SbERF027 protein related to cold resistance of sorghum at seedling stage and related biological materials and application of SbERF027 protein

Abstract

The invention discloses a SbERF027 protein related to cold resistance in a sorghum seedling stage and a related biological material and application of the SbERF027 protein in the technical field of kits in the technical field of biology, the SbERF027 gene in the sorghum seedling stage is instantaneously silenced by adopting a VIGS technology, and a new sorghum gene capable of obviously improving the cold resistance in the sorghum seedling stage is obtained. According to the method, the cold resistance of the sorghum at the seedling stage is improved, gene resources capable of improving the cold-resistant germplasm of the sorghum are innovatively obtained, and the method has important significance on new variety cultivation, environmental sanitation and grain safety and has great application and popularization values.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a SbERF027 protein related to cold tolerance at the sorghum seedling stage and related biological materials and applications thereof. Background Art

[0002] Sorghum (Sorghum bicolor (L.)) is one of the four major cereal crops in the world. It is a thermophilic crop originating from tropical or subtropical regions and is extremely sensitive to low temperatures. In low-temperature producing areas such as high latitudes and high altitudes, low temperature and chilling damage at the sorghum seedling stage has become one of the important factors affecting its yield and planting areas. Low temperature stress at the seedling stage seriously delays seedling growth, reduces the seedling rate, and ultimately affects sorghum yield.

[0003] Sorghum is the fifth largest cereal crop in the world and an important raw material for brewing Guizhou Maotai-flavor liquor. It originated in semi-arid tropical regions and is a warm-season crop with strong drought and heat resistance, but is more sensitive to low temperature stress. Chilling damage, as an agricultural meteorological disaster, mainly occurs during the crop growing season. As the temperature drops below the lower limit that the crop can tolerate, the crop is harmed, which in turn affects its normal growth and yield. In the actual production of sorghum, it is very susceptible to low temperature stress, especially during the germination and seedling stages. The root cause is that sorghum is sown in early spring, when the temperature is changeable, and low temperatures and late spring cold weather occur from time to time. As a result, the sorghum has a low emergence rate and mildew after low temperature stress, resulting in yield losses, which seriously restricts sorghum production.

[0004] Therefore, seedling cold damage is the most serious period affecting sorghum yield, and the study of sorghum seedling cold tolerance is of great significance. However, the use of traditional breeding methods to cultivate cold-tolerant sorghum varieties takes a long time and progress is relatively slow. The use of genetic engineering technology can directly transform the genetic background of plants at the gene level and transform the genetic traits of plants in a targeted manner. Therefore, the discovery of sorghum seedling cold tolerance genes is of great theoretical and practical significance for the breeding of new cold-tolerant sorghum varieties. Summary of the invention

[0005] The present invention aims to provide a SbERF027 protein related to cold tolerance in the sorghum seedling stage and related biological materials and applications thereof, so as to regulate the cold tolerance in the sorghum seedling stage.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] A SbERF027 protein related to cold tolerance in sorghum seedling stage, wherein the SbERF027 protein is the following protein A1), A2) or A3):

[0008] A1) the amino acid sequence is the protein of SEQ ID No. 1 in the sequence list;

[0009] A2) a protein obtained by replacing and / or deleting and / or adding amino acid residues of the protein of A1) and having 75% or more identity with the protein of A1) and having activity of regulating cold tolerance at the seedling stage of sorghum;

[0010] A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of A1) or A2).

[0011] The above-mentioned protein can be derived from sorghum.

[0012] In the above application, the identity of the protein refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences, the identity value (%) can be obtained.

[0013] In the above applications, the above 75% identity of the proteins may be at least 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% identity.

[0014] In the above application, the protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc. The amino acid sequences of some of the available tags are shown in Table 1.

[0015] Table 1 Tag sequences

[0016] Label Residue sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHQ c-myc 10 EQKLISEEDL

[0017] The above proteins can be artificially synthesized, or their encoding genes can be synthesized first and then expressed biologically.

[0018] In the above application, the gene is a nucleic acid molecule encoding SbERF027 protein.

[0019] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0020] In the above application, the gene may be a cDNA molecule or a DNA molecule whose coding sequence of the coding chain is SEQ ID No. 2.

[0021] In the above application, the substance regulating gene expression is any one of the following F1, F2 or F3:

[0022] F1, sgRNA, siRNA, shRNA, miRNA or antisense RNA targeting the gene;

[0023] F2, a DNA molecule that produces an sgRNA targeting the gene, a DNA molecule that produces an siRNA targeting the gene, a DNA molecule that produces an shRNA targeting the gene, a DNA molecule that produces an miRNA targeting the gene, or a DNA molecule that produces an antisense RNA targeting the gene;

[0024] F3. an expression vector that produces an sgRNA targeting the gene, an expression vector that produces an siRNA targeting the gene, an expression vector that produces an shRNA targeting the gene, an expression vector that produces an miRNA targeting the gene, or an expression vector that produces an antisense RNA targeting the gene.

