Plant transcription factor ap2 / erf family protein and its coding gene in the application of regulating the rose petal senescence and / or the level of reactive oxygen species

By inhibiting the expression of RhERF4-2 protein through gene silencing technology, the senescence of rose petals is delayed, solving the problem of premature petal senescence during the storage and transportation of cut roses and achieving the effect of extending the flowering period.

CN119192315BActive Publication Date: 2025-11-21CHINA AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411527684.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-30
Publication Date
2025-11-21
Estimated Expiration
2044-10-30

AI Technical Summary

Technical Problem

Premature senescence of petals is the main cause of loss in cut roses during long-distance storage and transportation, and existing technologies are unable to effectively delay petal senescence.

Method used

By utilizing the plant transcription factor AP2/ERF family protein RhERF4-2 and its encoding gene, gene silencing technology was used to inhibit or downregulate its expression. A silencing vector was constructed, introduced into Agrobacterium, and transformed into roses to delay petal senescence.

Benefits of technology

It significantly slows down the rate at which petals lose their ornamental value, prolongs the flowering period, and provides a new technical means to regulate petal aging, which has important prospects for production and application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119192315B_ABST
    Figure CN119192315B_ABST
Patent Text Reader

Abstract

The application discloses a kind of plant transcription factor AP2 / ERF family protein and its coding gene in the application of Chinese rose petal senescence and / or active oxygen level regulation, the plant transcription factor AP2 / ERF family protein is RhERF4-2, its amino acid sequence is as shown in SEQ ID NO.3.The RhERF4-2 gene is cloned from Chinese rose petal, and it is verified that the speed of petal from 5 levels to lose ornamental value is reduced by the silence of RhERF4-2 gene.In the petal of RhERF4-2 silence, the expression of senescence-related gene RhSAG12 is significantly down-regulated.The application discloses the effect of RhERF4-2 in the regulation of petal active oxygen (ROS) and senescence, provides new ideas and technical means for regulating plant flower senescence, especially postharvest preservation of Chinese rose fresh-cut flower, opens a new flower regulation research field, and has great academic value and important production application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to the application of plant transcription factor AP2 / ERF family proteins and their encoding genes in the regulation of rose petal senescence and / or reactive oxygen species levels. Background Technology

[0002] Roses are an important ornamental crop globally, possessing extremely high ornamental and economic value, and are widely used in cut flowers, potted plants, gardens, and landscaping. Cut roses suffer significant losses during long-distance storage and transportation, with premature petal senescence being the primary cause of this severe loss. Developing new varieties resistant to storage and transportation and researching efficient post-harvest preservation technologies are effective ways to overcome the industry bottleneck of high post-harvest losses in cut roses. Furthermore, identifying key genes involved in petal senescence and elucidating their biological mechanisms provides the theoretical foundation for variety improvement and technological innovation. Ethylene is a crucial hormone that promotes petal senescence; analyzing the functions of genes responding to ethylene treatment provides theoretical support for understanding the specific regulatory mechanisms of ethylene on rose petal senescence. Summary of the Invention

[0003] Objectives of this invention: The first objective is to provide the application of plant transcription factor AP2 / ERF family proteins in the regulation of rose petal senescence and / or reactive oxygen species (ROS) levels. The second objective is to provide the application of the RhERF4-2 gene, encoding the aforementioned AP2 / ERF family proteins, in the regulation of rose petal senescence and / or ROS levels. The third objective is to provide the application of a RhERF4-2 gene silencing vector and RhERF4-2 gene-silencing strains in delaying rose petal senescence. The fourth objective is to provide a downregulator of the rose RhERF4-2 gene. The fifth objective is to provide a method for delaying rose petal senescence or prolonging the flowering period.

[0004] Technical solution: The application of the plant transcription factor AP2 / ERF family protein of the present invention in the regulation of senescence and / or reactive oxygen species levels in rose petals, wherein the plant transcription factor AP2 / ERF family protein is RhERF4-2, and its amino acid sequence is shown in SEQ ID NO.3.

[0005] The present invention relates to the application of the RhERF4-2 gene, which encodes the aforementioned AP2 / ERF family protein, in the regulation of rose petal senescence and / or reactive oxygen species levels, wherein the nucleotide sequence of the RhERF4-2 gene is shown in SEQ ID NO.1.

[0006] Furthermore, the rose variety mentioned is 'Samantha'.

[0007] The present invention relates to the application of a silencing vector of the RhERF4-2 gene or a specific fragment thereof, and a silencing strain of the RhERF4-2 gene or a specific fragment thereof in delaying the senescence of rose petals. The RhERF4-2 gene sequence is shown in SEQ ID NO.1, and the nucleotide sequence of the specific fragment of the RhERF4-2 gene is shown in SEQ ID NO.12.

