Lactobacillus Harbin, grapefruit enzyme and application of lactobacillus Harbin and grapefruit enzyme in desinsectization or insecticide preparation

Abstract

The invention discloses lactobacillus Harbin, grapefruit enzyme and application of the grapefruit enzyme in an insect expelling or killing preparation, and belongs to the technical field of fermentation engineering. The grapefruit enzyme disclosed by the invention is prepared by taking grapefruits as a main raw material, inoculating lactobacillus Harbin EL07 and / or Kazakstan yeast EY02 and Hanseniaspora fabricius EY01, and fermenting the grapefruits and the lactobacillus Harbin EL07 and / or Kazakstan yeast EY02 and Hanseniaspora fabricius EY01. Wherein the lactobacillus Harbin EL07 is preserved in the China Center for Type Culture Collection on July 6, 2023, and the preservation number of the lactobacillus Harbin EL07 is CCTCC M 20231206. The grapefruit enzyme prepared by the invention has a good insect repelling / killing effect on pests such as cnaphalocrocis medinalis in crop planting, and the insect repelling / killing rate reaches 94.0% or above. The method has a good application prospect in the aspect of promoting wide planting of the organic rice.

Description

Technical Field

[0001] The invention relates to the technical field of fermentation engineering, in particular to a Harbin lactobacillus, a grapefruit enzyme and applications thereof in anthelmintic or insecticide preparations. Background Art

[0002] Rice pests and diseases are important factors that affect rice growth and yield, including diseases caused by fungi, bacteria, viruses, pests and other organisms. Common pests and diseases include rice leaf folders, aphids and red spiders. Among them, rice leaf folders are characterized by seasonal occurrence, and are generally more serious in the middle and late stages of rice growth. The larvae will spin silk to curl the rice leaves into a tube shape, feed on the mesophyll inside, and affect the photosynthesis of rice. After being damaged by rice leaf folders, the rice leaves are incomplete and the photosynthesis efficiency is reduced, resulting in incomplete rice grains and a decrease in thousand-grain weight, affecting the yield and quality of rice.

[0003] At present, insecticide and insect repellent methods include chemical control, physical control and biological control. Among them, biological control is a method of controlling rice pests and diseases by using organisms or their metabolites, which has many advantages such as environmental protection and sustainability. The existing technology mainly adopts organic solvent extraction, which will have organic solvent residues; adding various stabilizers, such as fatty alcohol polyoxyethylene ether, will also have the disadvantages of residues, high cost and inability to handle waste residues.

[0004] Therefore, there is an urgent need to provide a method for repelling / killing insects without adding organic solvents, polluting the environment, having sufficient raw materials and low cost. Summary of the invention

[0005] To solve the above problems, the present invention provides a strain of Lactobacillus harbinensis, grapefruit enzyme and their use in anthelmintic or insecticide preparations. The present invention adopts a microbial fermentation method, uses grapefruit from natural sources as raw materials, and adds auxiliary ingredients such as molasses, water, garlic, and wormwood. It uses a self-screened new type of Lactobacillus harbinensis EL07 (preservation number is CCTCC NO: M20231206) and / or Kazakhstan yeast of Sessima and Hansen yeast of Falpi for fermentation to produce a liquid anthelmintic / insecticide with high efficiency of anthelmintic / insecticide effect. The fermented liquid anthelmintic / insecticide enzyme is applied to the process of crop planting, and has a good anthelmintic / insecticide effect on pests in the process of crop planting. The method of mutualism and mutual restraint is used to grow organic crops well, and the production and management of crops can be developed with high quality and high yield.

[0006] The present invention is achieved through the following technical solutions:

[0007] The first object of the present invention is to provide a Harbin Lactobacillus (Lactobacillus harbinensis) EL07, which has been deposited in the China Center for Type Culture Collection on July 6, 2023, with a deposit number of CCTCC NO: M 20231206; the deposit address is Wuhan University.

[0008] The second object of the present invention is to provide a microbial preparation containing the Harbin Lactobacillus EL07.

[0009] The third object of the present invention is to provide the use of the Harbin Lactobacillus EL07 or the microbial preparation in the preparation of grapefruit enzyme.

[0010] The fourth object of the present invention is to provide a method for preparing grapefruit enzyme using the Harbin Lactobacillus EL07, comprising the following steps:

[0011] The grapefruit enzyme is obtained by inoculating a mixture of grapefruit and water with Harbin Lactobacillus EL07 for fermentation; the inoculation amount of Harbin Lactobacillus EL07 is 0.2%-20%;

[0012] And / or, a mixture of grapefruit and water is used as a raw material, and Harbin Lactobacillus EL07 and yeast are inoculated for fermentation to obtain the grapefruit enzyme; the inoculation amounts of Harbin Lactobacillus EL07 and yeast are 0.2%-20% respectively.