[0025] In order to solve the above technical problems, the present invention provides a reagent for improving the cold tolerance of sorghum seedlings, wherein the active ingredient of the reagent is the above-mentioned substance for regulating gene expression.

[0026] The active ingredients of the above-mentioned reagents may also contain other biological components and / or non-biological components. Those skilled in the art can determine the other active ingredients of the above-mentioned agents based on the cold resistance effect of sorghum seedlings.

[0027] In order to solve the above technical problems, the present invention also provides a method for improving the cold tolerance of sorghum at the seedling stage, comprising the following steps: inhibiting the expression of the SbERF027 protein in the recipient sorghum, reducing the abundance of the SbERF027 protein, and / or silencing the gene encoding the SbERF027 protein, so as to obtain the target sorghum having higher cold tolerance at the seedling stage than that of the recipient sorghum.

[0028] In the above method, the inhibition of the expression of the SbERF027 protein in the receptor sorghum, the reduction of the abundance of the SbERF027 protein, and / or the silencing of the gene encoding the SbERF027 protein can be achieved through the VIGS (virus induced genesilencing, VIGS) system, and the VIGS system includes expression plasmids containing pTRV2-SbERF027 and pTRV2, and the target sequence of the pTRV2 can be positions 200-650 (450 bp in total) of SEQ ID No. 2 in the sequence list.

[0029] The present invention also provides the SbERF027 protein.

[0030] The present invention also provides a biological material related to the SbERF027 protein, wherein the biological material is any one of the following B1) to B5):

[0031] B1) a nucleic acid molecule encoding the protein;

[0032] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0033] B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0034] B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0035] B5) A transgenic plant cell line, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant cell line, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the expression cassette described in B2).

[0036] The present invention provides an application of a substance for regulating gene expression in regulating cold tolerance at the seedling stage of sorghum or in preparing a product for regulating cold tolerance at the seedling stage of sorghum, wherein the gene encodes the SbERF027 protein. The present invention uses VIGS technology to silence the sorghum SbERF027 gene, providing a basis for obtaining a new sorghum germplasm with significantly improved cold tolerance at the seedling stage. The invention is of great significance to the innovation of sorghum cold-resistant germplasm resources, new variety breeding, environmental hygiene and food security, and has great application and promotion value. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 A schematic diagram of a climate box for treating seedling materials in an embodiment of the present invention;

[0038] Figure 2The statistical results of the phenotypes and physiological indicators related to cold tolerance of two sorghum varieties, Suiza 7 (SZ7) and Zhong-5 (Z-5), at the seedling stage after 7 days of low temperature treatment in Example 1 of the present invention. Figure 2 Figure A shows the seedling stage photos of two materials after low temperature treatment (right side) and normal control (left side). Figure 2 Figures B, C, D and E are bar graphs of seedling survival rate, chlorophyll content, proline content and ion permeability, respectively. In the figures, "*" and "**" indicate significant and almost significant differences, respectively, and ns indicates no significant difference.

[0039] Figure 3 This is the thermal map analysis result of SbERF027 in Example 1 of the present invention;

[0040] Figure 4 The expression results of SbERF027 in different tissues of SZ7 in Example 1 of the present invention, the internal reference is SbActin1 gene;

[0041] Figure 5 This is an analysis diagram of the expression pattern of SbERF027 in Example 1 of the present invention under cold induction in SZ7 and Z-5 seedlings, and the internal reference is the SbActin1 gene;

[0042] Figure 6 The phenotype of the SbERF027 silenced plant in Example 2 of the present invention;

[0043] Figure 7 The results of measuring the gene expression level, seedling survival rate and related cold tolerance indexes of the SbERF027 silenced plants and the control plants after cold treatment in Example 2 of the present invention are as follows: Figure 7 Figures A, B, C, D, E, and F are statistical diagrams of genetic variables, seedling survival rate, chlorophyll content, ion permeability, proline content, and malondialdehyde content. Different lowercase letters in the figure indicate that there are significant differences in the fruiting rate of different varieties;

[0044] Figure 8 These are the results of measuring gene expression, seedling survival rate and related cold tolerance indices of the SbERF027 rice overexpression strain and the control plant after cold treatment in Example 2 of the present invention. DETAILED DESCRIPTION

[0045] The following is further described in detail through specific implementation methods:

[0046] The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0047] The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

[0048] The sorghum varieties SZ7 and Z-5 in the following examples are both germplasm resources, and the original species are preserved in Jilin Academy of Agricultural Sciences. The public can obtain them from Maotai College (i.e., the applicant) to repeat the experiments of this application.

