Fusarium verticillium, microbial agent and application of fusarium verticillium

Abstract

The invention belongs to the technical field of microbiology and agricultural application thereof, and particularly relates to fusarium verticilliforme, a microbial agent and application of the fusarium verticilliforme and the microbial agent. The fusarium verticillium is separated from roots and stems of wild eggplants, is identified as the fusarium verticillium by combining morphological characteristics, physiological and biochemical characteristics and 16Sr DNA homology analysis, and has high antibacterial activity on phytophthora nicotianae and fusarium oxysporum, and the antibacterial rate is greater than 90%; the strain can secrete some substances to inhibit the growth of pathogenic bacteria, so that the pathogenic bacteria lose contents and are completely wizened until death; a stress resistance test verification result shows that the fusarium verticilliforme has tolerance to conditions such as temperature, pH and ultraviolet radiation, and the bacteriostatic activity at least higher than 50% can be maintained; the strain disclosed by the invention can be colonized in each tissue of a tobacco plant and has a combined prevention and control effect on tobacco black shank and tobacco root rot, and the biocontrol effect is obviously superior to that of commercially available biocontrol microbial agents and chemical agents.

Description

Technical Field

[0001] The invention belongs to the technical field of microbiology and its agricultural application, and specifically relates to a Fusarium verticillium, a microbial agent and application thereof. Background Art

[0002] Tobacco black shank (Phytophora nicotiana Breda de Haan), also known as tobacco black root and black stem, mainly infects the roots of tobacco leaves and the base of the stems. Because black spots appear on them, it is called "black shank". The disease rarely occurs during the seedling stage, but it mainly harms tobacco plants in the field. The symptoms vary greatly depending on the growth and development stage of the tobacco plants and weather conditions [2]{Wang Wenjing, 2021 #136;Wang Wenjing, 2021 #136}. Contaminated soil, manure and irrigation water, and diseased tobacco seedlings are the sources of infection for tobacco black shank. The first three are the sources of infection, and the last is the formation of zoospores and sporangia in irrigation water or by rain, which causes reinfection. Tobacco black shank pathogens spread by direct invasion or wounds, and the infected sites are mostly the stem base. Tobacco black shank pathogens are mainly soil-borne, and rain, running water, manure, soil, and agricultural operations are its main routes of infection. There are two ways to infect tobacco: ① Direct invasion. ② Invasion through wounds. At present, the use of chemical fungicides to control the disease will pollute the environment on the one hand, and make it resistant on the other. Biological control is highly efficient, pollution-free, and residue-free, and will be one of the main ways to prevent and control tobacco root and stem diseases in the future. Many studies have shown that the use of endophytes is an effective way, and it has been found that Pseudomonas spp. and Bacillus spp. among endophytic bacteria have particularly good control effects on tobacco black leg pathogens.

[0003] Tobacco root rot often occurs in tobacco-growing areas in my country, causing serious damage. In recent years, with the continuous improvement of land intensification in my country, continuous cropping of tobacco fields has also increased, resulting in increasingly serious root rot and a spreading trend. Pingdingshan tobacco-growing area is a traditional tobacco-growing area in Henan Province. The incidence of this disease in seriously diseased tobacco fields is more than 30%, which has greatly affected the yield and quality of tobacco and reduced its industrial feasibility. At the same time, the occurrence of root rot will promote the outbreak of black shank disease, further aggravating the losses. Therefore, the joint prevention and control of tobacco black shank disease and tobacco root rot is an important strategy to reduce the harm of tobacco rhizome diseases. Currently, the chemical agents or biocontrol agents on the market usually need to be used in combination to produce the effect of joint prevention and control. There is a lack of microbial agents that can simultaneously produce significant prevention and control effects on tobacco black shank disease and tobacco root rot. Summary of the invention

[0004] In order to solve the problems existing in the prior art, one of the purposes of the present invention is to provide a Fusarium verticillium that has an antibacterial effect on a variety of pathogens that can cause plant diseases, especially has a combined prevention and control effect on tobacco black shank and tobacco root rot.