[0013] In one embodiment of the present invention, the yeast is Saccharomyces sergeni EY02 or Hansenia farpei EY01;

[0014] And / or, the fermentation temperature is 5°C-38°C;

[0015] And / or, the fermentation is carried out by stirring fermentation, and the stirring speed is 10rpm-300rpm;

[0016] And / or, the fermentation period is 7 days to 20 days.

[0017] In one embodiment of the present invention, the pomelo is selected from one or more of landscape pomelo, field pomelo, pomelo, golden pomelo, Dianjiang white pomelo, Jinlan pomelo, Pingshan pomelo, Changshan pomelo, four seasons pomelo, Chuhong pomelo and Guanxi honey pomelo.

[0018] In one embodiment of the present invention, the concentration of grapefruit in the raw material is 5wt%-60wt%.

[0019] In one embodiment of the present invention, the raw materials further include one or more of sucrose, brown sugar, glucose, molasses, garlic and mugwort; preferably molasses, garlic and mugwort.

[0020] In one embodiment of the present invention, the contents of molasses, water, garlic and wormwood are 2wt%-20wt%, 40wt%-80wt%, 1wt%-15wt% and 0.5wt%-20wt%, respectively.

[0021] In one embodiment of the present invention, the garlic is selected from one or more of red-skinned garlic, white-skinned garlic, and purple-skinned garlic.

[0022] The fifth object of the present invention is to provide grapefruit enzyme prepared by the method.

[0023] The sixth object of the present invention is to provide the use of the grapefruit enzyme in preparing anthelmintic or insecticide preparations for crops.

[0024] In one embodiment of the present invention, the insect is one or more of rice leaf folder, aphid and red spider.

[0025] In one embodiment of the present invention, the method for repelling or killing insects is: spraying the grapefruit enzyme obtained by fermentation on crops; spraying once every 4 to 15 days, and the spraying amount per mu of land each time is 0.5 kg to 5.0 kg.

[0026] In one embodiment of the present invention, the Lactobacillus harbinensis EL07, Saccharomyces sergeni EY02 and Hansenia farpei EY01 are lactic acid bacteria and yeasts obtained by screening soil samples.

[0027] The grapefruit enzyme of the present invention is applied in the rice planting process and has a good insect repelling / killing effect on the rice leaf roller in the rice.

[0028] The present invention uses Harbin Lactobacillus EL07, Harbin Lactobacillus EL07 and Kazakhstan Saccharomyces sergeni EY02 or Hansen's yeast EY01 for fermentation, and optimizes the enzyme fermentation raw material components (such as adding different amounts of garlic for synergistic fermentation) to prepare grapefruit enzyme. The application effect of the fermentation enzyme in killing and repelling insects is further verified through field experiments on rice cultivation.

[0029] The above technical solution of the present invention has the following advantages compared with the prior art:

[0030] The invention provides a strain of Harbin lactobacillus, a grapefruit enzyme and application thereof in an anthelmintic or insecticide preparation. The invention adopts a self-screened novel Harbin lactobacillus EL07 and a mature landscape grapefruit and other auxiliary ingredients (molasses, water, garlic and wormwood) fermented by a self-screened novel Harbin lactobacillus EL07 and a Kazakh yeast EY02, and the cultured Harbin lactobacillus EL07 and a Hansen yeast EY01 liquid bacterial liquid are inoculated into a fermentation medium according to an inoculation amount of 0.2%-20%. The grapefruit content is 10%-50%, and the contents of molasses, water, grass charcoal and wormwood are 2%-20%, 40%-80%, 1%-15% and 0.5%-20% respectively. The fermentation temperature is 5°C-38°C. Stirring fermentation is adopted, and the stirring speed is 10rpm-300rpm. The fermentation cycle is 7d-20d. The fermented liquid anthelmintic / insecticide enzyme is applied in the rice planting process, and has a good anthelmintic / insecticide effect on rice leaf rollers in rice.

[0031] Biodeposit Information:

[0032] Harbin Lactobacillus EL07 was deposited in the China Center for Type Culture Collection (CCTCC) on July 6, 2023, with the deposit number CCTCC NO: M 20231206, and the deposit address is Wuhan University; the classification name is Harbin Lactobacillus (Lactobacillus harbinensis) EL07.

