Application of rice gene OsDITF1 in drought resistance of rice

Abstract

The invention relates to application of a rice gene OsDITF1 in drought resistance of rice, and belongs to the technical field of molecular biology and gene engineering. The invention provides application of an OsDITF1 gene in drought resistance of rice, and particularly relates to application of the OsDITF1 gene in drought resistance of the rice, a mutant is obtained by overexpressing a plant through the OsDITF1 gene and knocking out the OsDITF1 gene by adopting a CRISPR / Cas9 method, and the drought resistance of the mutant is evaluated by utilizing a stress condition mode, so that the condition that the OsDITF1 gene positively regulates the drought resistance of the rice is determined, and the yield of the rice under the drought condition is increased.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology and genetic engineering, and in particular to the application of rice gene OsDITF1 in rice drought resistance. Background Art

[0002] With the intensification of global climate change, population explosion, increased demand for agricultural water and shortage of freshwater resources, drought has become a key factor restricting the development of global agriculture, seriously affecting the quality and yield of food. In the past decade, the total economic losses of global crops caused by drought have reached 30 billion US dollars. As for my country's staple food crops, rice production consumes more freshwater resources than other crops. It takes 3 to 5 tons of water to produce 1 kilogram of rice seeds, while corn or wheat only needs less than half of the water, making the growth and yield of rice more susceptible to drought stress. Therefore, in-depth exploration of rice drought-related genes, analysis of the molecular mechanism of drought resistance, and thus breeding drought-resistant rice varieties are of great significance for improving rice yield and quality and ensuring food security.

[0003] Crops may suffer from drought stress at any stage of their growth, resulting in a decline in crop quality and yield. Drought during the reproductive growth period of crops, in particular, can lead to at least a 50% reduction in yield. At this time, drought affects flowering and fertilization, reduces pollen fertility, and thus reduces fruit set rate; drought can lead to incomplete filling, thereby reducing thousand-grain weight; drought can affect ear development, such as shortening of ear length and reduction of ear grain number. These factors largely cause crop yield reduction. Therefore, yield can be used as an important indicator for evaluating drought resistance.

[0004] However, there is still no report on the application of OsDITF1 gene in rice drought resistance. The present invention has found that the expression level of rice OsDITF1 gene can be changed by biotechnology to improve rice drought resistance and thus increase yield. Summary of the invention

[0005] Based on the above background technical problems, the purpose of the present invention is to provide an application of the rice OsDITF1 gene in rice drought resistance, specifically through OsDITF1 gene overexpression plants, and the use of CRISPR / Cas9 method to knock out the OsDITF1 gene to obtain mutants, and use stress conditions to evaluate their drought resistance, so as to determine that the OsDITF1 gene can be applied to rice drought resistance and increase rice yield under drought conditions.

[0006] The object of the present invention is to overcome at least one disadvantage of the prior art and provide an application of rice OsDITF1 gene in rice drought resistance.

[0007] The technical solution adopted by the present invention is:

[0008] The first aspect of the present invention provides:

[0009] Application of rice gene OsDITF1 in rice drought resistance, the nucleotide sequence of the OsDITF1 gene is shown as SEQ ID NO.1.

[0010] In some application examples, the amino acid sequence of the OsDITF1 protein is shown as SEQ ID NO.3.

[0011] In some application examples, the method comprises the following steps: overexpressing the rice gene OsDITF1 in rice.

[0012] In some application examples, the steps include: constructing an overexpression vector of the rice gene OsDITF1;

[0013] The overexpression vector is transferred into rice to obtain overexpression rice.

[0014] In some application examples, the following steps are included:

[0015] B01 designs primers to amplify the CDS sequence of the OsDITF1 gene;

[0016] B02 constructs an overexpression vector;

[0017] B03 transforming the overexpression vector described in B02 into Agrobacterium, and screening the recombinant Agrobacterium strain containing OsDITF1 to infect rice callus;

[0018] B04 resistant callus screening and differentiation to obtain transgenic plants;

[0019] In some application examples, B05 also performs genetic testing on transgenic plants, uses designed primers for PCR amplification and sequencing, confirms successful transformation, and obtains transgenic plants.

[0020] In some application examples, the primers in step B01 are shown as SEQ ID NO.16 and SEQ ID NO.17.