[0008] Furthermore, the silencing vector is obtained by constructing the entire ORF sequence or a specific fragment sequence of the RhERF4-2 gene into the vector pTRV2.

[0009] Furthermore, the silenced strain was obtained by introducing a silencing vector of the RhERF4-2 gene into Agrobacterium.

[0010] Furthermore, the Agrobacterium is GV3101.

[0011] The present invention relates to a method for delaying the senescence of rose petals or prolonging the flowering period, the method comprising inhibiting or downregulating the expression or activity of the rose RhERF4-2 protein to prolong the opening time of rose flowers, the amino acid sequence of the RhERF4-2 protein being shown in SEQ ID NO.3.

[0012] Further, the downregulation of the expression or activity of the rose RhERF4-2 protein includes: knocking out or silencing the RhERF4-2 gene in the rose genome; or transferring a downregulator that downregulates the transcription, peptide expression, or peptide activity of the RhERF4-2 gene into the rose; or hybridizing a rose variety with the RhERF4-2 gene missing with a common rose variety, wherein the RhERF4-2 gene sequence is shown in SEQ ID NO.1 or 2.

[0013] Furthermore, knocking out or silencing the RhERF4-2 gene in the rose genome involves introducing a specific fragment of the RhERF4-2 gene into a silencing vector, the nucleotide sequence of which is shown in SEQ ID NO.12.

[0014] Beneficial Effects: Compared with existing technologies, this invention has the following significant advantages: This invention cloned the RhERF4-2 gene from rose petals and verified that silencing the RhERF4-2 gene can slow down the rate at which petals deteriorate from level 5 to losing their ornamental value. In petals with silenced RhERF4-2, the expression of the senescence-related gene RhSAG12 was significantly downregulated. This invention reveals the role of RhERF4-2 in regulating petal ROS and senescence, providing new ideas and technical means for regulating plant flower senescence, especially for postharvest preservation of cut roses. It opens up a new field of flower regulation research and has significant academic value and important prospects for production applications. Attached Figure Description

[0015] Figure 1 This study revealed that there are two ERF4 homologous proteins in roses. A phylogenetic tree was constructed using MEGA.

[0016] Figure 2 The effect of ethylene on RhERF4-2 transcriptional levels was shown. Rose seedlings at developmental stage 2 were sampled 24 h after treatment with ethylene (10 μL / L), while the control group was air-treated. RhUBI2 was used as an internal control, and six biological replicates were performed. Data in the figure are mean ± SD. A two-tailed Student's t-test was used, with ns indicating no significant difference and *** indicating p < 0.001.

[0017] Figure 3 This study demonstrates the effect of RhERF4-2 silencing on the senescence process of petals. (A) Observation of senescence phenotypes in RhERF4-2-silenced tissue culture seedlings and TRV control groups. The time from full flower opening to petal senescence was recorded by photographs once a day. Scale bar: 5cm. (B) Detection of RhERF4-2 expression level. (C) Detection of RhSAG12 expression level. (D) Statistical analysis of the number of days of senescence in RhERF4-2-silenced tissue culture seedlings and TRV control groups. RhUBI2 was used as an internal control, with 6 biological replicates. Data in the figure are mean ± SD. A two-tailed Student's t-test was used. * represents p < 0.05, ** represents p < 0.01, and **** represents p < 0.0001.

[0018] Figure 4 This study demonstrates that RhERF4-2 promotes ROS accumulation. (Left) DAB staining image of rose petals after RhERF4-2 gene silencing, scale bar 1 cm. (Right) Quantitative results of DAB staining levels in rose petals after RhERF4-2 gene silencing. Petals from developmental stage 5 were used, with 6 biological replicates per group. Data in the figure are mean ± SD, and a two-tailed Student's t-test was used. *** represents p < 0.001. Detailed Implementation

[0019] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0020] Virus-induced gene silencing (VIGS) is a post-transcriptional gene silencing technique that has been widely applied in plant genetic engineering research as an effective reverse genetics technique. One commonly used viral vector is tobacco rattle virus (TRV). TRV functions using two vectors, pTRV1 and pTRV2. The vectors pTRV-1 and pTRV-2 of this invention were donated by Professor Liu Yule of Tsinghua University. In this invention, the combination of control pTRV-1 and pTRV-2 is named TRV, and the combination of pTRV-1 and pTRV-2-RhTIP1;1 is named TRV-RhERF4-2.