[0033] Kazakhstan yeast EY02 was deposited in the China Center for Type Culture Collection (CCTCC) on July 6, 2023, with the deposit number CCTCC NO: M 20231205, and the deposit address is Wuhan University; it is classified and named Kazakhstan yeast (kazochstania cervazzii) EY02.

[0034] Hanseniaspora valbyensis EY01 was deposited in the China Center for Type Culture Collection (CCTCC) on July 6, 2023, with the deposit number CCTCC NO: M 20231204, and the deposit address is Wuhan University; the classification name is Hanseniaspora valbyensis EY01. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein:

[0036] Figure 1 The nucleic acid electrophoresis diagram of Lactobacillus EL07 in Example 1 of the present invention;

[0037] Figure 2 The effect of different strains on the field application effect of liquid insect repellent / insecticide grapefruit enzyme fermentation production in Example 2 of the present invention;

[0038] Figure 3 The effects of different carbon source supplements on the field application of liquid repellent / insecticide grapefruit enzyme fermentation production in Example 3 of the present invention;

[0039] Figure 4 The effect of garlic supplementation on the field application effect of liquid insect repellent / insecticide grapefruit enzyme fermentation production in Example 4 of the present invention;

[0040] Figure 5 This is a diagram showing the effect of spraying the liquid insect repellent / insecticide grapefruit enzyme of the molasses+garlic+wormwood group in Example 4 of the present invention in a rice field. DETAILED DESCRIPTION

[0041] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0042] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0043] Example 1 Screening and identification of Harbin Lactobacillus EL07.

[0044] Take 50g of grapes, peaches, cowpeas and peppers harvested from the farm, wash with water, chop, add 1200mL of purified water, add 150g of molasses, and ferment in a water-sealed kimchi jar, control 30℃, and ferment for 7 days. After sampling, YPD solid culture medium (1% yeast extract, 2% protein Chen, 2% glucose, 2% agar powder) was used to screen lactic acid bacteria. A strain of lactic acid bacteria was screened. The lactic acid bacteria genome was extracted using the Bacteria Genomic DNA Kit (purchased from Kangwei Century, catalog number: CW0552) according to the instructions. The lactic acid bacteria genome was used as a template, the primers were 27F:AGAGTTTGATCCTGGCTCAG (SEQ ID No. 2), 1492R:TACGGCTACCTTGTTACGACTT (SEQ ID No. 3), and Ex-Taq enzyme was used for PCR amplification. The PCR conditions were: 94°C 30s, 55°C 30s, 72°C 1.4min, 30 cycles, and the conservative sequence gene fragment was obtained ( Figure 1). The conservative sequence of the above strain was sequenced to obtain a gene sequence (as shown in SEQ ID No. 1). The gene sequence obtained by gene sequencing was compared (BLAST) in the NCBI database, and the lactic acid bacteria obtained by screening were determined to be Harbin Lactobacillus (Lactobacillus harbinensis), and were named Harbin Lactobacillus (Lactobacillus harbinensis) EL07. Compared with all the conservative gene sequences of microorganisms in the NCBI database, Harbin Lactobacillus (Lactobacillus harbinensis) EL07 had a highest similarity of 99% (compared with the strain Lactobacillus harbinensis strain LH-1), which fully demonstrated that the strain obtained by screening was a new strain.

[0045] SEQ ID No. 1 is as follows:

[0046]

[0047] Example 2 Effect of different strains on the field application effect of liquid insect repellent / insecticide grapefruit enzyme fermentation production.

[0048] The selected Lactobacillus harbinensis EL07 and Kazochstania cervazzii EY02 were inoculated into optimized MRS liquid medium (tryptone 1%, beef extract 1%, yeast extract 0.5%, glucose 2%, Tween 8%, K2HPO4 0.2%, sodium acetate 0.5%, citrate amine 0.2%, MgSO4·4H2O 0.005%) and YPD liquid medium (yeast extract 1%, peptone 2%, glucose 2%), respectively. When Lactobacillus harbinensis EL07 was cultured, the liquid volume was 1000mL in a 5L triangular bottle, and cultured at 200rpm and 37℃ for 36h. When Kazakh yeast (kazochstania cervazzii) EY02 seeds were cultured, the liquid volume was 1000 mL in a 5 L Erlenmeyer bottle, and the culture was carried out at 200 rpm and 30°C for 36 h.

