Rice transcription factor GTL1 gene and application thereof in regulating seed size

Abstract

The invention belongs to the field of gene engineering, and particularly provides application of a rice transcription factor GTL1 in regulation and control of seed size. Through a CRISPR-Cas9 mediated genome editing technology, a GTL1 mutant plant gtl1 is generated under the background of Nipponbare rice, and compared with wild-type Nipponbare rice, analysis discovers that the size of seeds can be remarkably increased due to frameshift mutation caused by base deletion or insertion of GTL1 in rice. The invention provides a novel method for improving the yield of crops by utilizing a genetic engineering means, and has important significance on regulating and controlling the yield of plants and breeding.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to a rice transcription factor GTL1 gene and an application thereof in regulating seed size. Background Art

[0002] Rice is a major food crop and cash crop in my country and even in the world due to its long history of cultivation and wide range of consumption. Factors that determine rice yield include the number of grains per panicle, the number of effective tillers, and grain weight. Among them, grain weight is a relatively stable genetic factor that is not easily affected by the external environment and is relatively easy to control in genetic breeding. Grain weight is mainly determined by seed size, which is an important developmental biology issue. It is regulated by multiple genes and is a key factor in determining crop yield. It has long been one of the main goals of crop genetic improvement. Analyzing the molecular mechanism of regulating seed size can provide an important theoretical basis for high-yield rice breeding.

[0003] Rice is a diploid plant, and its seeds consist of three parts: seed coat, endosperm, and embryo. The endosperm and embryo develop from the zygote after fertilization, while the seed coat develops from the maternal components. The maternal and zygotic components jointly regulate seed size. The signaling pathways that have been reported to affect the maternal and zygotic components of plant seeds include: protein ubiquitination pathway, such as AtDA1, OsGW2, and OsWTG1 genes; G protein pathway, such as OsRGB1, GS3, and OsRGA1 genes; MAPK pathway (mitogen-activated protein kinase (MAPK) signaling), such as OsMKKK10, OsMKK4, and OsMKP1 genes; plant hormone pathway, such as OsGSK2, OsGSE5, and OsARF4 genes; transcription factor regulation pathway, such as OsGRF4, OsGW6, and MtBS1 genes. However, the seed development process is complex, and the molecular mechanism that determines seed size is not clear at present. Therefore, further exploring the genes that affect plant seed size on this basis is of great significance for humans to further understand the plant seed development process and increase crop yields. Summary of the invention

[0004] The present invention provides an application of a rice transcription factor GTL1 gene in regulating seed size. Reducing the expression of the GTL1 gene can significantly increase the length and width of the seed, which provides a theoretical basis for molecular breeding of high-yield rice.

[0005] Specifically, the present invention provides the following technical solutions:

[0006] The first aspect of the present invention provides the use of any one of the following 1)-3) substances in regulating plant seed size,

[0007] 1) Rice transcription factor GTL1 protein;

[0008] 2) a nucleic acid molecule encoding a rice transcription factor GTL1 protein;

[0009] 3) A recombinant vector, expression cassette or recombinant bacteria containing a nucleic acid molecule encoding rice transcription factor GTL1 protein.

[0010] In a preferred embodiment, the amino acid sequence of the rice transcription factor GTL1 protein has an NCBI accession number of LOC_Os03g02240.1.

[0011] In a preferred embodiment, the nucleic acid molecule encoding the rice transcription factor GTL1 protein is a DNA molecule of 1) or 2) as follows:

[0012] 1) The coding region is the DNA molecule with NCBI accession number LOC_Os03g02240;

[0013] 2) A DNA molecule that hybridizes under stringent conditions with the DNA molecule sequence whose coding region is NCBI accession number LOC_Os03g02240 and encodes a protein with the same function.

[0014] In one embodiment, the use includes regulating the seed size of a plant by regulating the content and / or activity of the protein GTL1 in the plant.

[0015] In a preferred embodiment, the plant is rice.

[0016] The second aspect of the present invention provides a method for cultivating a transgenic plant with enlarged seeds, the method comprising: 1) reducing the content and / or activity of GTL1 protein in the target plant to obtain a transgenic plant with enlarged seeds;

[0017] or 2) reducing the expression of a nucleic acid molecule encoding a GTL1 protein in a target plant to obtain a transgenic plant with enlarged seeds; wherein the GTL1 protein is as follows (1) or (2):

[0018] (1) Amino acid sequence with NCBI accession number LOC_Os03g02240.1;

[0019] (2) A protein comprising a tag sequence added to the end of the amino acid sequence described in (1).

[0020] In a preferred embodiment, the plant is rice.