[0005] The second object of the present invention is to provide a microbial agent, comprising the Fusarium solani provided by the present invention, which can effectively inhibit the growth of mycelium, causing the mycelium to lose its contents, completely shrivel and die, and lose its infectivity, and can be used for the combined prevention and treatment of tobacco black shank disease and tobacco root rot.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is as follows: A Fusarium verticillium spp., whose preservation number is CGMCC NO.41104.

[0007] A microbial agent containing the above-mentioned Fusarium verticillium.

[0008] The above-mentioned microbial agent is a freeze-dried powder or a liquid preparation; the liquid preparation can specifically adopt the above-mentioned Fusarium verticillioides strain fermentation broth. In a specific embodiment of the present invention, the fermentation culture temperature of the Fusarium verticillioides strain fermentation broth is 28-35°C.

[0009] The concentration of Fusarium spp. in the above-mentioned microbial agent can be adjusted according to the specific application scenario requirements. The concentration of Fusarium spp. in the microbial agent is 1.0×10 8 cfu / mL ~1.0×10 9 cfu / mL. As an example, the concentration of Fusarium verticillium in the microbial inoculant provided in the specific embodiment of the present invention is 1.0×10 8 cfu / mL.

[0010] The above-mentioned Fusarium verticillioides and microbial agent can be used to prevent and treat plant diseases caused by plant pathogenic fungi, wherein the plant pathogenic fungi are selected from tobacco phytophthora and tobacco oxysporum.

[0011] The above-mentioned Fusarium verticillioides and microbial agent can be used to prevent and treat tobacco black stem disease and Fusarium root rot. Preferably, the concentration of Fusarium verticillioides in the microbial agent for preventing and treating tobacco black stem disease and Fusarium root rot is 1.0×10 8 cfu / mL.

[0012] Beneficial effects of the present invention: (1) The Fusarium verticillioides fungus of the present invention is isolated from the rhizomes of wild eggplants and identified as Fusarium verticillioides fungus based on its morphological characteristics, physiological and biochemical properties and 16Sr DNA homology analysis. It has high antibacterial activity against Phytophthora nicotianae and Fusarium oxysporum fungi, with an antibacterial rate of >90%; (2) The Fusarium spp. of the present invention can secrete some substances to inhibit the growth of pathogenic bacteria, causing them to lose their contents, completely shrivel up and eventually die; the results of stress resistance test verification show that the Fusarium spp. of the present invention is tolerant to conditions such as temperature, pH, and ultraviolet irradiation, and can maintain an antibacterial activity of at least 50%; (3) The Fusarium verticillium of the present invention can colonize various tissues of tobacco plants and has a combined control effect on tobacco black shank disease and tobacco root rot. Specifically, potted plant tests of the specific embodiments of the present invention showed that the relative control effects on tobacco black shank disease and root rot were 76.9% and 76.7%, respectively. The relative control effects in field tests were 71% and 64.0%, respectively, which were significantly better than commercially available biocontrol agents and chemical agents. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0014] Figure 1 Schematic diagram of the plate confrontation experiment results of strain Q5 with tobacco phytophthora and oxysporum; Figure A shows tobacco phytophthora; Figure B shows the confrontation between Q5 and phytophthora; Figure C shows oxysporum; Figure D shows the confrontation between Q5 and oxysporum; Figure 2 This is the colony morphology of strain Q5; Figure 3 The microscopic morphology of strain Q5; Figure a shows Q5 hyphae; Figure b shows Q5 spores; Figure 4 This is the electrophoresis diagram of the DNA sequence amplification product of strain Q5; Figure 5 is the DNA sequence phylogeny of strain Q5; Figure 6 This is a schematic diagram of the response surface optimization of the culture conditions of strain Q5; Figure 7 Schematic diagram of the observation results of the antagonistic effect of strain Q5 on tobacco root rot pathogens under scanning electron microscopy: a: normal tobacco Fusarium oxysporum hyphae; b: antagonism between Q5 and tobacco Fusarium oxysporum; c, d: Fusarium oxysporum hyphae that lost their infection activity after antagonism with Q5; Figure 8 The colonization of the biocontrol strain in the root tissue is marked by GFP; Fig. 9 The colonization of the biocontrol strain marked by GFP in the stem tissue. DETAILED DESCRIPTION

[0015] The above contents of the present invention are further described in detail below through examples, but this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples, and all technologies implemented based on the above contents of the present invention belong to the scope of the present invention.