[0049] The Agrobacterium tumefaciens strain GV3101 in the following examples is recorded in the non-patent document "Cai Lanfeng. Research on Agrobacterium tumefaciens-mediated Sugarcane Genetic Transformation Technology. Master's degree thesis. Issue 08, 2014", which can be obtained by the public from Maotai College (ie, the applicant) to repeat the experiments of this application.

[0050] The following examples used Excel statistical software to process the data, and the experimental results were expressed as mean ± standard deviation. Duncant's test was used, and P < 0.05 (*) indicated a significant difference, and P < 0.01 (**) indicated a very significant difference.

[0051] Example 1. Acquisition of SbERF027 gene

[0052] 1. Acquisition of SbERF027 gene

[0053] In this study, two sorghum materials with significant differences in cold tolerance at the seedling stage were selected, namely Suiza 7 (hereafter referred to as SZ7) and Zhong-5 (hereafter referred to as Z-5).

[0054] Cold resistance identification method ( Figure 1 ), specifically:

[0055] Cold treatment in an artificial climate chamber (ZRX-460B): Sorghum seedlings grown to the seedling stage (three-leaf stage) under normal conditions were moved to an artificial climate chamber at 4°C for 7 days.

[0056] Control: Sorghum grown at room temperature to the seedling stage under normal conditions was not subjected to low temperature stress.

[0057] Each material was replicated with 15 plants.

[0058] After the cold stress ended, the test materials were transferred to room temperature to resume growth. After one week, the phenotypic identification was carried out and the survival rate of the seedlings was calculated:

[0059] Seedling survival rate = number of surviving seeds after treatment / total number of seeds × 100%.

[0060] The phenotypic identification results are shown in Figure 2 , indicating that the cold tolerance of SZ7 at the seedling stage was significantly higher than that of Z-5.

[0061] Two sorghum materials grown to the seedling stage under normal conditions were transferred to an artificial climate chamber at 4°C for 7 days, and the control was treated for 0h. The ears treated with low temperature for 0h, 2h, 8h and 16h were taken for transcriptome sequencing to obtain a series of differentially expressed genes. By comparing and analyzing the transcriptome factors in the differentially expressed genes, 16 common genes were screened out between different treatment time points, and heat map analysis of the above 16 genes was performed based on log2FC values ​​( Figure 3 ). It was found that the SORBI_3004G283300 gene was induced by low temperature in both sorghum materials, and the degree of induction in the cold-tolerant material SZ7 was significantly higher than that in the cold-sensitive material Z-5. At the same time, the gene was induced by low temperature in SZ7 earlier than in Z-5. Therefore, it is speculated that SORBI_3004G2833000 may be a candidate gene for regulating cold tolerance in sorghum seedlings. The nucleotide sequence of the SORBI_3004G2833000 gene is SEQ ID No.2, and the protein it encodes is SbERF027, and the amino acid sequence of the protein is SEQ ID No.1.

[0062] 2. Expression pattern of SbERF027 gene

[0063] Normal treatment: Take samples of different tissues of SZ7 under normal planting conditions, including seedlings, roots, stems, mature leaves, leaf sheaths, and spikes. After sampling, use liquid nitrogen to quickly freeze and store at -80℃ for later use.

[0064] Low temperature stress treatment: SZ7 and Z-5 grown to the seedling stage under normal conditions were transplanted into an artificial climate chamber at 4°C, and seedling leaf samples were taken at 0h, 2h, 8h, 16h, 1d, 2d, 4d, and 6d, respectively, quick-frozen in liquid nitrogen, and stored at -80°C for later use.

[0065] Total RNA was extracted from the samples treated above, and the first strand of cDNA was synthesized by reverse transcription using reverse transcriptase M-MLV. The first strand of cDNA was used as a template, and primers were used for real-time quantitative analysis, with SbActin1 as the internal reference gene. The SbERF027 amplification primer set consisted of qRT-SbERF027-F and qRT-SbERF027-R, and the SbActin1 amplification primer set consisted of Actin1-F and Actin1-R. The sequences are as follows:

[0066] SbERF027 amplification primers:

[0067] qRT-SbERF027-F:5'-GAGCGGCAAGTGGGTGTC-3';

[0068] qRT-SbERF027-R:5'-TACGTGCCGAGCCATATCC-3'

[0069] SbActin1 amplification primers:

[0070] Actin1-F:5'-CGAAGACATACTGGACGCAACA-3';

[0071] Actin1-R:5'-GGGCGGAAAGAATTAGAAGC-3'

[0072] The experiment was repeated three times.