[0021] Example 1: Gene Cloning and Sequence Analysis

[0022] Total RNA was extracted from petals of the rose 'Samantha' (R. hybrida 'Samantha') using the hot borate method (Ma, N., Tan, H., Liu, X., Xue, J., Li, Y., & Gao, J. (2006). Transcriptional regulation of ethylene receptor and CTR genes involved in ethylene-induced flower opening in cut rose (Rosa hybrida) cv. Samantha. Journal of experimental botany, 57(11), 2763–2773). cDNA was obtained from 1 μg of total RNA using HiScript III reverse transcriptase (Vazyme). RhERF4-2ORF (SEQ ID NO.2) was amplified from the cDNA in 'Samantha' petals using primers RhERF4-2-ORF-F (SEQ ID NO.4) and RhERF4-2-ORF-R (SEQ ID NO.5). PCR conditions are shown in Tables 1 and 2.

[0023] Table 1 High-fidelity enzyme amplification system

[0024]

[0025]

[0026] Table 2 High-fidelity enzyme reaction procedures

[0027]

[0028] The cloned fragments were recovered by gel electrophoresis and then ligated into the ZT4 vector (Zhuangmeng Biotechnology Co., Ltd., ZC205). The fragments were then transformed into Escherichia coli DH5α (Qingke Biotechnology Co., Ltd., TSC-C01) using the heat shock method, cultured overnight, and single clones were picked, shaken, and sent for testing.

[0029] Sequencing results showed that the cDNA sequence of the rose RhERF4-2 gene was 1191 bp, and the corresponding gene number in the R. chinensis 'Old Blush' database (https: / / lipm-browsers.toulouse.inra.fr / pub / RchiOBHm-V2 / ) was RchiOBHm_Chr5g0032721 (full-length gene, SEQ ID NO.1). The ORF length of RchiOBHm_Chr5g0032721 was 753 bp (SEQ ID NO.2), which encodes a protein containing 250 amino acids (SEQ ID NO.3).

[0030] Example 2 Ethylene Induction Analysis

[0031] Tissue culture seedlings of the rose 'Samantha' were cultured on MS medium containing 1.0 mg / L 6-benzylaminopurine (6-BA), 0.05 mg / L α-naphthaleneacetic acid (NAA), and 3 mg / L gibberellin (GA3) at 22±1℃ under long-day conditions (16 h light / 8 h dark) until four weeks of age. The four-week-old seedlings were then transplanted to 1 / 2 MS medium containing 0.1 mg / L NAA to root. Next, the rooted seedlings were transplanted into a 1:1 mixture of vermiculite and peat moss and continued to be cultured at 22±1℃, 60% relative humidity, and under long-day conditions (16 h light / 8 h dark) until flowering.

[0032] According to a previously published article defining the flower opening stage (Ma, N., Cai, L., Lu, W., Tan, H., & Gao, J. (2005). Exogenous ethylene influences flower opening of cut roses (Rosahybrida) by regulating the genes encoding ethylene biosynthesis enzymes. Science in China. Series C, Life sciences, 48(5), 434–444. https: / / doi.org / 10.1360 / 062004-37Stage 1, the sepals of the flower split open, revealing the petals; Stage 2, the sepals of the flower are fully open, but the petals are not open; Stage 3, the flower is in the early stage of opening, and is cup-shaped; Stage 4, the flower and petals have completed expansion and are close to the maximum diameter of the flower, but the center of the flower is not exposed; Stage 5, the center of the flower is exposed; Stage 6, the flower is withered and senescent. The petal samples at different stages are the middle petals of the flower collected (Wu,L.,Ma,N.,Jia,Y.,Zhang,Y.,Feng,M.,Jiang,CZ,Ma,C.,&Gao,J.(2017).An Ethylene-Induced Regulatory Module Delays Flower Senescence by Regulating Cytokinin Content.Plant Physiology,173(1),853–862.https: / / doi.org / 10.1104 / pp.16.01064). Grade 2 cut roses were treated with ethylene. The cut roses in vases were treated with 10 μL / L ethylene for 24 hours in a sealed glass box. The control group was air-treated. Each treatment was performed in 6 biological replicates.

[0033] Quantitative real-time PCR (qRT-PCR) was performed using ChamQ SYBR qPCR Master Mix (Low ROX Premixed) reagent (Vazyme) in the Applied Biosystems StepOnePlus™ real-time quantitative PCR system. RhUBI2 was used as an internal control. PCR conditions are shown in Tables 3 and 4. The expression of related genes was calculated using the 2-ΔΔCT method. The quantitative primers are as follows: RhUBI2-qRT-F sequence (SEQ ID NO. 6), RhUBI2-qRT-R sequence (SEQ ID NO. 7), RhERF4-2-qRT-F sequence (SEQ ID NO. 8), RhERF4-2-qRT-R sequence (SEQ ID NO. 9), RhSAG12-qRT-F sequence (SEQ ID NO. 10), and RhSAG12-qRT-R sequence (SEQ ID NO. 11).