[0016] The following examples and test examples include: The pathogen of tobacco black shank disease is Phytophthora parasitica, the pathogen of tobacco Fusarium root rot is Fusarium oxysporum Fusarrium oxysporum ) were provided by the Engineering Technology Research Center for Microecological Regulation of Solanaceae Crops of Shangqiu Normal University. The strain was isolated from the high-quality tobacco producing area of ​​Pingdingshan, Henan Province.

[0017] Potato-glucose liquid medium (PDA): 20g glucose, 1000ml sterile water, 200g peeled potatoes; Potato-dextrose agar medium (PDA): 20g glucose, 15-20g agar, 1000ml sterile water, 200g peeled potatoes; Isolation and purification medium: PDA medium + streptomycin (final concentration 30 μg / ml). Note: Antibiotics will degrade at high temperatures. Streptomycin should be added when the inactivated medium is cooled to about 45°C.

[0018] Carrot culture medium solid: 1000ml sterile water, 20g glucose, 15-20g agar, 200g peeled carrots; (for antagonistic confrontation) Reagents: The preparation of culture medium and the drugs required for physiological and biochemical experiments were all products of Shanghai Sinopharm Group (analytical grade), 16SrDNA fragment amplification reagent was purchased from Beijing Quanshijin Biological Company, and DNA extraction kit was purchased from Solarbio Technology Co., Ltd.

[0019] Example 1 Screening and identification of target antagonistic bacteria 1.1. Isolation and screening of strains: Prepare liquid and solid PDA culture medium, and sterilize the PDA culture medium and other equipment by high pressure at 121 degrees Celsius for 20 minutes. Take out the sterilized items and cool the PDA culture medium to 45 degrees Celsius. Aseptically transfer 180 microliters of streptomycin stock solution into a 250 ml conical flask, shake well, and pour onto a plate for later use.

[0020] Wild eggplants were collected from the Sanlingtai pepper base in Shangqiu. The eggplant plants were rinsed in running water for 30 minutes, and then the roots were cut off with alcohol-sterilized scissors and set aside. Weigh 1 gram of eggplant roots, put them in a small beaker, and use a 70% ethanol solution on the clean bench in the sterile operation room for 20 seconds, then rinsed with sterile water, placed in a sterilized mortar, and crushed with a pestle. The ground eggplant roots were clamped with sterilized tweezers into the 250 ml liquid PDA medium prepared in advance, and incubated in a constant temperature shaker for 3-5 days (28°C 180r) until it becomes turbid.

[0021] Steps of gradient dilution separation method: On the clean bench, use a micropipette to transfer 0.1 ml of the shaken bacterial solution into a 1.5 ml centrifuge tube, then add 0.9 ml of sterile water, mix the two substances thoroughly, and you will get 1×10-2 of the original solution, and prepare diluted suspensions of 10-3, 10-4, 10-5 and 10-6 according to the above method. Use a micropipette to suck 0.1 ml of each gradient onto the prepared PDA solid medium, and evenly spread it on the plate with a sterilized coating rod; repeat three plates for each comparison. Then place the plate in a constant temperature incubator at 28°C for 3-5 days, and monitor the growth of colonies in each gradient every day. The gradient with uniform colony distribution and appropriate density is the most suitable gradient. Select the colonies on the gradient for further plate culture to separate and purify, and obtain purified colonies in triplicate. Put the washed colonies in a refrigerator at 4°C for use.

[0022] 1.2. Screening of antagonistic bacteria using plate confrontation method: Initial screening: The strains isolated in the previous step and the tobacco rhizomes and root diseases strains (Phytophthora nicotianae and Fusarium oxysporum) were inoculated on the PDA culture matrix, and carrot culture medium was prepared at the same time, and the plates were poured for later use. The inoculated culture medium was cultured in a fungal incubator at 28°C for about 3 days. Then, antagonistic and pathogenic mycelium blocks of equal size with a diameter of 1 cm were taken on the ultra-clean workbench with a puncher pure plate, and the pathogenic strains were inoculated into the center of the carrot solid culture medium, and the antagonistic strains were inoculated two centimeters away from the center. Each treatment was repeated three times and cultured in an incubator at a constant temperature of 28°C. The inhibitory effect of antagonistic bacteria on pathogenic bacteria was observed every day for 3-5 days.