[0021] Compared with the prior art, the present invention has the following significant advantages:

[0022] The present invention proves for the first time that the rice transcription factor GTL1 gene has an important regulatory effect on seed size, and mutation of the gene can increase the length and width of rice seeds, thus indicating that the gene can be used to regulate plant seed yield, which has important implications for plant breeding. The present invention provides important gene resources for cultivating new varieties of large-fruited plants using genetic engineering methods, which can be used to increase crop yields and has important application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The accompanying drawings are used to provide further understanding of the present invention and constitute a part of the specification. They are used to explain the present invention together with the embodiments of the present invention and do not constitute a limitation of the present invention.

[0024] Figure 1 is the phenotype of rice transcription factor GTL1 gene overexpression plants; NPB is wild-type Nipponbare rice, GTL1OE#1 and GTL1 OE#2 are GTL1 gene overexpression plants;

[0025] Figure 2 Identification of the rice transcription factor GTL1 plant genotype; CRISPR-Cas9-mediated genome editing was used to generate gtl1 mutants in the Nipponbare plant background; the top of the figure shows the GTL1 gene structure; the Nipponbare gDNA sequence below is the original sequence of the mutation site; the red bases in gtl1#5 in the figure are inserted bases and cause the GTL1 gene frameshift mutation, as well as the mutation sites in the gtl1#3 and gtl1#13 sequences;

[0026] Figure 3 The photos are of the seeds of gtl1#3, #5, and #13 mutants and NPB seeds, with ten seeds in a group, comparing their seed lengths;

[0027] Figure 4 The photos are of the seeds of gtl1#3, #5, and #13 mutants and NPB seeds, which were grouped into ten, comparing their seed widths. DETAILED DESCRIPTION

[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0029] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0030] The mutants and wild-types appearing in the following examples are described as follows:

[0031] The wild rice variety selected is Nipponbare.

[0032] GTL1 gene variant plants were obtained by Wuhan Boyuan Biotechnology Co., Ltd. through genetic transformation using CRISPR-Cas9 technology. After multiple generations of identification and screening, homozygous mutant seeds with no traces of transgenic genes were obtained.

[0033] In the genomes of the GTL1 gene mutant gtl1#3 and the wild-type rice, only the GTL1 gene has a base deletion mutation, and the other genes are the same.

[0034] In the genomes of the GTL1 gene mutant gtl1#5 and the wild-type rice, only the GTL1 gene has an insertion mutation, and the other genes are the same.

[0035] In the genomes of the GTL1 gene mutant gtl1#13 and the wild-type rice, only the GTL1 gene has a base deletion mutation, and the other genes are the same.

[0036] Example 1 Functional identification of rice transcription factor GTL1 gene

[0037] The transcription factor AtGTL1 in Arabidopsis can regulate plant growth, development and resistance response, but no function of the homologous gene GTL1 in rice has been reported. Primers were designed based on the rice transcription factor GTL1 gene sequence information provided by the MSU website (NCBI accession number LOC_Os03g02240) to amplify the full-length sequence of GTL, and then constructed it into the overexpression vector pHZ104 to obtain the recombinant plasmid pHZ104-Ubi-GTL1. Using Agrobacterium-mediated plant transformation technology, the recombinant plasmid was introduced into Nipponbare rice callus tissue, and finally GTL1 overexpressing transgenic rice plants GTL1 OE#1 and GTL1OE#2 were obtained. The growth phenotype of the transgenic T0 generation plants is as follows: Figure 1 As shown, GTL1 overexpressing plants were dwarfed and unable to produce seeds.

[0038] GTL gene full-length amplification primers:

[0039] pHZ-GTL1-F: ATCCAGATCCAGTGGGATCCTTTGTTGGCATGCAGCAGCC (SEQ ID NO. 1)

[0040] pHZ-GTL1-R: AACGTCGTACGGGTAAAGCTTCTGGACGCAGGCCAAGAATG (SEQ ID NO. 2)

[0041] Example 2 Application of GTL1 gene in regulating plant seed size

[0042] I. Obtaining mutant plants gtl1

[0043] The GTL1 gene mutant plants were produced using CRISPR-Cas9 technology. The target sequence for the GTL1 gene was designed and constructed on the CRISPR-Cas9 vector pYL-HU suitable for rice transformation. After the recombinant plasmid was transformed into Agrobacterium GV3101, the recombinant plasmid was introduced into the Nipponbare rice callus using Agrobacterium-mediated plant transformation technology, and complete rice plants were finally obtained after tissue culture.

