A SNP molecular marker related to pig teat number trait and application thereof

Abstract

The application discloses three SNP molecular markers yz_rs329085302, rs320468838 and yz_rs325631013 on chromosome 14 which affect pig teat number, and there are extremely significant differences in left teat number, right teat number and total teat number of pigs with different genotypes of the markers. The three new SNP molecular markers can be used for evaluating pig teat number for non-diagnostic and therapeutic purposes. Compared with the current PCR-RFLP method, the application has the outstanding advantages of simplicity, rapidness, high sensitivity and good specificity.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular markers and animal breeding, in particular to a SNP molecular marker related to the number of pig teats and its application. BACKGROUND

[0002] The number of pig teats is a complex trait with moderate heritability, and its estimated heritability is mostly between 0.1 and 0.5. It is one of the important reproductive traits of pigs. The establishment of high-reproduction lines cannot be separated from high teat number as its physiological basis. Sows with more teats can nurse more piglets, and the number of piglets affects the survival rate of piglets. Studies have shown that there is a positive correlation between teat number and litter size, and the effective combination of more teat number and high litter size is the physiological basis for achieving high reproductive capacity of sows. With the application of breeding technology, the litter size of the core sow population has been effectively improved, but the teat number has not been systematically selected and improved, resulting in more piglets than teats, and some piglets need to be fostered or artificially fed, increasing production costs and management difficulty. Therefore, the selection of teat number traits has also become one of the focuses of current breeding research.

[0003] In recent years, multi-gene marker screening methods have developed rapidly, and genome-wide association study (GWAS) has become one of the mainstream methods. GWAS analysis refers to the correlation study of genes and phenotypes at the whole genome level, with multi-center, large sample, and repeated verification. It can efficiently correlate phenotypes and genotypes and be used to search for candidate genes related to the traits. With the wide application of whole genome association analysis in pig breeding, sites related to teat number and candidate genes have been reported, and a total of 983 QTLs associated with teat number have been included in the pig QTLdb database. Although there have been many reports on teat number, the results of their research usually have population heterogeneity, and the major genes controlling the teat number trait of pigs are still unclear.

[0004] Meta analysis, also known as synthesis analysis, heterogeneity analysis, and comprehensive analysis, is a method of statistically combining information from multiple independent studies to enhance the probability of discovering new associations and reduce false negative results. It can increase the test power and improve the accuracy and reliability of the results. The application of Meta analysis in pig breeding has improved the quantity and accuracy of GWAS results, and has helped the genetic analysis of important economic traits of excellent pig breeds.

[0005] The present application uses whole genome association analysis and Meta analysis methods to mine genetic markers related to teat number using 7338 pigs of different breeds as objects, and uses the genetic molecular markers to further select sows with more teats. SUMMARY

[0006] The present application aims to provide a new SNP molecular marker related to the pig teat number trait, so as to be used for breeding sows with multiple teat number.

[0007] According to a first aspect of the present application, a SNP molecular marker related to the pig teat number trait is provided, which is a C>T mutation at the position of 54971936bp of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version, or a T>C mutation at the position of 54972009bp of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version, or a C>G mutation at the position of 48300187bp of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version. Thus, through the three new SNP molecular markers, the teat number of pigs can be evaluated for non-diagnostic and therapeutic purposes, and compared with the current PCR-RFLP method, the present application has the outstanding advantages of simplicity, speed, high sensitivity and good specificity.

[0008] According to a second aspect of the present application, a SNP molecular marker is provided for use in improving the teat number trait of sows, which is a C>T mutation at the position of 54971936bp of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version, or a T>C mutation at the position of 54972009bp of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version, or a C>G mutation at the position of 48300187bp of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version. Thus, by using the above-mentioned SNP molecular marker for breeding, the teat number of sows can be effectively improved, and the reproductive performance and economic value of sows can be further improved.

[0009] According to a third aspect of the present application, a SNP molecular marker is provided for use in breeding a sow line with multiple teat number, which is a C>T mutation at the position of 54971936bp of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version, or a T>C mutation at the position of 54972009bp of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version, or a C>G mutation at the position of 48300187bp of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version. Thus, by using the above-mentioned SNP molecular marker for breeding, a sow line with multiple teat number can be efficiently bred, and the reproductive performance and economic value of sows can be further improved.