[0073] The tissue expression pattern of SbERF027 Figure 4 It can be seen that the SbERF027 gene is expressed in different tissues, especially in the panicle and seedlings.

[0074] Analysis of cold-induced expression of SbERF027 Figure 5 It can be seen that both SZ7 and Z-5 were induced by low temperature, indicating that the SbERF027 gene is a gene related to low temperature stress, and the low temperature induction in the low temperature sensitive material Z-5 at the seedling stage was significantly lower than that in the cold-tolerant parent SZ7.

[0075] Example 2: Functional verification of SbERF027 gene

[0076] 1. Construction of SbERF027 VIGS silencing vector

[0077] The target was designed according to the literature description (Li et al: PbrMYB21, a novel MYB protein of Pyrusbetulaefolia, functions in drought tolerance and modulates polyamine levels by regulating arginine decarboxylase gene. Plant Biotechnology Journal, 15, 1186-1203). The specific target sequence was the nucleotide sequence at position 200-650 bp (450 bp in total) of SEQ ID No. 2.

[0078] pTRV2-SbREF027-F: AAGGTTACCGAATTCTCTAGAAGCAGCATCATCGGTTGCCApTRV2-SbREF027-R: CGTGAGCTCGGTACCGGATCCACGCCGTGCTGCTGCTGCTGAT

[0079] Recombination-ligation reaction using SoSoo Cloning Kit Ver.2 (Beijing Qingke) was used as follows: 2×SoSoo Mix 5ul, PCR purified product 1.4ul, vector pTRV2 3.6ul, reacted at 50℃ for 20min, immediately transferred into competent E. coli DH5α, ice bathed for 20min, heat-shocked at 42℃ for 1min, then propagated the bacterial solution in a constant temperature shaker and plated for culture. After PCR monoclonal detection and sequencing, the specific primer sequences are as follows:

[0080] Detection primer: SbREF027-F: 5′-AGCAGCATCATCGGTTGCCA-3′;

[0081] SbREF027-R:5'-ACGCCGTGCTGCTGCTGCTGAT-3';

[0082] Sequencing primer: SbREF027-F1: 5′-ATGGCTGAGCAGCC-3′;

[0083] SbREF027-R1:5'-CTACGGGTCATGGT-3'.

[0084] The sequencing results confirmed that the silencing target site of SbERF027 existed on the obtained recombinant vector, and finally the silencing vector of SbERF027 gene was obtained and named as pTRV2-SbREF027.

[0085] 2. Obtaining SbERF027 transiently silenced sorghum lines

[0086] The recombinant vector pTRV2-SbERF027 prepared above with the SbERF027 silencing target was transformed into Agrobacterium tumefaciens GV3101 by heat shock method to obtain the recombinant bacteria GV3101 / pTRV2-SbERF027, which was used to infect the young shoots (about 1 cm) of the transgenic receptor SZ7. Transient gene silencing sorghum seedlings were obtained, and their genomic DNA was extracted at the three-leaf stage. The expression level of SbERF027 was identified using the following primers. The expression level was significantly lower than that of the control plant, and it was selected for the next experiment.

[0087] qRT-SbERF027-F:5'-GAGCGGCAAGTGGGTGTC-3';

[0088] qRT-SbERF027-R:5'-TACGTGCCGAGCCATTCC-3'.

[0089] The plants infected in the same culture medium were regarded as one strain, and the expression level was the average value of multiple strains. The strains SbERF027-1 and SbERF027-1 were two gene transient silencing strains whose expression levels of gene SbERF027 were significantly lower than those of the control plants, and they can be used as cold-tolerant phenotype identification materials ( Figure 6 ).

[0090] 3. Identification of cold tolerance of SbERF027 transgenic sorghum

[0091] Artificial climate chamber cold resistance identification method ( Figure 1 The wild-type sorghum Z-5, SbERF027 sorghum silenced lines SbERF027-1 and SbERF027-2 were transferred to an artificial climate chamber at 4°C for 7 days, with 24 plants of each material being treated.

[0092] After the stress was over, the test materials were transferred to room temperature to resume sorghum growth. After one week, the survival rate of seedlings was observed and counted.

[0093] Survival rate = number of survivors after treatment / total number × 100%

[0094] The statistical results of seedling survival rate and related cold tolerance indexes are as follows Figure 7 As shown, it can be seen that under low temperature stress, the seedling survival rate, chlorophyll and proline content of the silent lines (SbERF027-1, SbERF027-2) were significantly lower than those of the control plants (WT), while the ion permeability and malondialdehyde content were significantly higher than those of the control plants.