[0023] Second screening: In the initial screening study, the antagonistic fungi with obvious antagonistic effects were punched with a sterilized punch according to the steps of the initial screening, and the pure culture of antagonistic fungi and pathogens were used as controls. The degree of inhibition was recorded for 3-5 days, and the percentage of inhibition, i.e., the inhibition rate, was calculated.

[0024] Antibacterial diameter = A-B Antibacterial rate (%) = [(A-B) / A] × 100% (A: Pathogen colony diameter of the control group; B: Pathogen colony diameter of the treatment group) Screening results: 18 strains were isolated from 5 wild eggplant root samples, and one strain with good antagonism to the pathogenic tobacco black shank disease pathogen (Phytophthora nicotianae) and the pathogenic tobacco root rot pathogen (Fusarium oxysporum) was screened out, named Q5, as shown in Table 1. Its antibacterial diameter to Phytophthora nicotianae and Fusarium oxysporum was greater than 75 mm, and the antibacterial rate was greater than 90%. The plate confrontation antibacterial effect was better. Figure 1 As shown (Figure A shows tobacco phytophthora; Figure B shows the confrontation between Q5 and phytophthora; Figure C shows Fusarium oxysporum; Figure D shows the confrontation between Q5 and Fusarium oxysporum)

[0025] 1.3. Identification of strains: 1.3.1 Colony morphology and microscopic morphology observation: The isolated strain Q5 was cultured on PDA medium at 28°C, and its colony morphology and microscopic morphology were observed.

[0026] The results showed that the colony of the isolated strain Q5 was white, the aerial hyphae were spider-web-like, bulged in the center, slightly yellow on the back, and produced brown mycelial balls - conidiophores. It grew quickly, bulged in the center after 2-3 days of growth, and spread to the surroundings until it covered the plate after 4-5 days (such as Figure 2 ); Microscopic and scanning electron microscopic observations showed that the conidiophores of strain Q5 were translucent, sickle-shaped, and had obvious separations (e.g. Figure 3 ).

[0027] Through morphological identification, it can be preliminarily determined that the Q5 strain is Fusarium.

[0028] 1.3.2 Molecular biological identification of strains: DNA was extracted using the Fungal Genomic DNA Extraction Kit from Solarbio Technology Co., Ltd.

[0029] PCR amplification: Reaction system (20 mL): Premix Taq 10 mL, Forward primer (ITS1:TCCGTAGGTGAACCTGCGG) 0.5 mL, Template 1 mL, ddH 2O 8 mL, Reverse primer (ITS4:TCCTCCGCTTATTGATATGC) 0.5 mL. Reaction procedure: pre-denaturation at 94℃ for 5 min, denaturation at 94℃ for 1 min, annealing at 55℃ for 1 min, extension at 72℃ for 1 min30s, full extension at 72℃ for 10 min (delayed shutdown: 4℃ for unlimited time), denaturation, annealing, and extension for 30 cycles, 1% agarose gel electrophoresis to detect PCR products, such as Figure 4 As shown, by comparing with the values ​​of the Marker lane, the band of Q5 genomic DNA is about 600 bp, which is consistent with the judgment.

[0030] The 16S rDNA gene sequence of strain Q5 obtained by PCR was sent to Tianjin Jinweizhi Biotechnology Co., Ltd. for sequence determination. The base pair sequences obtained after the determination were compared for similarity using BLAST software, and then the Neighbor-Joining method of MEGA7 was used to construct a phylogenetic diagram, as shown in Figure 2. Figure 5 As shown, the sequence of strain Q5 had the highest similarity to that of Fusarium spp.

[0031] In summary, the results of morphological, microscopic morphological and molecular biological identification of strain Q5 showed that strain Q5 was Fusarium verticillioides, which was deposited in the General Microbiology Center of China Microbiological Culture Collection on February 20, 2024, with the deposit number CGMCC NO.41103.