[0049] After crushing the landscape pomelo, mix it with other auxiliary ingredients (water) to obtain a fermentation medium. Inoculate them separately as follows: 1) Inoculate the cultured Lactobacillus harbinensis EL07 into the fermentation medium at an inoculation rate of 1%. 2) Inoculate the cultured Lactobacillus plantarum CICC20270 into the fermentation medium at an inoculation rate of 1%. 3) Inoculate the cultured Lactobacillus harbinensis EL07 and Kazochstania cervazzii EY02 seed liquid into the fermentation medium at an inoculation rate of 1%. 4) Inoculate the cultured Lactobacillus harbinensis EL07 and Hanseniaspora valbyensis EY01 seed liquid into the fermentation medium at an inoculation rate of 1%. 5) Do not inoculate any exogenous microorganisms and ferment directly (control).

[0050] Among them, the grapefruit content is 20%, the water content is 80%, and the fermentation temperature is 30°C; stirring fermentation is adopted, and the stirring speed is 50rpm; the fermentation cycle is 10d. After the fermentation is completed, after filtering through filter cloth, the fermentation liquid is centrifuged by a disc centrifuge to clarify it before use. Among them, the waste residue produced can be used as organic fertilizer after further composting and fermentation. When spraying in farmland, the fermented enzyme does not need to be diluted with water. Using drones, spray twice within 14 days (once every 7 days), and the amount of spraying per acre of rice field each time is 1.3kg. Figure 2 As shown in the figure, the insect repellent / killing rate (rice leaf roller) of the enzyme that was not inoculated with bacteria and only fermented naturally was only 29%. The insect repellent / killing rate of the enzyme fermented by Lactobacillus harbinensis EL07 alone was better than that of Lactobacillus plantarum CICC20270 (45%), and the insect repellent / killing rate reached 56%. The insect repellent / killing rate of the fermented enzyme of Lactobacillus harbinensis EL07 and Kazakhstan yeast EY02 was better than that of Lactobacillus harbinensis EL07 and Hansen yeast EY01 (59%), and the insect repellent / killing rate reached 66%.

[0051] Example 3 Effects of different carbon source supplements on the field application of liquid insect repellent / insecticide grapefruit enzyme fermentation production.

[0052] The screened Harbin Lactobacillus EL07 and Kazakhstan yeast EY02 were inoculated into optimized MRS liquid medium (tryptone 1%, beef extract 1%, yeast extract 0.5%, glucose 2%, Tween 8%, K2HPO4 0.2%, sodium acetate 0.5%, citrate amine 0.2%, MgSO4·4H2O 0.005%) and YPD liquid medium (yeast extract 1%, protein 2%, glucose 2%). When Harbin Lactobacillus EL07 was cultured, the liquid volume was 1000mL in a 5L triangular bottle, and the culture was carried out at 200rpm and 37℃ for 36h. When Kazakhstan yeast EY02 was cultured, the liquid volume was 1000mL in a 5L triangular bottle, and the culture was carried out at 200rpm and 30℃ for 36h.

[0053] After crushing the landscape pomelo, 80% water (control group), 60% water + 15% molasses (honey group), 60% water + 15% brown sugar (brown sugar group), 60% water + 15% sucrose (sucrose group), and 60% water + 15% glucose (glucose group) were mixed respectively. Inoculate in the following manner: inoculate the cultured Harbin Lactobacillus EL07 and the Kazakhstan yeast EY02 seed liquid into the fermentation medium at an inoculation rate of 0.5%. Among them, the fermentation temperature is 30°C; stirring fermentation is adopted, and the stirring speed is 50rpm; the fermentation cycle is 9d. After the fermentation is completed, after filtering through a filter cloth, the fermentation liquid is centrifuged by a disc centrifuge to clarify it before use. Among them, the waste residue produced can be used as organic fertilizer after further composting and fermentation. When spraying in farmland, the fermented enzyme does not need to be diluted with water.

[0054] Using drones, spraying is done twice within 14 days (once every 7 days), and the amount of spraying per mu of rice field each time is 1.2 kg. Figure 3 As shown in the figure, the insect repelling / killing rates of the liquid insect repelling / killing grapefruit enzyme in the molasses group, brown sugar group, sucrose group, and glucose group were all higher than those of the enzyme without any carbon source added (control group), and their insect repelling / killing rates were 81%, 79%, 68%, and 72%, respectively. However, the insect repelling / killing rate of the enzyme without any carbon source added was only 66%.

[0055] Example 4 Effect of adding different key ingredients on the field application effect of liquid insect repellent / insecticide grapefruit enzyme fermentation production.