[0095] The above results show that low temperature encountered in the seedling stage affects the physiological index contents of chlorophyll, proline, malondialdehyde and ion permeability, and ultimately affects the survival rate of sorghum. Under low temperature stress, the survival rate of seedlings of the silent strain was significantly lower than that of the cold-tolerant parent SZ7, indicating that the gene SbERF027 has the function of positively regulating seedling tolerance and can reduce the effect of temperature on survival rate under cold stress.

[0096] On the contrary, the results Figure 8 As shown, through overexpression in rice, it was found that the seedling survival rate, chlorophyll and proline content of the overexpression lines (OE2, OE6) under low temperature stress were significantly higher than those of the control plants (WT), while the ion permeability and malondialdehyde content were significantly lower than those of the control plants.

[0097] The above results show that low temperature encountered in the seedling stage affects the physiological index contents of chlorophyll, proline, malondialdehyde and ion permeability, and ultimately affects the survival rate of sorghum. Under low temperature stress, the survival rates of sorghum and rice seedlings are positively correlated with the expression level of the SbERF027 gene, indicating that the gene SbERF027 has the function of positively regulating seedling tolerance and can reduce the effect of temperature on survival rate under cold stress.

Claims

1. SbERF027 protein related to cold tolerance in sorghum seedling stage, characterized in that The SbERF027 protein is the following protein A1), A2) or A3): A1) the amino acid sequence is the protein of SEQ ID No. 1 in the sequence list; A2) a protein obtained by replacing and / or deleting and / or adding amino acid residues of the protein of A1) and having 75% or more identity with the protein of A1) and having activity of regulating cold tolerance at the seedling stage of sorghum; A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of A1) or A2).

2. The SbERF027 protein related to cold tolerance in sorghum seedling stage according to claim 1, characterized in that: The SbERF027 protein is derived from sorghum.

3. The SbERF027 protein related to cold tolerance in sorghum seedling stage according to claim 2, characterized in that: The gene is a cDNA molecule or a DNA molecule whose coding sequence of the coding chain is SEQ ID No.

2.

4. The SbERF027 protein related to cold tolerance in sorghum seedling stage according to claim 3, characterized in that: The substance regulating gene expression is any one of the following F1, F2 or F3: F1, sgRNA, siRNA, shRNA, miRNA or antisense RNA targeting the gene; F2, a DNA molecule that produces an sgRNA targeting the gene, a DNA molecule that produces an siRNA targeting the gene, a DNA molecule that produces an shRNA targeting the gene, a DNA molecule that produces an miRNA targeting the gene, or a DNA molecule that produces an antisense RNA targeting the gene; F3. an expression vector that produces an sgRNA targeting the gene, an expression vector that produces an siRNA targeting the gene, an expression vector that produces an shRNA targeting the gene, an expression vector that produces an miRNA targeting the gene, or an expression vector that produces an antisense RNA targeting the gene.

5. The SbERF027 protein related to cold tolerance at the sorghum seedling stage according to any one of claims 1 to 4 is used in a reagent for improving cold tolerance at the sorghum seedling stage, wherein the active ingredient of the reagent is the substance for regulating gene expression according to any one of claims 1 to 4.

6. The use of the SbERF027 protein related to cold tolerance in sorghum seedling stage according to claim 5, characterized in that: The method comprises the following steps: inhibiting the expression of the SbERF027 protein in a receptor sorghum, reducing the abundance of the SbERF027 protein, and / or silencing the gene of the SbERF027 protein, so as to obtain the target sorghum with higher cold tolerance than that of the receptor sorghum at the seedling stage.

7. The use of the SbERF027 protein related to cold tolerance in sorghum seedling stage according to claim 5, characterized in that: Increasing the expression of the SbERF027 protein in the recipient sorghum, increasing the abundance of the SbERF027 protein, and / or silencing the gene of the SbERF027 protein is achieved through a VIGS system, wherein the VIGS system includes expression plasmids containing pTRV2 and pTRV2-SbERF027, and the VIGS target sequence may be positions 200-650 of SEQ ID No. 2 in the sequence list.

8. The biomaterial related to the SbERF027 protein related to cold tolerance in sorghum seedlings according to any one of claims 1 to 4, characterized in that: The biological material is any one of the following B1) to B5): B1) a nucleic acid molecule encoding the protein according to claim 1; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5) A transgenic plant cell line, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant cell line, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the expression cassette described in B2).

Images