[0034] Table 3 Real-time quantitative PCR reaction system

[0035]

[0036] Table 4 Real-time Quantitative PCR Reaction Procedure

[0037]

[0038] The expression level of RhERF4-2 in rose petals after treatment was detected, and it was found that the transcription level of RhERF4-2 was significantly increased after ethylene treatment compared with the control group. Figure 2 Therefore, it is speculated that RhERF4-2 may be involved in ethylene-related petal senescence.

[0039] Example 3

[0040] The experimental method was based on the inventors' previous research (Tian, ​​J., Pei, H., Zhang, S., Chen, J., Chen, W., Yang, R., Meng, Y., You, J., Gao, J., & Ma, N. (2014). TRV-GFP: a modified Tobaccorattle virus vector for efficient and visualizable analysis of gene function. Journal of experimental botany, 65(1), 311–322.). Specifically, using the pTRV2 vector (gifted by Professor Liu Yule of Tsinghua University) containing EcoRI and BamHI restriction sites, a 363bp RhERF4-2 specific fragment (162bp of the ORF region and 201bp of the 3' untranslated region, SEQ ID) was inserted. NO.12: ctggacaaaagcgtcaaggcagccgcctctccgtccggcggttccctctccggcctcagcgactcggactcctccaccgtcgtggatttcg ctcactcccccgccaagaaaggaccgctcgatctcgacctcaacctcccccctccaccggagaaagcctgaatccgccgccgccggaaactctgtcc gcctccacatttttccttccgttctttaattagaaaagcaaaaaaagccaacctcttagagcgagaaaggcaaagctcaaagctgacatgtaatcat gagttttgcattagcctatgttgtttattaactgcagctttgtatatagacaaaactagaaaacccaaaaccgcagc) construct pTRV2-RhERF4-2 vector.The vectors carrying pTRV-1, pTRV-2, and pTRV2-RhERF4-2 were transformed into Agrobacterium tumefaciens strain GV3101, respectively. The cells were grown in Luria-Bertani (LB) medium supplemented with 50 μg / mL kanamycin and 50 μg / mL rifampin. The cells were then shaken in liquid medium at 200 rpm for 14 h at 28 °C. The Agrobacterium cells were collected by centrifugation at 4000 g and resuspended in osmosis buffer (10 mM 2-(N-Morpholino)ethanesulfonic acid (MES), 200 mM acetosyringone, and 10 mM magnesium chloride (MgCl2), pH 5.6, with a final bacterial concentration of OD. 600 =0.8~1.0. Agrobacterium-mediated transformation (ACT) was achieved by mixing Agrobacterium-mediated transformation carrying pTRV1 and pTRV2-RhERF4-2 vectors at a 1:1 (v / v) ratio as the experimental group (the control group consisted of a 1:1 (v / v) mixture of Agrobacterium-mediated transformation carrying pTRV1 and pTRV2 vectors). The mixture was incubated at room temperature in the dark for 3–4 hours. Rose seedlings were then immersed in an osmotic buffer containing the Agrobacterium-mediated transformation and placed under a -0.8 MPa vacuum until the bacterial solution was aspirated into the plants using a vacuum pump. This was maintained for 5 minutes, followed by slow aeration to ensure complete inoculation. The seedlings were rinsed with deionized water and then incubated at 8℃ in the dark for 3 days. They were then transplanted into potting soil and grown at 22±1℃, 60% relative humidity, and long-day conditions (16h light / 8h dark) for 40 days.

[0041] 1. Effects of RhERF4-2 on the senescence process of rose petals

[0042] The flower phenotype of Grade 1 flowers was continuously monitored.

[0043] Quantitative real-time PCR (qRT-PCR) was performed using ChamQ SYBR qPCR Master Mix (Low ROX Premixed) reagent (Vazyme) in an Applied Biosystems StepOnePlus™ real-time quantitative PCR system. PCR conditions were the same as in Example 2. RhUBI2 was used as an internal control. The primer sequences used were SEQ ID NO. 8–9. The expression of relevant genes was calculated using the 2-ΔΔCT method.

