianduo, et al. Research progress on factors affecting early flowering of tobacco[J]. Molecular Plant Breeding, 2019,

[0066] 17(09):3080-3083.DOI:10.13271 / j.mpb.017.003080.

[0067]

[12] Yang Quanxian. Advantages of dwarfing and dense planting of fruit-bearing ginkgo[J]. Hebei Forestry Science and Technology, 2013, No.192(05):94-95.

[0068] DOI:10.16449 / j.cnki.issn1002-3356.2013.05.039.

[0069]

[13] Wang Fengwei, Zhao Fengxia, Wang Baohua. Key technologies for high-yield cultivation of dwarfed and densely planted corn in the field[J]. Agricultural Development and Equipment, 2021, No.234(06):209-210.

Claims

1. Application of tobacco NtTPS21 gene in regulating tobacco plant height and growth period, the nucleotide sequence of the tobacco NtTPS21 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that Overexpression of tobacco NtTPS21 gene can reduce tobacco plant height and extend the growth period.

3. A method for extending tobacco growth period and reducing plant height, characterized in that The tobacco NtTPS21 gene overexpression vector was introduced into wild-type tobacco to obtain transgenic tobacco with reduced plant height and extended growth period.

Images