[0056] The screened Lactobacillus EL07 and Kazakhstan yeast EY02 were inoculated into optimized MRS liquid medium (tryptone 1%, beef extract 1%, yeast extract 0.5%, glucose 2%, Tween 8%, K2HPO4 0.2%, sodium acetate 0.5%, citrate amine 0.2%, MgSO4·4H2O 0.005%) and YPD liquid medium (yeast extract 1%, protein 2%, glucose 2%). When the Harbin Lactobacillus EL07 seed culture was carried out, the liquid volume was 1000mL in a 5L triangular bottle, and the culture was carried out at 200rpm and 37℃ for 36h. When the Kazakhstan yeast (kazochstania cervazzii) EY02 seed culture was carried out, the liquid volume was 1000mL in a 5L triangular bottle, and the culture was carried out at 200rpm and 30℃ for 36h.

[0057] After crushing the landscape pomelo, mix them with 65% water + 15% molasses (molasses group), 63% water + 15% molasses + 2% garlic (molasses + garlic group), and 61% water + 15% molasses + 2% garlic + 2% wormwood (molasses + garlic + wormwood group). Inoculate them separately as follows: inoculate the cultured Harbin Lactobacillus EL07 and the Kazakhstan yeast EY02 seed liquid into the fermentation medium at an inoculation rate of 0.5%. Among them, the fermentation temperature is 30°C; stirring fermentation is adopted, and the stirring speed is 50rpm; the fermentation cycle is 9d. After the fermentation is completed, after filtering through a filter cloth, the fermentation liquid is centrifuged by a disc centrifuge to clarify it before use. Among them, the waste residue produced can be used as organic fertilizer after further composting and fermentation. When spraying in farmland, the fermented enzyme does not need to be diluted with water.

[0058] Using drones, spraying is done twice within 14 days (once every 7 days), and the amount of spraying per mu of rice field each time is 1.2 kg. Figure 4 As shown in the figure, the liquid insect repellent / insecticidal grapefruit enzyme in the molasses + garlic group and the molasses + garlic + wormwood group had a higher insect repellent / insecticidal rate (rice leaf folder) than the enzyme in the molasses group, which were 88% and 94.0%, respectively. However, the insect repellent / insecticidal rate of the enzyme in the molasses group was only 81%. The fermented liquid insect repellent / insecticidal enzyme was applied in the rice planting process, and had a good insect repellent / insecticidal effect on rice leaf folder ( Figure 5 ).

[0059] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A Harbin Lactobacillus EL07, characterized in that The Harbin Lactobacillus EL07 was deposited in the China Center for Type Culture Collection on July 6, 2023, with the deposit number CCTCCNO: M 20231206; the deposit address is Wuhan University.

2. A microbial preparation containing the Harbin Lactobacillus EL07 according to claim 1.

3. Use of the Harbin Lactobacillus EL07 according to claim 1 or the microbial preparation according to claim 2 in the preparation of grapefruit enzyme.

4. A method for preparing grapefruit enzyme using the Harbin Lactobacillus EL07 according to claim 1, characterized in that: The following steps are involved: The grapefruit enzyme is obtained by inoculating a mixture of grapefruit and water with Harbin Lactobacillus EL07 for fermentation; the inoculation amount of Harbin Lactobacillus EL07 is 0.2%-20%; And / or, a mixture of grapefruit and water is used as a raw material, and Harbin Lactobacillus EL07 and yeast are inoculated for fermentation to obtain the grapefruit enzyme; the inoculation amounts of Harbin Lactobacillus EL07 and yeast are 0.2%-20% respectively.

5. The method according to claim 4, characterized in that The yeast is Saccharomyces sergeni EY02 or Hansenia farpei EY01; And / or, the fermentation temperature is 5°C-38°C; And / or, the fermentation is carried out by stirring fermentation, and the stirring speed is 10rpm-300rpm; And / or, the fermentation period is 7 days to 20 days.

6. The method according to claim 4, characterized in that The pomelo is selected from one or more of landscape pomelo, field pomelo, pomelo, golden pomelo, Dianjiang white pomelo, Jinlan pomelo, Pingshan pomelo, Changshan pomelo, four-season pomelo, Chuhong pomelo and Guanxi honey pomelo.

7. The method according to claim 4, characterized in that The concentration of grapefruit in the raw material is 5wt%-60wt%.

8. The method according to claim 4, characterized in that The raw materials also include one or more of sucrose, brown sugar, glucose, molasses, garlic and wormwood.

9. The grapefruit enzyme prepared by the method according to any one of claims 1 to 8.

10. Use of the grapefruit enzyme according to claim 9 in preparing anthelmintic or insecticide preparations for crops.

Images