[0010] In some embodiments, the application of the method comprises the following steps:

[0011] 1) detecting the SNP molecular marker in the gilt;

[0012] 2) selecting and keeping the individual with TT genotype at the position of 54971936bp as the breeding sow, and mating the breeding sow;

[0013] or selecting and keeping the individual with TT genotype at the position of 54972009bp as the breeding sow, and mating the breeding sow;

[0014] or selecting and keeping the individual with CC genotype at the position of 48300187bp as the breeding sow, and mating the breeding sow;

[0015] 3) detecting the SNP molecular marker in the piglet born from the mating in step 2), keeping the piglet according to the genotype as described in step 2), and breeding, so as to breed the pig line with the trait of more teats.

[0016] According to the fourth aspect of the present application, there is provided an application of the SNP molecular marker in improving the trait of teat number in sows, wherein the SNP molecular marker is C>T mutation at the position of 54971936bp on chromosome 14 of the pig genome Ensembl Sscrofa11.1 version, or T>C mutation at the position of 54972009bp on chromosome 14 of the pig genome Ensembl Sscrofa11.1 version, or C>G mutation at the position of 48300187bp on chromosome 14 of the pig genome Ensembl Sscrofa11.1 version. Thus, the trait of teat number in sows can be improved by the SNP molecular marker, and the teat number of the sow population can be further improved, and the reproductive performance and market competitiveness of the sow population can be improved.

[0017] In some embodiments, the application comprises the following steps:

[0018] 1) detecting the SNP molecular marker in the gilt;

[0019] 2) selecting and keeping the individual with TT genotype at the position of 54971936bp as the breeding sow, and mating the breeding sow;

[0020] or selecting and keeping the individual with TT genotype at the position of 54972009bp as the breeding sow, and mating the breeding sow;

[0021] or selecting the individuals with CC genotype at the 48300187bp locus detected in step 1) as the breeding sows, and mating the breeding sows;

[0022] 3) detecting the SNP molecular marker in the piglets born in step 2), and selecting the individuals with the superior genotype according to the genotypes as described in step 2), and then breeding, retaining the individuals with the superior genotype in the offspring, and eliminating the individuals with other genotypes, so as to increase the frequency of the superior allele from generation to generation, thereby improving the teat number trait of the sow population and improving the teat number of the offspring sows.

[0023] According to a fifth aspect of the present application, there is provided an application of the SNP molecular marker in detecting / screening / identifying the teat number trait of sows, the SNP molecular marker being a C>T mutation at the 54971936bp locus of chromosome 14 in the pig genome Ensembl Sscrofa11.1 version, or a T>C mutation at the 54972009bp locus of chromosome 14 in the pig genome Ensembl Sscrofa11.1 version, or a C>G mutation at the 48300187bp locus of chromosome 14 in the pig genome Ensembl Sscrofa11.1 version. Thus, by means of the above-mentioned molecular marker, the teat number trait of sows can be detected / screened / identified conveniently, efficiently, safely and specifically.

[0024] In some embodiments, the sows are Landrace or Large White sows.

[0025] According to a sixth aspect of the present application, there is provided a nucleotide sequence containing a SNP molecular marker related to the teat number trait of pigs, the sequence containing the nucleotide sequence as shown in SEQ ID No:1, and the M in the sequence representing a C>T base mutation; or containing the nucleotide sequence as shown in SEQ ID No:2, and the M in the sequence representing a T>C base mutation; or containing the nucleotide sequence as shown in SEQ ID No:3, and the M in the sequence representing a C>G base mutation. Thus, by means of the sequence, the corresponding primers or probes can be designed to detect / screen / identify the SNP molecular marker, which can then be used for the selection of the teat number trait of sows, so as to improve the teat number and reproductive performance of the sow population, effectively shorten the breeding period, and improve the economic value and market competitiveness of sows.