[0021] In some application examples, the primers in step B05 are shown as SEQ ID NO.18 and SEQ ID NO.19.

[0022] The second aspect of the present invention provides:

[0023] A gene editing method for obtaining a rice gene OsDITF1 mutant comprises the following steps:

[0024] A01 designed sgRNA primers in the OsDITF1 coding region;

[0025] A02 Construction of dual-target CRISPR / Cas9 knockout vector;

[0026] A03 transforming the CRISPR / Cas9 knockout vector described in A02 into Agrobacterium, and screening the recombinant Agrobacterium strain containing CRISPR / Cas9 to infect rice callus;

[0027] A04 resistant callus was screened and differentiated to obtain T0 generation strains;

[0028] The A05 T0 generation strain was genetically tested, and PCR amplification and sequencing were performed using designed primers to confirm that the knockout was successful and the OsDITF1 mutant was obtained.

[0029] In some application examples, the sequences of the dual targets in step A02 are shown as SEQ ID NO.12 and SEQ ID NO.13.

[0030] In some application examples, the sgRNA primers in step A01 include two pairs of primers, as shown in SEQ ID NO.8 and SEQ ID NO.9, SEQ ID NO.10 and SEQ ID NO.11 respectively.

[0031] In some application examples, the primers in step A05 are shown as SEQ ID NO.14 and SEQ ID NO.15.

[0032] Beneficial Effects

[0033] The present invention obtains mutants by overexpressing OsDITF1 gene plants and knocking out OsDITF1 gene by CRISPR / Cas9 method, and evaluates drought resistance by stress conditions. After rice overexpresses OsDITF1 gene, the yield of OsDITF1 overexpressing plants is significantly increased compared with the wild type when planted in drought ponds. This indicates that overexpressing OsDITF1 can significantly improve the drought resistance of rice and increase the yield of rice under drought conditions. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Example 1 Analysis of the expression pattern of OsDITF1 gene under drought stress

[0035] Expression analysis of OsDITF1 under two conditions: hydroponic culture (Normal) and 20% PEG treatment (Drought);

[0036] Figure 2 Example 2 Analysis of Drought Resistance of OsDITF1 Mutant Plants

[0037] ab. Analysis of drought resistance phenotypes of osditf1 mutant plants and wild-type plants (WT) (scale bar is 20 cm) and comparison of yield per plant (scale bar is 2 cm); cf. Tillering number, number of grains per ear, 1000-grain weight and yield per plant of wild-type (WT) and OsDITF1 mutant under water pond planting (normal) and drought pond planting (Drought) (lowercase letters indicate significant differences, P<0.05);

[0038] Figure 3 Example 3 Analysis of drought resistance of OsDITF1 overexpressing plants

[0039] ab. Analysis of drought resistance phenotype of OsDITF1 overexpressing plants (scale bar is 10 cm) and comparison of single plant yield (scale bar is 4 cm). c. Comparison of tiller number of wild type and OsDITF1 overexpressing plants under water pond planting and dry field planting (lowercase letters indicate significant differences, P<0.05). d. Single plant yield of wild type and OsDITF1 overexpressing plants under water pond planting and dry field planting. Red values ​​represent the value of increase in yield of OsDITF1 overexpressing plants compared with wild type; blue values ​​represent the value of decrease in yield of OsDITF1 overexpressing plants compared with wild type;

[0040] Figure 4 This is a diagram of the process of obtaining rice OsDITF1 mutants;

[0041] Figure 5 This is a diagram of the process of obtaining rice overexpressing OsDITF1.

[0042] Embodiments of the present invention

[0043] The technical solution of the present invention is further illustrated below in combination with examples and experiments.

[0044] Example 1: Analysis of the expression pattern of OsDITF1 gene under drought stress

[0045] The OsDITF1 (Oryza sativa Drought Induced Transcription Factor 1) gene involved in this Example 1 is derived from rice (Oryza sativa L.), its genomic sequence is shown in SEQ ID NO.1, its cDNA sequence is shown in SEQ ID NO.2 in the sequence table, and the amino acid sequence encoded by OsDITF1 is shown in SEQ ID NO.3.