[0032] Example 2 Screening of the best culture conditions for Q5 Screening method: The response surface methodology was used to optimize the growth conditions of the Q5 strain. Four factors, including inoculum size (0.05-5%), culture temperature (28-39°C), pH (6-8), and shaker speed (120-220 r / min), were optimized. The experiment was designed using DesignExpert 8. The experimental groups are shown in Table 2.

[0033]

[0034] The response surface optimization results are as follows Figure 6 As shown, the optimal culture conditions were: pH 6.89, temperature 30.43℃, rotation speed 185.72r / min, and inoculation amount 3.91%.

[0035] Preparation of fermentation broth of strain Q5: Strain Q5 was cultured in an expanded manner according to the optimal culture conditions selected above, and a fermentation broth was prepared for use in subsequent examples.

[0036] Example 3 Identification of the antibacterial mechanism of strain Q5 3.1 Scanning electron microscopy observation of inhibited pathogen hyphae The Fusarium oxysporum strains and the Fusarium oxysporum treated with Q5 fermentation broth were observed using a scanning electron microscope.

[0037] The results are as follows Figure 7 As shown, the normal hyphae of Fusarium oxysporum are tubular, with a smooth and velvety surface and no branches (Figure a). After being treated with the Q5 antagonistic bacterial solution, the Q5 hyphae parasitized inside the mycelium of Fusarium oxysporum, significantly inhibiting its growth and spore production. Fusarium oxysporum lost its contents, completely shrunken, and eventually died (Figures c, d).

[0038] 3.2 Antagonist activity The antagonistic factors in the fermentation broth filtrate of Q5 strain (the whole bacterial solution was centrifuged at 12000 rpm for 5 min, and the supernatant was filtered) and the bacterial cell disrupted solution (100 mL of the whole bacterial solution was collected, centrifuged at 4°C, 6500 rpm for 10 min, and 5 mL of 50 mmol / L pH7.5KH2PO4-K2HPO4 buffer solution was added, and ultrasonically disrupted).

[0039] Protease activity was determined by the whole milk plate method to detect the protease activity of the fermentation supernatant and cell crude extract of the antagonistic strain. A well was punched in the center of the whole milk plate, and 20 μL of the fermentation supernatant and cell disruption solution were added to each well, respectively. The well was sealed and allowed to stand at 25°C for 7 d. After being fixed with 10% trichloroacetic acid for 2 h, it was stained with Coomassie Brilliant Blue G-250 overnight and decolorized with ethanol-glacial acetic acid. The protease activity of the fermentation supernatant and cell disruption solution was qualitatively compared by calculating the ratio of the colony diameter to the transparent zone diameter. The lower the ratio, the higher the protease activity.

[0040] The activities of chitinase and cellulase were detected using a trypsinase activity detection kit (Shanghai Yuanxin Biotechnology, YX-SH-TQ22025) and a chitinase activity detection kit (Shanghai Yuanxin Biotechnology, YX-W-B917), respectively.

[0041] The results are shown in Table 3 below:

[0042] The results shown in Table 3 above show that the activities of protease, chitinase and cellulase were detected in the supernatant of the fermentation broth of Q5 bacteria and the cell lysate, and the activities of these three enzymes were all higher in the fermentation broth than in the cell lysate. This indicates that antimicrobial protein substances such as protease, chitinase and cellulase exist in the Q5 strain. These antimicrobial proteins can cause mycelial deformity, cell wall dissolution, cytoplasm leakage, and loss of infection ability of Fusarium oxysporum.

[0043] Example 4 Analysis of stress resistance of Q5 strain 4.1 Effect of temperature on the antibacterial stability of Q5 fermentation broth The fermentation broth of Q5 strain was treated in a water bath for 30 min and 60 min at 40 ℃, 60 ℃, 80 ℃, 100 ℃ and 120 ℃ respectively, and its inhibitory effect on the mycelial growth of tobacco phytophthora and Fusarium oxysporum was detected by plate confrontation culture. After confrontation culture at 28 ℃ for 8 days, the inhibition rate was calculated, and the fermentation broth of the untreated strain was used as a control to detect the effect of temperature on the antibacterial activity of the fermentation broth. The results are shown in Table 4:

[0044] The results shown in Table 4 above indicate that the antibacterial activity of the Q5 strain still retained more than 50% of the antibacterial activity after being treated at 80 °C, and that it has high thermal stability.