[0044] Designed GTL1 target sequence: CTTCCGGGAAGCCGCCCTCA (SEQ ID NO.3)

[0045] 2. Identification of mutant plants gtl1

[0046] The genomic DNA of positive seedlings was extracted and PCR amplified using primers Cri-GTL1-F and Cri-GTL-R.

[0047] The main reagents used were: KOD OneTM PCR Master Mix purchased from Toyobo, DNA marker and gelred nucleic acid dye purchased from Polymer, DNA gel recovery kit purchased from Quanshijin, and primers synthesized by BGI Biotechnology Co., Ltd.

[0048] Primer sequences used:

[0049] Cri-GTL1-F: 5'-CGATCGACAGCGAAAGATTAG-3' (SEQ ID NO.4)

[0050] Cri-GTL1-R: 5'-CTGGATACATGAAGTGACGCA-3' (SEQ ID NO.5)

[0051] The PCR system used was:

[0052]

[0053] The reaction conditions for the first round of PCR amplification are:

[0054]

[0055]

[0056] After PCR amplification, 8 μL of amplified product was added with 1 μL of loading buffer and electrophoresed on a 1.0% agarose gel with Gelred nucleic acid dye, using 1×TAE as the electrophoresis buffer, at 150 V for 20 minutes, and the gel was imaged with a gel imager. The amplified product was sent to BGI Biotechnology Co., Ltd. for sequencing.

[0057] The PCR products were sequenced and analyzed, and some of the sequencing results were as follows Figure 1 As shown, the top of the figure shows the GTL1 gene structure; the NPB gDNA sequence below it is the original sequence of the mutation site; the red bases in gtl1#5 in the figure are inserted bases and cause the GTL1 gene frameshift mutation, as well as the mutation sites in the gtl1#3 and gtl1#13 sequences.

[0058] 3. Phenotypes of gtl1 mutant plants

[0059] After harvesting seeds from the T0 generation plants with successful mutations, more than two generations of seed breeding and screening were performed, and finally gtl1#3, gtl1#5, and gtl1#13 rice seeds with homozygous mutations without Cas9 were obtained. Ten seeds were randomly selected as a group, and the length and width of seeds of different strains were measured for comparison.

[0060] The results of seed photography are as follows Figure 2 As shown, the length of seeds of GTL1 gene mutants gtl1#3, #5, and #13 is greater than that of seeds of wild-type rice Nipponbare, among which gtl1#5 seeds are the longest.

[0061] The results of seed photography are as follows Figure 3 As shown, the width of the seeds of the GTL1 gene mutants gtl1#3, #5, and #13 is greater than that of the seeds of the wild-type rice Nipponbare, among which the seeds of the GTL1 gene mutant gtl1#5 are the widest.

[0062] The above results indicate that mutation of the GTL1 gene can increase seed length and width.

[0063] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Use of any one of the following 1)-3) in regulating plant seed size, 1) Rice transcription factor GTL1 protein; 2) A nucleic acid molecule encoding a rice transcription factor GTL1 protein; 3) A recombinant vector, expression cassette or recombinant bacteria containing a nucleic acid molecule encoding rice transcription factor GTL1 protein.

2. The use according to claim 1, characterized in that: The amino acid sequence of the rice transcription factor GTL1 protein described in claim 1 has a NCBI accession number of LOC_Os03g02240.

1.

3. The use according to claim 1 or 2, characterized in that: The nucleic acid molecule encoding the rice transcription factor GTL1 protein is the DNA molecule of 1) or 2) below: 1) The coding region is the DNA molecule with NCBI accession number LOC_Os03g02240; 2) A DNA molecule that hybridizes under stringent conditions with the DNA molecule sequence whose coding region is NCBI accession number LOC_Os03g02240 and encodes a protein with the same function.

4. The use according to any one of claims 1 to 3, characterized in that: The application includes regulating the seed size of plants by regulating the content and / or activity of the protein GTL1 in plants.

5. The use according to any one of claims 1 to 4, characterized in that: The plant is rice.

6. A method for cultivating transgenic plants with enlarged seeds, characterized in that: The method comprises, Reducing the content and / or activity of GTL1 protein in target plants to obtain transgenic plants with enlarged seeds; or reducing the expression of a nucleic acid molecule encoding a GTL1 protein in a target plant to obtain a transgenic plant with enlarged seeds; Wherein, the GTL1 protein is as follows (1) or (2): (1) Amino acid sequence with NCBI accession number LOC_Os03g02240.1; (2) A protein comprising a tag sequence added to the end of the amino acid sequence described in (1).

7. The method according to claim 6, characterized in that: The plant is rice.

Images