[0044] Compared with the TRV control, the expression of RhERF4-2 in petals of RhERF4-2-silenced plants was reduced by 46.1%, indicating that RhERF4-2-silenced plants can be used for further research. Figure 3B). The difference in flowering process between RhERF4-2 silent plants and TRV control plants was evident from level 5 to losing their ornamental value (…). Figure 3 A), the control plants' duration of inactivity increased from 3.7 ± 0.5 days to 4.8 ± 1.2 days in RhERF4-2 silent plants. Figure 3 D). Compared with the TRV control, RhSAG12 expression was reduced by 32.1% in petals silenced by grade 5 RhERF4-2 (D). Figure 3 C). These results indicate that RhERF4-2 plays a significant positive regulatory role in petal senescence.

[0045] 2. Effects of RhERF4-2 on ROS in rose petals

[0046] Dissolve DAB powder in water, adjust the pH to 3.8 with hydrochloric acid, and wrap the reagent in aluminum foil to prevent light exposure and decomposition. Take rose petals, wash them with deionized water, and dry them with paper. Transfer the petals to the DAB solution (1 mg / mL, pH 3.8), vacuum to -0.8 MPa, maintain for 5 min, and release the gas for 5 min. Incubate at 22℃ in the dark for 8 h. Wash away excess DAB solution with water, transfer the petals to a decolorizing solution (acetic acid: glycerol: ethanol volume ratio of 1:1:3), and soak for 3 days to decolorize. Use a scanner to record the DAB staining status of the petals.

[0047] The DAB staining method was used to indicate the level of ROS (reactive oxygen species) in petals, and the staining intensity was quantitatively analyzed using ImageJ software. The results are as follows: Figure 4 As shown, the ROS level in rose petals transiently silenced by RhERF4-2 was significantly higher than that in the TRV control group. This indicates that RhERF4-2 can promote ROS accumulation in rose petals.

[0048] In summary, RhERF4-2, induced by ethylene, plays an important role in regulating the petal senescence process by influencing the petal ROS level.

Claims

1. The application of a plant transcription factor AP2 / ERF family protein in the regulation of rose petal senescence, characterized in that, The plant transcription factor AP2 / ERF family protein is RhERF4-2, and its amino acid sequence is shown in SEQ ID NO.

3.

2. Encoding the AP2 / ERF family protein as described in claim 1 RhERF4-2 The application of genes in the regulation of rose petal senescence is characterized by, The RhERF4-2 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

3. The application according to claim 1 or 2, characterized in that, The rose variety mentioned is 'Samantha'.

4. RhERF4-2 A gene silencing vector or a silencing strain containing such a silencing vector, or containing RhERF4-2 The application of gene-specific silencing vectors or silencing strains containing such vectors in delaying rose petal senescence is characterized by, The RhERF4-2 The gene sequence is shown in SEQ ID NO.

1. RhERF4-2 The nucleotide sequence of the gene-specific fragment is shown in SEQ ID NO.

12.

5. The application according to claim 4, characterized in that, The inclusion RhERF4-2 The silencing vector for specific gene fragments is to... RhERF4-2 The specific fragment sequence of the gene was constructed into the vector pTRV2.

6. The application according to claim 4, characterized in that, The silenced strain is obtained by introducing the silence vector into Agrobacterium.

7. The application according to claim 6, characterized in that, The Agrobacterium species in question is GV3101.

8. A method for delaying the senescence of rose petals or prolonging the flowering period, characterized in that, The method includes inhibiting or downregulating the expression or activity of the rose RhERF4-2 protein to prolong the blooming time of rose flowers, the amino acid sequence of which is shown in SEQ ID NO.

3.

9. The method according to claim 8, characterized in that, The downregulation of the expression or activity of the rose RhERF4-2 protein includes: knocking out or silencing it in the rose genome. RhERF4-2 Genes; or may be downregulated RhERF4-2 Gene transcription, or the use of silencing vectors that downregulate RhERF4-2 protein expression or activity, can be transferred into roses, or... RhERF4-2 The genetically modified rose variety was crossed with a common rose variety. RhERF4-2 The gene sequence is shown in SEQ ID NO.1 or 2.

10. The method according to claim 9, characterized in that, Knockout or silence in the rose genome RhERF4-2 Genes are... RhERF4-2 A specific fragment of the gene is introduced into a silencing vector, wherein... RhERF4-2 The nucleotide sequence of the gene-specific fragment is shown in SEQ ID NO.12.

Citation Information

Patent Citations

  • Method for predicting apple fruit hardness based on amino acid residue varieties at 225th position of apple transcription factor ERF4

    CN110387430A

  • Application of RhMPK9 protein and coding gene thereof in senescence regulation and control of Chinese rose petals

    CN118620949A