Application of Maize Gene ZmEREB147 in Controlling Maize Flowering Time

Abstract

The present invention belongs to the field of plant genetic engineering technology. Specifically, it relates to the application of maize gene ZmEREB147 in controlling the flowering period of maize. The applicant has isolated a gene located on maize chromosome 3 that can control the flowering period of maize by using genetic methods. ZmEREB147 This gene controls important agricultural traits in maize, such as tasseling and pollen shedding. Reducing its expression level could advance the tasseling and pollen shedding periods, providing genetic resources and theoretical support for maize breeding.

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering technology and specifically relates to the application of the maize gene ZmEREB147 in controlling the flowering period of maize. The gene of the present invention is located on the third chromosome of maize and controls important agricultural traits of maize, such as tasseling and pollen shedding. Background Art

[0002] In agricultural production, the flowering period traits of corn are closely linked to its late-maturing and early-maturing traits. Conducting research on flowering period regulation is of great significance to molecular breeding for genetic improvement of corn growth period and innovation of germplasm resources.

[0003] Flowering is a crucial physiological change for plants, transitioning most plants from vegetative growth (stem and leaf production) to reproductive growth (inflorescence production). It is a crucial developmental transition in the plant life cycle and plays a crucial role in the overall growth and developmental stages. Flowering is influenced by both the plant's own genetic factors and external environmental factors. Under these influences, florigen is transported from the leaves to the stem apex via conducting tissues, stimulating the formation of the apical meristem and inducing flowering. Flowering traits generally include tasseling, pollen shedding, and silking, and are important traits in crop evolution and adaptation. Discovering the key genes that control maize flowering and better understanding the mechanisms that regulate it are crucial for breeding, screening, and improving new maize varieties suitable for cultivation in different ecological zones.

[0004] The applicant previously disclosed the function of ZmEREB147 in increasing corn yield, but there has been no report on the gene being related to controlling flowering time.

[0005] In light of this, this study used genetic methods to isolate a gene, ZmEREB147, located on maize chromosome 3, that controls flowering time. This gene encodes an APETALA2 / ETHYLENE RESPONSE FACTOR (AP2 / ERF) transcription factor, involved in signal transduction in the ethylene signaling pathway. Based on the genetic phenotypes of the transgenic material and related molecular biological analyses, the biological function of this gene in controlling traits such as tasseling, silking, and pollen shedding was confirmed. Genetic transformation studies of ZmEREB147 can provide genetic resources and theoretical support for maize breeding. Summary of the Invention

[0006] The purpose of the present invention is to provide an application of the maize gene ZmEREB147 in controlling the flowering period of maize. The amino acid sequence encoded by the gene is shown in SEQ ID NO.2.

[0007] In order to achieve the above object, the present invention adopts the following technical measures:

[0008] Application of maize gene ZmEREB147 in controlling maize flowering period, the amino acid sequence encoded by the gene is shown in SE Q ID NO.2;

[0009] The applications described above are specifically:

[0010] Knockout or inhibition of the gene encoding the protein shown in SEQ ID NO. 2 in corn to advance the flowering time of corn;

[0011] In the above application, preferably, the knockout method includes: homologous recombination or CRISPR-Cas9 technology, and the protein translated from the knocked-out gene has no original function or cannot be translated into protein;

[0012] In the above-mentioned application, preferably, the inhibition method includes: antisense RNA technology or interfering RNA technology.

[0013] In the above application, preferably, the knockout method uses CRISPR-Cas9 technology, and the gRNA is: CCGTTCAAGGGCTATCCTGTCG;

[0014] In the above application, preferably, the gene is shown as SEQ ID NO.1.

[0015] A method for preparing early-flowering transgenic corn comprises knocking out or inhibiting the gene encoding the protein shown in SEQ ID NO. 2 in the corn.

[0016] Compared with the prior art, the present invention has the following advantages:

[0017] This study cloned and confirmed a gene, ZmEREB147, that controls flowering time in maize. The relationship between tasseling and pollen shedding periods and ZmEREB147 expression levels was confirmed, demonstrating that reducing ZmEREB147 expression levels can advance both the tasseling and pollen shedding periods. The difference in flowering time between transgenic and wild-type materials is due to editing of the gene's coding region, which results in a decrease in the level of the protein encoded by the gene. In terms of its mechanism of action, it is believed that this gene regulates the expression levels of downstream genes involved in floral transition, thereby influencing flowering traits such as tasseling and pollen shedding in maize. Therefore, this study provides a new genetic resource for improving maize flowering time. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Schematic diagram of ZmEREB147 gene editing in maize;

[0019] Schematic diagram of the editing of the maize ZmEREB147 gene, where EREBP147-cr1 lacks the AA base and EREBP147-cr2 lacks the A base. The insertion and deletion of these bases lead to the premature termination of protein translation.

[0020] Figure 2 Schematic diagram of the phenotype of maize ZmEREB147 knockout plants;

[0021] Among them: a is a schematic diagram of the phenotype of the maize ZmEREB147 gene knockout material, from left to right are: the wild-type family (WT) obtained by separating transgenic heterozygous plants, two ZmEREB147 gene-edited families CR-EREBP147-1 and CR-EREBP147-2; b is a schematic diagram of the investigation of the tasseling period of the maize ZmEREB147 gene knockout material; c is a schematic diagram of the investigation of the pollen shedding period of the maize ZmEREB147 gene knockout material.