[0046] The Zhonghua 11 rice seedlings grown to the 3-leaf stage were treated with 20% PEG, and samples were taken at 0h, 1h, 2h, 4h, 8h, 12h, and 24h, respectively. At the same time, the untreated Zhonghua 11 rice seedlings were sampled at the same time points as a control, and then quickly frozen in liquid nitrogen. The total RNA of Zhonghua 11 was extracted and reverse transcribed into cDNA. Real-time fluorescence quantitative PCR was performed using cDNA as a template to detect the changes in the transcription level of the OsDITF1 gene after drought treatment, and OsActin1 was used as an internal reference gene. The experiment was repeated 3 times, and the results were averaged. The specific primer sequences are as follows:

[0047] OsDITF1-qpcr-F: 5'-GTCGCTACCCAAGTATCAGG-3' (SEQ ID NO: 4),

[0048] OsDITF1-qpcr-R: 5'-CAAGCCGACTTTCTGATATTC-3' (SEQ ID NO: 5);

[0049] OsActin1-qpcr-F: 5'-ACCATTGGTGCTGAGCGTTT-3' (SEQ ID NO: 6);

[0050] OsActin1-qpcr-R: 5'-CGCAGCTTCCATTCCTATGAA-3' (SEQ ID NO: 7).

[0051] The results are analyzed as Figure 1 As shown, in this example, the expression pattern of rice OsDITF1 gene under drought stress was analyzed by qPCR method. The results showed that the expression of OsDITF1 was significantly induced by PEG treatment. The expression level of OsDITF1 was significantly upregulated 2h after PEG treatment and reached a peak at 12h ( Figure 1 ), which indicated that OsDITF1 was involved in the response of rice to drought stress.

[0052] Example 2: Obtaining rice osditf1 mutant and identifying its drought resistance

[0053] This Example 2 is to obtain the rice osditf1 mutant and identify its drought resistance, specifically including the following steps: Figure 4 As shown:

[0054] A01 designed sgRNA primers in the OsDITF1 coding region;

[0055] Using the nucleotide sequence of the OsDITF1 gene as shown in SEQ ID NO.1 as a reference sequence, two pairs of sgRNA primer sequences were designed in the OsDITF1 coding region, namely

[0056] OsDITF1-U3F1 / OsDITF1-U3R1 and OsDITF1-U3F2 / OsDITF1-U3R2. The primer sequences are as follows:

[0057] OsDITF1-U3F1: 5'-GATCCTCGTGCAGCACCAGA-3' (SEQ ID NO: 8);

[0058] OsDITF1-U3R1: 5'-TCTGGTGCTGCACGAGGATC-3' (SEQ ID NO: 9);

[0059] OsDITF1-U3F2: 5'-CTTGGTGACGGACTCCTTG-3' (SEQ ID NO: 10);

[0060] OsDITF1-U3R2: 5'-CAAGGAGTCCGTCACCAAG-3' (SEQ ID NO: 11).

[0061] Furthermore, to facilitate subsequent connection, a ggca linker was added to the 5' end of the primer sequences of OsDITF1-U3F1 and OsDITF1-U3F2, and an aaac linker was added to the 5' end of the primer sequences of OsDITF1-U3R1 and OsDITF1-U3R2.

[0062] As shown below:

[0063] OsDITF1-U3F1: 5'-ggcaGATCCTCGTGCAGCACCAGA-3';

[0064] OsDITF1-U3R1: 5'-aaacTCTGGTGCTGCACGAGGATC-3';

[0065] OsDITF1-U3F2: 5'-ggcaCTTGGTGACGGACTCCTTG-3';

[0066] OsDITF1-U3R2: 5'-aaacCAAGGAGTCCGTCACCAAG-3'.

[0067] A02 Construction of dual-target CRISPR / Cas9 knockout vector;

[0068] The two pairs of primers in step A01 are annealed and extended into double strands to complete the preparation of the target adapter, and the two pairs of target adapters obtained are respectively connected to the pYLgRNA-OsU3 vector to obtain two intermediate vectors.

[0069] Furthermore, gRNA expression cassettes containing corresponding targets were amplified from two intermediate vectors, and the amplified fragments were connected into the vector pYLCRISPR / Cas9-MH using the cutting and ligation method to obtain the dual-target OsDITF1 CRISPR / Cas9 knockout vector.

[0070] Furthermore, in this example, the two targets are named OsDITF1-T1 and OsDITF1-T2, respectively. The sequence of the target of OsDITF1-T1 is shown as GATCCTCGTGCAGCACCAGA (SEQ ID NO. 12); the sequence of the target of OsDITF1-T2 is shown as CAAGGAGTCCGTCACCAAG (SEQ ID NO. 13).