[0026] According to a seventh aspect of the present application, there is provided use of the nucleotide sequence containing the nucleotide sequence as shown in SEQ ID No: 1, wherein M represents a C>T base mutation; or containing the nucleotide sequence as shown in SEQ ID No: 2, wherein M represents a T>C base mutation; or containing the nucleotide sequence as shown in SEQ ID No: 3, wherein M represents a C>G base mutation, in the preparation of a product for detecting / screening / identifying a SNP molecular marker associated with the pig teat number trait, so that the product or kit for detecting the pig teat number trait can be prepared from the sequence, and the detection or use is more convenient and efficient.

[0027] Advantages of the present application:

[0028] 1. The present application identifies three SNP molecular markers yz_rs329085302, rs320468838 and yz_rs325631013 on chromosome 14 affecting the teat number of breeding pigs, and there are extremely significant differences in the left teat number, right teat number and total teat number of breeding pigs with different genotypes of each marker (Tables 1-3). The three new SNP molecular markers can be used for evaluating the teat number of pigs for non-diagnostic and therapeutic purposes. Compared with the current PCR-RFLP method, the present application has the outstanding advantages of simplicity, speed, high sensitivity and good specificity.

[0029] 2. The application of the three new SNP molecular markers can effectively improve the teat number of sows, and can be used for breeding sows with multiple teat number and improving the teat number trait of sows, and can also be used for detecting / screening / identifying the teat number trait of sows, so that the teat number trait of sows can be simply and efficiently selected, the breeding efficiency is improved, the reproductive performance of sows is improved, and the economic benefits are further improved.

[0030] 3. The nucleotide sequence containing the SNP molecular marker associated with the teat number trait of sows is also disclosed. The corresponding primers or probes can be designed from the sequence to detect / screen / identify the SNP molecular marker, which can then be used for the selection of the teat number trait of sows, so as to improve the teat number and reproductive performance of sow populations, effectively shorten the breeding period, and improve the economic value and market competitiveness of sows. BRIEF DESCRIPTION OF DRAWINGS

[0031] Figure 1 The Manhattan plot of yz_rs329085302 and rs320468838, wherein the SNP sites of yz_rs329085302 and rs320468838 are indicated in the figure;

[0032] Figure 2Manhattan plot of the molecular marker yz_rs325631013, wherein the SNP site yz_rs325631013 is indicated in the plot. DETAILED DESCRIPTION

[0033] The application will be further described in detail below with reference to the accompanying drawings.

[0034] Example 1, screening of molecular markers

[0035] (1) Phenotype-pedigree data collection

[0036] The research population of the present application is the breeding pigs of six populations of Dan-line Large White, Hua-line Large White, Top-line Large White, Dan-line Landrace, Hua-line Landrace and Top-line Landrace, all from the core breeding pig farm of Guangxi Yangxiang Group Co., Ltd. Phenotype data such as the number of left teats, the number of right teats, the number of teats before the navel, etc. were recorded from 2015 to 2022. The total number of teats was calculated according to the formula: total number of teats = number of left teats + number of right teats. After filtering the abnormal phenotype data, a total of 15,214 pig teat number trait observations were obtained for phenotype and genotype association analysis.

[0037] (2) Genotyping and quality control

[0038] Ear tissue samples or blood samples of breeding pigs were collected, total DNA was extracted, and qualified DNA samples were genotyped using a pig 80K functional site gene chip [Shadowgene, CHN, DNBSEQ-T7 (Huada Intelligent Manufacturing)]. PLINKv2.0 software was used for quality control, with the following conditions: exclude SNP sites on unknown positions and sex chromosomes, retain individuals with a detection rate of ≥90%; SNP detection rate ≥90%; minimum allele frequency ≥0.01; Hardy-Weinberg equilibrium P value ≥10 -6 Beagle software (version 4.1) was used to fill in the missing genotype sites. After filling, quality control was performed again, with the same conditions as before. A total of 7,506 pigs had both phenotype and genotype data for subsequent analysis.