[0022] Figure 3 Schematic diagram of the expression pattern of the maize ZmEREB147 gene;

[0023] In situ hybridization of mRNA in SAM (shoot apical meristem) using antisense ZmEREB147 probe (a) and sense probe (b) showed that ZmEREB147 was highly expressed in maize SAM tissue. DETAILED DESCRIPTION

[0024] The following examples further define the present invention. Based on the following description and examples, those skilled in the art can determine the essential features of the present invention and, without departing from the spirit and scope of the present invention, can make appropriate improvements and modifications to the present invention to make it suitable for various uses and conditions. The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art; the reagents or materials described, unless otherwise specified, are all from commercial channels or published materials.

[0025] Example 1: ZmEREB147 cloning

[0026] Total DNA was extracted from leaves of the maize inbred line KN5585 (Liu, et al. High-throughput CRISPR / Cas9 mutagenesis stremalines trait gene identification in maize. The Plant Cell, 2020, 32: 1397–1413). Primers 147-F and 147-R were designed based on the maize B73 genome reference sequence (National Crop Germplasm Center) (primer names and sequences are shown in Table 1). The ZmEREB147 gene was amplified by PCR and resequenced in the KN5585 material to obtain the complete nucleotide sequence of the ZmEREB147 gene. The CDS sequence of the ZmEREB147 gene obtained by sequencing is shown in SEQ ID NO.1, encoding the protein shown in SEQ ID NO.2.

[0027] Table 1. Primers used in the present invention and their sequences

[0028]

[0029] Example 2: Knockout and phenotypic identification of ZmEREB147 in maize KN5585

[0030] Gene target design was performed using the CRISPR-P website (http: / / cbi.hzau.edu.cn / crispr / ). The ZmEREB147 Guide RNA1 sequence (CCGTTCAAGGGCTATCCTGTCG) was obtained. Target primers, designated Target-1F, were designed based on the Guide RNA sequence. The ZmU6 promoter was amplified using pU6F1 and pU6R. The Target+sgRNA fragment was amplified using Target-1F and gRR0. The ZmU6-Target1-sgRNA fragment was overlapped with pU6F1 and gRR0 and then homologously recombined into the HindIII-digested CPB-ZmUbi-hspCas9 vector (CN116574754A). (Primer sequences are shown in Table 1, Primer ID is 2). The resulting clones were sequenced using CRISPR vector detection primers (primer sequences are shown in Table 1, Primer ID is 3) to confirm that the target fragment was attached to the vector.

[0031] The correctly cloned plasmid was transformed into the maize inbred line KN5585 via Agrobacterium-mediated transformation (genetic transformation was completed by Jiangsu Weimi Biotechnology Co., Ltd.). Using ZmEREB147-specific detection primers (primer sequences are shown in Table 1, primer ID is 4), two maize transformation events with ZmEREB147 knockout were screened and obtained ( Figure 1), CR-EREBP147-1 and CR-EREBP147-2 (the ZmEREB147 gene sequences after knockout are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively, wherein CR-EREBP147-1 lacks AA bases,; CR-EREBP147-2 lacks A bases, ( Figure 1 ).

[0032] WT, cr-erebp147-1 and cr-erebp147-2 Hainan were planted in two rows for each material, with three replicates planted in randomized blocks. The growth period of the maize materials was observed when they began to tassel.

[0033] Phenotypic values ​​for maize tasseling and pollen shedding were investigated in Hainan in 2023. The results showed that compared to the wild-type (WT) strain, tasseling and pollen shedding were delayed by 2-3 days in the cr-erebp147-1 strain, and by 1-2 days in the cr-erebp147-2 strain. These results demonstrate that knocking down ZmEREB147 expression significantly advances both tasseling and pollen shedding, indicating that ZmEREB147 negatively regulates maize growth.

[0034] Example 3: Expression analysis of ZmEREB147

[0035] RNA in situ hybridization was used to verify the specific expression pattern of ZmEREB147 in 18-day SAM tissues, and it was strongly expressed in SAM tissues ( Figure 3 A, primer sequences are shown in Table 1, and primer ID is 5); it is speculated that this gene affects the floral transition of maize.

Claims

1. Application of the maize gene ZmEREB147 for controlling maize flowering time. The amino acid sequence encoded by the gene is shown in SEQ ID NO.

2. The application process includes: Knockout or inhibition of the gene encoding the protein shown in SEQ ID NO. 2 in corn can advance the flowering time of corn.

2. The use according to claim 1, characterized in that: The knockout method includes: homologous recombination or CRISPR-Cas9 technology, and the protein translated from the knocked-out gene has no original function or cannot be translated into protein.

3. The use according to claim 1, characterized in that: The inhibition methods include: antisense RNA technology or interfering RNA technology.

4. The use according to claim 2, characterized in that: The knockout method uses CRISPR-Cas9 technology, and the gRNA is: CCGTTCAAGGGCTATCCTGTCG.

5. The use according to claim 1, characterized in that: The gene is shown in SEQ ID NO.

1.

6. A method for preparing early-flowering transgenic corn, comprising knocking out or inhibiting the gene encoding the protein shown in SEQ ID NO. 2 in corn.

Images