[0045] 4.2 Effect of pH on the antibacterial stability of Q5 fermentation broth The pH of Q5 fermentation broth was adjusted to 2, 4, 6, 8, 10 and 12 by HCl (1 mol / L) or NaOH (1 mol / L), and then the pH of the fermentation broth was adjusted back to the original pH (7.6) after standing at room temperature (20 ℃) ​​for 24 h. The inhibitory effect on the growth of tobacco phytophthora and Fusarium oxysporum was detected by plate confrontation culture. The inhibition rate was calculated after culturing at 28 ℃ for 8 days. The untreated fermentation broth was used as the control to detect the effect of pH on the activity of antibacterial substances. The results are shown in Table 5

[0046] The results shown in Table 5 above show that the antibacterial activity of strain Q5 remained basically unchanged after being treated with pH 6; after incubation for 24 hours in pH 2, pH 4, pH 8, pH 10 and pH 12 environments, it only slightly decreased and was able to maintain a high antibacterial activity. The results show that strain Q5 has good resistance to conventional acid-base environments, and only over-acidic and over-alkaline environments will reduce its antibacterial activity against Fusarium oxysporum.

[0047] 4.3 Effect of UV irradiation on the antibacterial stability of fermentation broth of antagonistic strains The fermentation liquid was placed 20 cm (168 μW / cm 2 ) were irradiated for 2, 4, 6, 8, 10, and 12 h, respectively. The control group was not irradiated with ultraviolet light. The inhibitory effect on the growth of tobacco phytophthora and Fusarium oxysporum was detected by plate confrontation culture. After culturing at 28 ° C for 8 days, the antibacterial rate was calculated. The fermentation liquid without treatment was used as the control to detect the effect of ultraviolet light on the antibacterial activity. The results are shown in Table 6

[0048] The results shown in Table 6 above indicate that strain Q5 has a certain UV stability, and after being treated with UV for 12 h, it still retains more than 50% of the antibacterial activity.

[0049] Example 5 Colonization analysis of Q5 strain in tobacco 5.1 In order to study the colonization effect of high-efficiency biocontrol strains in the rhizosphere of tobacco plants, the experimental strains such as the strains in Table 7 were GFP-labeled. The green fluorescent plasmid was transformed into the competent cells of each antagonistic strain, and the positive GFP-labeled strains were selected through resistance screening, and the positive strains were observed under a fluorescence imaging microscope.

[0050]

[0051] The GFP-labeled strain emitted bright green fluorescence from its colonies under an ultraviolet projector. After six rounds of alternating culture medium and plates without ampicillin, the strain was able to grow normally when plated back on plates containing ampicillin, with bright green fluorescence, indicating that the labeled strain plasmid could stably express the GFP marker of the biocontrol strain.

[0052] 5.2 Colonization of Q5 strain in tobacco seedlings The tobacco seeds were soaked in the fermentation liquid of the GFP-labeled strain. After the tobacco seeds were disinfected with alcohol, they were soaked in the suspension of the labeled strain (1.00×10 8 cfu / mL) for 24 hours, 50 seeds for each treatment, take out the seeds, rinse them with sterile water 4 times, and place them in a culture dish with moist filter paper, and keep them moist in a light incubator at 28℃. After the seeds germinate, take 0.5g of seedlings, disinfect them with alcohol, and then rinse them with sterile water 4 times. Grind the plant tissue into a slurry, dilute it to different concentrations, and let it stand for 3 minutes. Take 100µL of juice and apply it on an LB plate containing 300µg / mL ampicillin, incubate it in the dark at 30℃ for 48 hours, and count the number of colonies with green fluorescence on the plate under the irradiation of a UV projector, and calculate the bacterial content [(colony number × dilution factor × milliliters of water for separation) ÷ (milliliters of water for coating × grams of tissue for separation)]. Seeds soaked in clean water were used as the control, and each treatment was repeated 3 times.

[0053] In the soaking experiment, no fluorescent colonies were recovered in the water control treatment; however, 2.58×10 7 The fluorescent colonies of cfu / g indicated that the strain showed good colonization in tobacco seedlings.