[0039] (3) Principal component analysis and quality control

[0040] The PLINK v2.0 software is used to evaluate the population structure. Principal Component Analysis (PCA) is performed on the SNP chip data after quality control, and the first 5 principal component characteristics are calculated. The first three principal components are used to draw the principal component result graph. Since Dan Lai Changbai and Huai Lai Changbai cannot be distinguished in the first three principal components, they are analyzed as a group in the subsequent analysis. According to the results, the discrete population outside the 95% confidence interval is removed, and finally the data of 7338 pigs in 5 groups such as Dan Lai Huai Lai Changbai, Topk Changbai, Dan Lai Da Bai, Huai Lai Da Bai, and Topk Da Bai are divided for subsequent analysis. The original chip data of the five groups is extracted from the original chip data, and the PLINK v2.0 software and beagle software (version 4.1) are used for quality control-filling-quality control. The operation steps and quality control conditions are the same as before, and 3729 Dan Lai Da Bai and 74147 SNPs, 250 Huai Lai Da Bai and 100066 SNPs, 263 Topk Da Bai and 94946 SNPs, 2914 Dan Lai Huai Lai Changbai and 88625 SNPs, and 182 Topk Changbai and 69752 SNPs are obtained as the final data analysis.

[0041] (4) Statistical model

[0042] 4.1 Whole genome association analysis model

[0043] The GEMMA software is used to perform whole genome association analysis on the teat number traits of the five groups by using a single variable mixed linear model. The single variable mixed linear model is as follows:

[0044] y = Wα + Xβ + μ + ε

[0045] Where y is the phenotype vector, W is the indicator matrix of fixed effects and covariates, including gender, field, year, season, and the first three principal component characteristics of PCA, and α is the corresponding correlation coefficient in each fixed effect; X is the indicator matrix of SNPs, and β represents the effect vector of SNPs; μ is an n x 1 random effect matrix, and ε represents the residual.

[0046] 4.2 Meta-analysis model

[0047] The METAL software is used to combine the weights of the GWAS results of the five groups for meta-analysis. Based on the METAL software, the effect direction and result P value of the target group are converted into Z-scores, and the calculation formula of the Z-test statistic (Z-scores) is as follows:

[0048]

[0049] Wherein Pi is the P value of the i th population, Δi represents the effect direction of the i th population, and Ni is the sample size of the i th population.

[0050] (5) Marker screening

[0051] The results of the meta-analysis were processed, and the results were corrected using the False Discovery Rate (FDR) method, with the FDR set to 0.01, and the threshold formula being:

[0052] P = FDR x n / m

[0053] Where FDR is the set value 0.01, n is the number of sites with a P value less than 0.01 in the GWAS results, and m is the total number of SNP sites after quality control.

[0054] A Manhattan plot was drawn for the effect values of all the above markers, and SNP markers below the threshold line were displayed and screened, as shown in Figure 1 and 2 .

[0055] Example Two, Effect of Different Genotypes on Sow Teat Number

[0056] A Manhattan plot was drawn for the effect values of all the markers, and SNP markers below the threshold line were displayed and screened Figures 1-2 , as shown in Figure 1 , 2 SNP molecular markers associated with the teat number trait were screened on chromosome 14, designated as yz_rs329085302 and rs320468838, as shown in Figure 2 , 1 SNP molecular marker associated with the teat number trait was screened on chromosome 14, designated as yz_rs325631013. Variance analysis and multiple comparisons (R statistical analysis platform) were used to analyze the differences in left teat number, right teat number, and total teat number of sow populations with different genotypes (Tables 1-3), and the specific results are as follows:

[0057] 1. Nucleotide sequence of yz_rs329085302 molecular marker site and analysis of teat traits of different genotypes

[0058] The yz_rs329085302 molecular marker is located at position 54971936 bp on chromosome 14 of the pig genome Ensembl Sscrofa11.1 by referring to Ensembl (Sscrofa11.1), which is a C>T mutation. The nucleotide sequence 100 bp upstream and downstream of the SNP marker is shown in SEQ ID No: 1, wherein the 101st M(C / T) position represents a C>T base mutation:

[0059] GCTGGYGTGTGTCACCAGGCACCRTGCCAGACTCATTTCTTGKATTTT

[0060] CACAATGCCCTGGGAGGCAGATGGGACATGAAACCCTGACACKGTCT YRCTG M(C / T) RCTTGAGTCTCTSCTATTTGCCCCACTGGCCAGCATCCC ATATTCTGGAAGCTTCTTAAGCAGGCTTTCATCYGGAGGTCTGTGACC CAACCACTCGGGT (SEQ ID No: 1).