[0071] A03 transforming the CRISPR / Cas9 knockout vector described in A02 into Agrobacterium, and screening the recombinant Agrobacterium strain containing CRISPR / Cas9 to infect rice callus;

[0072] The OsDITF1 CRISPR / Cas9 knockout vector containing dual targets in step A03 was transferred into the Agrobacterium strain EHA105 by the heat shock method, and the recombinant Agrobacterium strain containing OsDITF1 CRISPR / Cas9 was screened and used to infect the callus tissue of Zhonghua 11.

[0073] The specific operation is to take the activated Agrobacterium and culture it in liquid AAM medium (a commercially available product) at 8°C and 200 r / min until the OD 600 = 0.4, collect the bacteria by centrifugation and resuspend them in an equal volume of AAM medium, add 100μmol acetosyringone at a final concentration, and shake culture for 2-3h as the infection solution. Select well-growing embryonic callus and place it in the above infection solution, shake culture at 100r / min for 20min, take out the callus after standing for 10min, absorb the excess bacterial solution with sterile filter paper, and then place it on the co-culture medium (glucose 10g / L and acetosyringone 10mg / L in the induction medium) and culture until colonies just appear. Then shake and wash with 0.1mol mannitol sterile solution 2-3 times, shake and wash with 500mg / L cephalosporin solution 2-3 times until the supernatant is completely clean, then take out the callus and place it in a sterile culture dish with only filter paper to dry for 2-3d, then transfer it to the screening medium for screening culture, and change the medium every 20d or so.

[0074] A04 resistant callus was screened and differentiated to obtain T0 generation strains;

[0075] The transformed callus is first cultured on a subculture medium with a lower selection pressure for 3 to 4 weeks, and then cultured on a subculture medium with a higher selection pressure for 3 to 4 weeks, and then the surviving resistant callus blocks are selected for differentiation culture on a differentiation medium with a lower selection pressure. For materials that are difficult to differentiate, appropriate drying treatment can be performed when the callus tissue turns green, and when the young shoots grow 1 to 2 mm, they are transferred to a seedling culture medium for rooting culture to obtain T0 generation strains.

[0076] The A05 T0 generation strain was genetically tested, and PCR amplification and sequencing were performed using designed primers to confirm that the knockout was successful and the OsDITF1 mutant was obtained.

[0077] Under the guidance of sgRNA, Cas9 can cut the double strands of the target sequence, causing double-strand DNA breaks, thereby activating the cell's DNA double-strand break repair function. During the repair process, a small amount of base substitution, deletion or insertion will occur, resulting in gene editing.

[0078] Extract genomic DNA from the T0 generation strain, design primers near the target site, amplify the DNA fragment containing the target site by PCR technology and perform sequencing detection. The specific primer sequences for amplification are as follows:

[0079] OsDITF1-Cas9-F: 5'-ACCCTAACCCTAGAATCGT-3' (SEQ ID NO. 14);

[0080] OsDITF1-Cas9-R: 5'-TTTCCCACTCAGATATTGC-3' (SEQ ID NO. 15).

[0081] Sequencing revealed that compared with the wild-type genomic DNA, the OsDITF1 mutant strain had a 1-base deletion at the OsDITF1-T1 target site and a 3-base deletion at the OsDITF1-T2 target site, resulting in premature termination of translation due to frameshift mutation. The cDNA sequence of the OsDITF1 mutant strain is shown in SEQ ID NO.20, and the amino acid sequence is shown in SEQ ID NO.21. Sequencing confirmed that the knockout was successful, thereby obtaining the OsDITF1 mutant plant.

[0082] Identification of drought resistance in rice osditf1 mutant

[0083] The osditf1 mutant and wild-type plant materials were planted in identification ponds (water ponds and dry ponds). The dry ponds were no longer irrigated 10 days after transplanting until the rice matured. If there was a lot of rainfall during this period, the water in the dry ponds was drained in time. The water ponds were irrigated normally as controls. After the osditf1 mutant and wild-type plants matured, the yield per plant, the number of tillers, the relative fruiting rate and other traits were measured.