[0054] 5.3 Colonization of biocontrol strains in tobacco plant roots and stems The tobacco plants were irrigated with the fermentation liquid of the GFP-labeled strain. The roots of the tobacco seedlings with 5 to 6 true leaves were pulled up and washed and transplanted into a pot filled with non-sterile natural soil. After the tobacco seedlings returned to seedlings, the roots were irrigated with the fermentation liquid of the GFP-labeled strain (1.00×10 8 cfu / mL) root irrigation treatment. Samples were taken on the 1st, 5th, 10th, 25th and 50th days after treatment to determine the colonization of antagonistic bacteria in tobacco roots, stems and leaves. Tobacco roots were irrigated with clean water as a control, and each treatment was repeated 3 times. While tissue separation was in progress, the rhizosphere soil of tobacco was weighed in sterile water, shaken on a shaker for 30 minutes, and then a series of gradient dilutions were made and spread on LB plates containing 300µg / mL ampicillin to determine the changes in the colonies of the labeled bacteria in the rhizosphere soil. Tobacco samples were selected after 10 days of treatment, and the tobacco root and stem tissues washed with sterile water were cut and sliced ​​by pressing. The colonization of the GFP-labeled strain in the tobacco was observed under a fluorescence microscope, and the tobacco plants that were not inoculated with bacteria were used as controls.

[0055] Observation of tobacco seedling root tissues using a fluorescence microscope Figure 8 As shown, compared with the control, the tobacco root tissues treated with GFP-labeled biocontrol strains all showed green fluorescence, indicating that the biocontrol strains were well colonized in the tobacco roots.

[0056] Fluorescence microscopy was used to observe the stem tissue of tobacco seedlings. Fig. 9 As shown, compared with the control, the tobacco stem tissues treated with the GFP-labeled biocontrol strains all showed green fluorescence, indicating that the biocontrol strains were well colonized in the tobacco stems.

[0057] The above results show that after soaking tobacco seeds and watering tobacco seedlings with GFP-labeled biocontrol strain Q5-GFP, the labeled bacteria can be detected in tobacco roots, stems, leaves and other tissues. Fluorescence microscopy observation found that the labeled strain mainly gathered in the epidermis, cortex and vascular tissue of tobacco stem tissue, indicating that the Q5 biocontrol strain can successfully colonize in the root and stem tissues of tobacco plants.

[0058] Example 6 Verification of the biocontrol effect of strain Q5 The fermentation liquid of strain Q5 was used to treat tobacco seedlings by root irrigation to determine its potted and field control effects: There were 6 treatments in the pot experiment, including CK, CK0, Bimiao, Wangtaibao, Mancozeb, and Q5.

[0059] (1) CK: only pathogens were inoculated (Fusarium oxysporum or Phytophthora nicotianae); (2) CK0: blank control group, normal water was applied; (3) microbial fungicide Wangtaibao treatment: solid microbial agent Wangtaibao purchased on the market, 650 ml per plant, concentration of 1%; (4) microbial agent Bi Miao treatment: liquid microbial fertilizer Bi Miao purchased on the market, diluted 1000 times, 650 ml per plant; (5) chemical reagent metal frost and mancozeb treatment: 58% metal frost and mancozeb wettable powder was used, 600 times, 200 ml per plant; (6) Q5: the expanded cultured Q5 strain was diluted and made into a fermentation liquid (spore concentration was about 1.0×10 8 cfu / mL), and 200 μL was inoculated into each pot using the root irrigation method.

[0060] Each treatment was inoculated with 200 μL of the fermentation liquid of Fusarium oxysporum or Phytophthora nicotianae 7 days after the first application of the fungicide or pesticide. Thereafter, the fungicide or pesticide of each treatment was irrigated once every 7 days, for a total of 3 times. Each treatment had 8 plants, with 3 replicates. The disease was investigated 14 days after inoculation.