[0061] By the nucleotide sequence, primers or probes can be designed to detect the genotype of the yz_rs329085302 locus SNP molecular marker, and then further select the sow teat number trait according to the detection result; or the primers are designed to make a corresponding detection kit to directly detect the yz_rs329085302 locus SNP molecular marker of the pig, and then select the sow teat number trait according to the detected genotype.

[0062] The molecular marker can be used as a molecular marker for detecting the teat number trait of a breeding pig, and when the 101st nucleotide in the above sequence is T, the breeding pig is likely to have more teats, and the results are shown in Table 1:

[0063] Table 1 Teat number traits of breeding pigs with different genotypes of the yz_rs329085302 marker

[0064]

[0065] Note: P<0.05 is significantly different; P<0.01 is extremely significantly different.

[0066] As shown in the results in Table 1, the left teat number, right teat number and total teat number of the TT genotype of the yz_rs329085302 marker are 0.12, 0.17 and 0.29 more than those of the CC genotype. Moreover, the left teat number, right teat number and total teat number of the TT genotype are extremely significantly (P<0.01) higher than those of the CC and CT genotypes, but there is no significant difference between the CC and CT genotypes. Therefore, TT is the dominant genotype, T is the dominant allele, and the T allele can significantly increase the teat number. Therefore, when the allele of the yz_rs329085302 molecular marker is T, the breeding pig is likely to have more teats, and should be retained, and the C allele should be eliminated.

[0067] 2. Nucleotide sequence of the rs320468838 molecular marker locus and analysis of teat traits of different genotypes

[0068] The rs320468838 marker is located at the position of 54972009 bp on chromosome 14 of Ensembl Sscrofa 11.1 by referring to Ensembl (Sscrofa 11.1), which is a T>C mutation, and the position is less than 100 bp away from the marker yz_rs329085302, and the nucleotide sequence of 100 bp upstream and downstream of the marker is shown in SEQ ID No: 2, wherein the 101st nucleotide M(T / C) represents T>C mutation: ACATGAAACCCTGACACKGTCTYRCTGYRCTTGAGTCTCTSCTATTTG CCCCACTGGCCAGCATCCCATATTCTGGAAGCTTCTTAAGCAGGCTTT CATC M(T / C) GGAGGTCTGTGACCCAACCACTCGGGTATGTACTAAAAC ATRGGYTTATGGACCTGACCCTAGACTCACTACATCCTAATTTCAGAGTAGCAGCGCCCAG (SEQ ID No: 2).

[0069] By the nucleotide sequence, a primer or a probe can be designed to detect the genotype of the rs320468838 site SNP molecular marker, and then the sow's teat number trait is further selected according to the detection result; or a primer is designed to make a corresponding detection kit to directly detect the rs320468838 site SNP molecular marker of the pig, and then the sow's teat number trait is selected according to the genotype of the detection.

[0070] The molecular marker can be used as a molecular marker for detecting the teat number trait of a breeding pig, and when the 101st nucleotide in the above sequence is T, the breeding pig is likely to have more teats, and the results are shown in Table 2:

[0071] Table 2 Teat number trait of breeding pigs with different genotypes of rs320468838 marker

[0072]

[0073] As shown in the results in Table 2, the TT genotype of rs320468838 is 0.12, 0.17, and 0.29 more than the CC genotype in the number of left teats, right teats, and total teats, respectively. Moreover, the number of left teats, right teats, and total teats in the TT genotype is significantly (P < 0.01) higher than that in the CC and CT genotypes, but there is no significant difference between the CC and CT genotypes. Therefore, TT is the dominant genotype, T is the dominant allele, and the T allele significantly increases the number of teats. Therefore, when the allele of the rs320468838 molecular marker is T, the pig may have more teats, and the T allele should be retained, while the C allele should be eliminated.