[0084] like Figure 2 As shown, the tiller number of OsDITF1 mutants planted in water ponds was significantly increased compared with wild-type plants; the tiller number of OsDITF1 mutants planted in dry ponds was significantly lower than that of wild-type plants. The thousand-grain weight of OsDITF1 mutants planted in water ponds and dry ponds was significantly lower than that of wild-type plants. Ultimately, the yield per plant of OsDITF1 mutants was significantly lower than that of wild-type plants. The yield per plant of mutants planted in water ponds was 18.59% lower than that of wild-type plants, while the yield per plant of mutants planted in dry ponds was 29.84% lower than that of plants planted in water ponds, which was about 10% different from that of plants planted in water ponds. The above results indicate that OsDITF1 positively regulates rice drought resistance.

[0085] Example 3: Obtaining rice overexpressing OsDITF1 and identifying its drought resistance

[0086] This Example 3 is to obtain rice overexpressing OsDITF1 and identify its drought resistance, specifically including the following steps: Figure 5 As shown:

[0087] B01 designs primers to amplify the CDS sequence of the OsDITF1 gene;

[0088] Total RNA from the japonica rice variety Nipponbare was extracted and reverse transcribed into cDNA. Using cDNA as a template, the CDS region of OsDITF1 was amplified using the primer combination OE-OsDITF1F / OE-OsDITF1R. The specific primer sequences are as follows:

[0089] OE-OsDITF1F:

[0090] 5-ACGATGATAAGGGC GGTACC ATGGGGAAGAAGAAGAAGCG-3' (SEQ ID NO. 16);

[0091] OE-OsDITF1R:

[0092] 5'-AGGCTACGTA GGATCC TTACAGGGCCATGCGTCCAG-3' (SEQ ID NO. 17).

[0093] The bold sequence in the OE-OsDITF1F / OE-OsDITF1R primer sequence is the sequence on the vector, and the underlined part contains the KpnI (GGTACC) and BamHI (GGATCC) restriction sites.

[0094] Furthermore, the OE-OsDITF1F / OE-OsDITF1R primers have been added to the vector linker.

[0095] B02 constructs an overexpression vector;

[0096] The DNA fragment amplified from B01 was connected between the KpnI and BamHI restriction sites of the vector pCAMBIA1300-221 to obtain an overexpression vector.

[0097] B03 transforms the overexpression vector of B02 into Agrobacterium, and selects the recombinant Agrobacterium strain containing OsDITF1 to infect rice callus;

[0098] The overexpression vector constructed in step B02 was transferred into the Agrobacterium strain EHA105 by the heat shock method, and the recombinant Agrobacterium strain containing OsDITF1 was screened and infected with the callus tissue of Zhonghua 11.

[0099] B04 resistant callus was screened and differentiated to obtain T0' generation strains;

[0100] The transformed callus is first cultured on a subculture medium with a lower selection pressure for 3 to 4 weeks, and then cultured on a subculture medium with a higher selection pressure for 3 to 4 weeks, and then the surviving resistant callus blocks are selected and cultured on a differentiation medium with a lower selection pressure for differentiation culture.

[0101] For materials that are difficult to differentiate, appropriate drying treatment can be performed when the callus tissue turns green. When the young shoots grow to 1-2 mm, they can be transferred to the seedling culture medium for rooting culture to obtain the T0' generation strains.

[0102] The B05 T0' generation strain was genetically tested, and PCR amplification and sequencing were performed using the designed primers to confirm that the transformation was successful and to obtain transgenic plants.

[0103] The genomic DNA of the T0' transgenic rice obtained in step B04 was extracted, and primers were designed in the CDS region of the vector pCAMBIA1300-221 and the OsDITF1 gene, respectively. The size of the amplified PCR product was 500 bp. The plants containing the PCR product were identified as transgenic positive plants. The specific primer sequences are as follows:

[0104] OsDITF1-F1: 5'-TCTAGAGGATCTCGAG-3' (SEQ ID NO. 18);

[0105] OsDITF1-R1: 5'-ATAGGTGGAGCTACAC-3' (SEQ ID NO. 19).