[0061] Field experiment: The field rescreening test was conducted in Bailongmiao Village, Pingdingshan City, with five treatments, including CK, Bimiao, Wangtaibao, Mancozeb and Q5, as the control group. The treatment was repeated three times, with 50 plants used in each treatment. The plants were transplanted on May 1, 2021, and the same number of treatments as the potted test were used 20 days later. The irrigation test was carried out every 15 days, for a total of 3 irrigation tests. The disease test investigation started 15 days after the last irrigation.

[0062] Incidence rate = (total number of infected strains / total number of strains investigated) × 100% Disease index = ∑ (total number of diseased plants at each level × total diseased plant value at that level) / (total number of plants surveyed × total plant value at the highest level) × 100% Relative prevention effect = (control disease index - treatment disease index) / control disease index × 100%.

[0063] The results of the control effect test of strain Q5 on tobacco Fusarium root rot are shown in Table 8:

[0064] The results shown in Table 8 above show that in the pot test, after the pathogen (CK0) was inoculated, the tobacco plant morbidity rate was 100%, indicating that the pathogenicity of the tested pathogen was strong. The natural morbidity rate of the CK treatment with only water irrigation was 57.1%. Compared with CK0, the morbidity rate and disease index of each treatment were significantly reduced, and the morbidity rate of the Q5 fermentation liquid treatment was the lowest, at 33.3%, and the disease index was also the lowest, at 20.8%. The control effect and relative control efficiency were the highest in the Q5 treatment, reaching 66.7% and 76.7% respectively, which were significantly higher than the commercially available microbial agents Bimiao and Wangtaibao treatments, and also higher than the chemical agent formosan frost mancozeb treatment.

[0065] In the field test, the natural incidence rate was 14.3% and the disease index was 11.1%. After inoculation with biocontrol agents and spraying with chemical agents, the incidence rate of each treatment was reduced, with the lowest incidence rate of Q5 treatment, which was 4.0%, and the disease index was 4.0%. The relative control effect was also the highest in Q5 treatment, reaching 64.0%, which was significantly higher than the chemical agent metalaxyl mancozeb and commercial microbial agent treatment, indicating that the strain has good biocontrol potential.

[0066] The results of the control effect test of strain Q5 on tobacco black shank are shown in Table 9:

[0067] As shown in Table 9, compared with the control, the commercially available microbial agents Bi Miao and Wang Tai Bao, the chemical agent metalaxyl mancozeb, and the fermentation liquid of Q5 strain in the pot experiment and field experiment all played a certain role in the prevention and control of tobacco black shank disease, and the Q5 strain had the best prevention effect, with the prevention effect of 74.5% in the pot experiment and the relative prevention effect of 76.9%; the prevention effect of 68.3% in the field experiment and the relative prevention effect of 71.0%, indicating that the prevention effect of Q5 strain on tobacco black shank disease is relatively stable.

[0068] In summary, it can be concluded that Fusarium Q5 has a significant antagonistic effect on tobacco black shank and tobacco root rot, and its disease prevention and control effect is significantly better than commercially available chemical agents and biocontrol agents, and can be used for the combined prevention and control of tobacco black shank and tobacco root rot.

[0069] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A Fusarium verticillium, characterized in that Its accession number is CGMCC NO.41103.

2. A microbial agent containing the Fusarium spp. as claimed in claim 1.

3. The microbial agent according to claim 2, characterized in that The microbial agent is freeze-dried powder.

4. The microbial agent according to claim 2, characterized in that The microbial agent is a liquid preparation.

5. The microbial agent according to claim 4, characterized in that The microbial agent is the fermentation liquid of the Fusarium spp. strain as claimed in claim 1.

6. The microbial agent according to any one of claims 4 to 5, characterized in that The concentration of Fusarium verticillium in the microbial agent is 1.0×10 7 cfu / mL~1.0×10 9 cfu / mL.

7. Use of the Fusarium verticillium according to claim 1 or the microbial agent according to any one of claims 2 to 7 in preventing and controlling plant diseases caused by plant pathogenic fungi, characterized in that: The plant pathogenic fungi are selected from Phytophthora nicotianae and Fusarium oxysporum.

8. The use according to claim 7, characterized in that The plant diseases are tobacco black shank and Fusarium root rot.

9. The use according to claim 8, characterized in that The concentration of Fusarium verticillium in the microbial agent is 1.0×10 8 cfu / mL.

Images