[0074] 3. Nucleotide sequence of the yz_rs325631013 molecular marker site and analysis of teat traits of different genotypes

[0075] The yz_rs325631013 marker is located at position 48300187 bp on chromosome 14 of the pig genome Ensembl Sscrofa11.1 version by referring to Ensembl (Sscrofa11.1), which is a C>G mutation. The nucleotide sequence of 100 bp upstream and downstream of the SNP marker is shown in SEQ ID No: 3, wherein the 101st M(C / G) position represents a C>G mutation:

[0076] GGGCCCTAACCTAAGGGACCACAGCTTCTGTCCCTTCAGGGTGCAGG

[0077] CAAAGACATTCATCTTGTTAGCAAAGGAATAGGTTGTTGGGCAGCCTC CTCCT M(C / G) CCCCAGACCTGTTGGTTCTCCCCACTTGTCCTGTTACC AGAACAGGTACCCTCTTGGAAACCTCATTTTTTTGTGACCTGGCCCCT GCCCCATCCCTGC(SEQ ID No: 3).

[0078] Through the nucleotide sequence, primers or probes can be designed to detect the genotype of the yz_rs325631013 site SNP molecular marker, and then the sow teat number trait is further selected according to the detection results; or primers are designed to make a corresponding detection kit to directly detect the pig yz_rs325631013 site SNP molecular marker, and then the sow teat number trait is selected according to the detected genotype.

[0079] The molecular marker can be used to detect the molecular marker related to the number of teats of a boar, and when the 101th nucleotide in the sequence is C, the boar can have more teats, and the results are shown in Table 3:

[0080] Table 3 Number of teats of boars with different genotypes of the marker yz_rs325631013

[0081]

[0082]

[0083] As shown in the results in Table 3, the CC genotype of the marker yz_rs325631013 has 0.18, 0.12 and 0.30 more left teats, right teats and total teats than the GG genotype. Moreover, the number of left teats, right teats and total teats of the CC genotype is significantly (P<0.01) higher than that of the CG and GG genotypes, but the difference in the number of right teats and total teats between the CG and GG genotypes is not significant. Therefore, CC is the dominant genotype, C is the dominant allele, and the C allele significantly increases the number of teats. Therefore, when the allele of the molecular marker yz_rs325631013 is C, the boar can have more teats, and should be kept, and the allele G should be eliminated.

[0084] Example Three, Application of the SNP Molecular Marker in Breeding of a Line of Sows with More Teats

[0085] 1) Detecting one or more of the SNP molecular markers yz_rs329085302, rs320468838 and yz_rs325631013 in the backup sows;

[0086] 2) Selecting and keeping the individuals with the TT genotype of the alleles of the sites yz_rs329085302 and rs320468838, or the individuals with the CC genotype of the alleles of the site yz_rs325631013, detected in step 1), as breeding sows, and mating the breeding sows;

[0087] 3) Detecting the SNP molecular markers in the piglets born in step 2), and selecting and keeping the piglets according to the genotypes as described in step 2), and then breeding, so as to breed a line of sows with more teats.

[0088] Example Four, Application of the SNP Molecular Marker in Improving the Number of Teats of Sows

[0089] 1) Detecting one or more of the SNP molecular markers yz_rs329085302, rs320468838 and yz_rs325631013 in the backup sows;

[0090] 2) Selecting the individuals with TT genotype at the detected yz_rs329085302 and rs320468838 loci or the individuals with CC genotype at the yz_rs325631013 locus in step 1) as the breeding sows, and mating the breeding sows;

[0091] 3) Detecting the above-mentioned SNP molecular markers in the piglets born from the mating in step 2), and selecting the individuals with the superior genotypes according to the genotypes as described in step 2) for breeding, and retaining the individuals with the superior genotypes and eliminating the individuals with other genotypes to increase the frequency of the superior alleles generation by generation, thereby increasing the trait of the number of teats of the sow population and improving the number of teats of the offspring sows.

