Interference engineering bacterium for blocking early infection of animal parasitic nematodes and application of interference engineering bacterium

Abstract

The invention discloses interference engineering bacteria for blocking early infection of animal parasitic nematodes and application, and belongs to the field of animal parasitic disease prevention and treatment. According to the interference engineering bacteria disclosed by the invention, the HCON00038080 (cyp-22a1) gene of haemonchus contortus is specifically silenced by expressing double-stranded RNA (dsRNA), so that the biosynthesis of endogenous bile acid-like steroid hormone of the haemonchus contortus is inhibited, the activation of infectious larvae is influenced, and the infection establishment process of the infectious larvae is blocked. The invention can be used for preventing early infection of haemonchus disease of ruminants such as cattle, sheep, camels and the like and the phenomenon of spring / perinatal high tide, has higher application value for prevention and control of haemonchus disease, and has reference value for prevention and control of parasitic nematode disease of other animals.

Description

Technical Field

[0001] The invention relates to the field of animal parasitic disease prevention and treatment, and in particular to an interfering engineering bacterium for blocking early infection of animal parasitic nematodes and its application. Background Art

[0002] Animal parasites include external parasites and internal parasites. Internal parasites include flukes, tapeworms, nematodes, etc. There are many types of animal parasitic nematodes, which feed on the host's blood, tissue fluid, chyme, etc., often causing tissue damage, inflammation and secondary infection, anemia, emaciation, developmental delay, and even death. Some parasitic nematodes can infect a variety of animals and humans, and their prevention and control are of great veterinary and public health significance.

[0003] Animal parasitic nematode infections cause direct economic losses of tens of billions of dollars to the global livestock and poultry industry each year, and also cause great harm to the high-quality breeding of important economic animals such as cattle, sheep, pigs, and chickens in my country. Due to the lack of effective vaccine immunization programs for major livestock and poultry parasitic nematodes, chemical anthelmintics remain the main means of controlling animal parasitic nematode infections. However, long-term, large-scale, and irregular drug use has led to the emergence of animal parasitic nematode resistance. Among them, animal parasitic nematodes are the most serious in terms of drug resistance. For example, Haemonchus contortus - a highly pathogenic parasitic nematode that is widely parasitic on ruminants such as cattle, sheep, and camels - can develop tolerance to new antiparasitic drugs within 2 years. Globally, Haemonchus contortus has a serious multidrug resistance to commonly used anthelmintics such as ivermectin and albendazole, and is a model organism for animal parasitic nematode resistance research and drug development.

[0004] The eggs of many animal parasitic nematodes are excreted with feces, and develop into the infectious third-stage larvae in the external environment through the first-stage larval stage and the second-stage larval stage. The infective larvae need to be activated after entering the animal's body, and the activated larvae develop into adults through the fourth-stage larval stage. Due to seasonal, immune and other factors, the infective larvae of some animal parasitic nematodes (for example, Haemonchus contortus and Toxocara canis) cannot be fully activated after entering the host's body, resulting in "diapause". These diapause larvae will be activated in large numbers in spring, perinatal period, or lactation period, causing a large number of animals to become ill, which is called the "spring / perinatal climax" phenomenon. "Deep winter deworming" has been used to kill diapause larvae in animals, but due to the emergence of drug resistance, the prevention and control of "spring / perinatal climax" has become more difficult, posing a greater challenge to the prevention and control of animal parasitic diseases.

[0005] RNA interference (RNAi) technology is a common method of gene knockdown in eukaryotes. It has been widely used in reverse genetics (gene function) research in animals, plants, pathogens (bacteria, viruses, parasites), etc., and also has a positive impact on the treatment strategies of many diseases such as pathogen infection, inflammation, and cancer. Electroporation, microinjection, feeding, soaking and other methods can already introduce interference reagents (double-stranded RNA, small interfering RNA, etc.) into animal parasitic nematodes to exert specific RNAi effects. Based on the RNAi worm phenotype information (decreased activity, developmental delay, decreased pathogenicity, death, etc.), the basic function of the target gene can be deduced, and it can also be determined whether the target gene can be used as a potential intervention target. At present, RNAi of specific target genes has gradually become a new concept for preventing and controlling animal parasitic nematode infections.