[0106] Furthermore, the transcriptional level of transgenic plants was analyzed;

[0107] The transgenic positive plants obtained in B05 were used as experimental materials, and the total RNA of the transgenic lines and wild-type Zhonghua 11 was extracted and reverse transcribed into cDNA. Real-time fluorescence quantitative PCR was performed using cDNA as a template to detect the expression level of the OsDITF1 gene in different materials. OsActin1 was used as an internal reference gene. The experiment was repeated 3 times and the results were averaged. The specific primer sequences are as follows:

[0108] OsDITF1-qpcr-F: 5'-GTCGCTACCCAAGTATCAGG-3' (SEQ ID NO: 4),

[0109] OsDITF1-qpcr-R: 5'-CAAGCCGACTTTCTGATATTC-3' (SEQ ID NO: 5);

[0110] OsActin1-qpcr-F: 5'-ACCATTGGTGCTGAGCGTTT-3' (SEQ ID NO: 6);

[0111] OsActin1-qpcr-R: 5'-CGCAGCTTCCATTCCTATGAA-3' (SEQ ID NO: 7).

[0112] According to the results of real-time fluorescence quantitative PCR, compared with the wild-type Zhonghua 11, the expression level of OsDITF1 gene in the identified transgenic positive strains was significantly increased at the transcriptional level, and two independent transgenic strains were selected and named OE-1 and OE-2.

[0113] Identification of drought resistance in rice overexpressing OsDITF1

[0114] OsDITF1 transgenic plants OE-1, OE-2 and wild type were planted in identification ponds (water pond and dry pond). The dry pond was no longer irrigated 10 days after transplanting until the rice matured. If there was a lot of rainfall during this period, the water in the dry pond was drained in time. The water pond was irrigated normally as a control. After the plants matured, the yield and tillering number were measured.

[0115] like Figure 3As shown in the results, the tiller number of OsDITF1 overexpressing plants OE-1 planted in water pools was not significantly different from that of wild type, while the tiller number of OE-2 was significantly lower than that of wild type; the tiller number of OsDITF1 overexpressing plants planted in dry pools was significantly higher than that of wild type. The yield per plant of OsDITF1 overexpressing plants OE-1 planted in water pools was slightly higher than that of wild type, while the yield per plant of OE-1 was 9.57% lower than that of wild type; the yield per plant of OsDITF1 overexpressing plants OE-1 and OE-2 planted in dry pools was 17.76% and 12.91% higher than that of wild type, respectively. The above results indicate that overexpression of OsDITF1 can significantly improve the drought resistance of rice.

[0116] Sequence Listing

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123] The above is a further detailed description of the present invention, which should not be regarded as a limitation on the specific implementation of the present invention. For ordinary technicians in the technical field to which the present invention belongs, simple deduction or replacement without departing from the concept of the present invention is within the protection scope of the present invention.

Claims

1. Application of rice gene OsDITF1 in rice drought resistance, characterized in that: The nucleotide sequence of the OsDITF1 gene is shown in SEQ ID NO.

1.

2. The use of the rice gene OsDITF1 in rice drought resistance according to claim 1, characterized in that: The amino acid sequence of the OsDITF1 protein is shown in SEQ ID NO.

3.

3. The use of the rice gene OsDITF1 in rice drought resistance according to claim 1, characterized in that: The method comprises the following steps: over-expressing the rice gene OsDITF1 in rice.

4. The use of the rice gene OsDITF1 in rice drought resistance according to claim 3, characterized in that: include: Construct an overexpression vector of rice gene OsDITF1; The overexpression vector is transferred into rice to obtain overexpression rice.

5. The use of the rice gene OsDITF1 in rice drought resistance according to claim 4, characterized in that: include: B01: design primers to amplify the CDS sequence of the OsDITF1 gene; B02: Construction of overexpression vector; B03: transforming the overexpression vector described in B02 into Agrobacterium, screening the recombinant Agrobacterium strain containing OsDITF1 to infect rice callus; B04: Screening and differentiation of resistant callus to obtain transgenic plants.

6. The use of the rice gene OsDITF1 in rice drought resistance according to claim 5, characterized in that: Also includes: B05: Conduct genetic testing on transgenic plants, use designed primers for PCR amplification and sequencing to confirm successful transformation.

7. The use of the rice gene OsDITF1 in rice drought resistance according to claim 5, characterized in that: The primers of step B01 are shown in SEQ ID NO.16 and SEQ ID NO.

17.

8. The use of the rice gene OsDITF1 in rice drought resistance according to claim 6, characterized in that: The primers of step B05 are shown as SEQ ID NO.18 and SEQ ID NO.19.

Images