Claims

1. The application of a SNP molecular marker in improving the teat number trait in Large White or Landrace sows, wherein, The SNP molecular markers are: a C>T mutation at position 54971936 bp on chromosome 14 of the pig genome Ensembl Sscrofa 11.1; or a T>C mutation at position 54972009 bp on chromosome 14 of the pig genome Ensembl Sscrofa 11.1; or a C>G mutation at position 48300187 bp on chromosome 14 of the pig genome Ensembl Sscrofa 11.

1.

2. The application of a SNP molecular marker in breeding Large White or Landrace sows with a high number of nipples, wherein, The SNP molecular markers are: a C>T mutation at position 54971936 bp on chromosome 14 of the pig genome Ensembl Sscrofa 11.1; or a T>C mutation at position 54972009 bp on chromosome 14 of the pig genome Ensembl Sscrofa 11.1; or a C>G mutation at position 48300187 bp on chromosome 14 of the pig genome Ensembl Sscrofa 11.

1.

3. The application according to claim 2, wherein, The method of application includes the following steps: 1) Detect the SNP molecular markers in replacement Large White or Landrace sows; 2) Select individuals with the TT genotype at the 54971936bp allele detected in step 1) as breeding sows, and mate these breeding sows; Alternatively, individuals with the TT genotype at the 54972009bp allele detected in step 1) can be selected as breeding sows and mated with them. Alternatively, individuals with the CC genotype at the 48300187bp allele detected in step 1) can be selected as breeding sows and mated with them. 3) Test the SNP molecular markers on the piglets born from mating in step 2), retain them for breeding according to the genotypes described in step 2), and then breed them to cultivate Large White or Landrace sow breeds with multiple teats.

4. The application of an SNP molecular marker in improving the teat number trait in Large White or Landrace sows, wherein, The SNP molecular markers are: a C>T mutation at position 54971936 bp on chromosome 14 of the pig genome Ensembl Sscrofa 11.1; or a T>C mutation at position 54972009 bp on chromosome 14 of the pig genome Ensembl Sscrofa 11.1; or a C>G mutation at position 48300187 bp on chromosome 14 of the pig genome Ensembl Sscrofa 11.

1.

5. The application according to claim 4, wherein, The application includes the following steps: 1) Detect the SNP molecular markers in replacement Large White or Landrace sows; 2) Select individuals with the TT genotype at the 54971936bp allele detected in step 1) as breeding sows, and mate these breeding sows; Alternatively, individuals with the TT genotype at the 54972009bp allele detected in step 1) can be selected as breeding sows and mated with them. Alternatively, individuals with the CC genotype at the 48300187bp allele detected in step 1) can be selected as breeding sows and mated with them. 3) Test the SNP molecular markers of the piglets born from mating in step 2), retain them for breeding according to the genotypes described in step 2), and then breed them. Retain individuals with the dominant genotypes in the offspring pigs and eliminate other genotypes to increase the frequency of the dominant alleles generation by generation, thereby increasing the number of teats in the Large White or Landrace sow population and improving the number of teats in the offspring sows.

6. The application of a SNP molecular marker in the detection / screening / identification of the teat count trait in Large White or Landrace sows, wherein, The SNP molecular markers are: a C>T mutation at position 54971936 bp on chromosome 14 of the pig genome Ensembl Sscrofa 11.1; or a T>C mutation at position 54972009 bp on chromosome 14 of the pig genome Ensembl Sscrofa 11.1; or a C>G mutation at position 48300187 bp on chromosome 14 of the pig genome Ensembl Sscrofa 11.

1.

7. The application of nucleotide sequences containing SNP molecular markers associated with the number of teats in the preparation of SNP molecular marker products for the detection / screening / identification of SNP molecular markers associated with the number of teats in Large White or Landrace sows, wherein, The nucleotide sequence is as shown in SEQ ID No:1, where M represents a C>T base mutation; or the nucleotide sequence is as shown in SEQ ID No:2, where M represents a T>C base mutation; or the nucleotide sequence is as shown in SEQ ID No:3, where M represents a C>G base mutation.

Images