[0006] Cytochrome P450s (CYPs) are a class of heme proteins widely found in animals, plants, bacteria, fungi, parasites and other living organisms, and are an important part of the multifunctional oxidase system of biological organisms. Many cross-species studies have shown that CYPs, as an important part of the oxidase system of living organisms, play an important role in the metabolism, decomposition and detoxification of exogenous harmful substances such as drugs, pesticides and environmental pollutants. In addition, many studies based on model organisms have found that CYPs are involved in the synthesis and metabolism of a variety of endogenous bioactive substances (including fatty acids, steroid hormones, pheromones, etc.). Some CYPs have been found to play an important role in the tolerance of animal parasitic nematodes to anthelmintics and in the development of worms. At present, broad-spectrum CYP inhibitors have been used in the prevention and control of mouse strongyloides autoinfection.

[0007] There is currently a lack of effective vaccine immunization programs for animal parasitic nematode infections. Chemical anthelmintics remain the main means of controlling animal parasitic nematode infections, but drug resistance is serious and does not conform to the advocacy of "reducing and banning antibiotics." In addition, chemical anthelmintics are basically ineffective against diapause larvae. Although in vitro screening studies of RNAi target genes for animal parasitic nematodes have been conducted, there is a lack of in vivo animal testing and verification, and there are no specific feasible technical solutions. In particular, there are currently no RNAi targets for intervening in the activation of diapause larvae in vivo. Although broad-spectrum CYP inhibitors can have a certain anthelmintic effect by intervening in the development process of nematodes, they are also toxic to host animals and humans and are not suitable for promotion and use in livestock and poultry farming. Summary of the invention

[0008] The present invention aims to address the deficiencies of the prior art and propose an interfering engineered bacterium and its application for blocking early infection of animal parasitic nematodes, based on a bacterium that plays a key role in the activation and infection of infective larvae of Haemonchus contortus (including diapause larvae in the host). cypGene, design specific double-stranded RNA (dsRNA) amplification primers, construct engineered bacteria that can express specific interfering RNA, introduce it into the body of infectious nematode larvae through feeding, efficiently knock down the target gene, intervene in the activation process of infectious larvae or dormant larvae in the host, thereby blocking nematode infection and preventing and controlling nematode diseases.

[0009] The purpose of the present invention is achieved through the following technical solutions: an interference engineering bacterium for blocking early infection of animal parasitic nematodes, constructing an expression vector of Haemonchus contortus cyp-22A1 The L4440 vector plasmid of the homologous gene double-stranded RNA was transformed into competent Escherichia coli to obtain interference engineering bacteria; Express cyp-22A1 The primers for amplifying double-stranded RNA of homologous genes are: Upstream primer: 5′–CATCATCCAAGATTTCGTGTTAGGC–3′ (SEQ ID No. 1); Downstream primer: 5'-TGGCTGCTCGTCTCCGAACACCTGG-3' (SEQ ID No. 2).

[0010] Furthermore, the expression cyp-22A1 The length of the double-stranded RNA gene is 480 bp.

[0011] Furthermore, the cyp-22A1 The homologous gene is a target molecule that plays a key role in the activation of infective larvae of Haemonchus contortus.

[0012] Furthermore, the interference engineering bacteria are used to feed the second-stage larvae of animal parasitic nematodes, reducing cyp-22A1 The transcription level of the gene is reduced, inhibiting the activation and development of the third-stage infective larvae and blocking the infection process.

[0013] Furthermore, the biological information of Helicoverpa polymorpha, Angiostrongylus annularis, Nippostrongylus brasiliensis, Angiostrongylus cantonensis, Dictyocaulus viviparus, Hookworm, Corynebacterium gonorrhoeae, Esophagus dentata, and Strongyloides was mined and analyzed, and Haemonchus contortus was identified. cyp-22A1 orthologous genes.

[0014] Furthermore, the construction method of the interference engineering bacteria comprises the following steps: (1) Collect and purify infective larvae of Haemonchus contortus, extract RNA and perform reverse transcription reaction; (2) Hc-18s The gene was used as an internal reference, and the specific primers were used for qPCR reaction to analyze the expression of cyp Transcription levels of genes at various developmental stages of nematodes; (3) Screening out key genes involved in nematode activation and infection through host serum stimulation test and relative transcription level analysis cyp Gene cyp-22A1 , and validate them as intervention targets; (4) Design of Haemonchus contortus cyp-22A1 Gene double-stranded RNA amplification primers, using homologous recombination method to construct interference plasmid L4440- cyp-22A1 , transformed into Escherichia coli HT115 competent cells to obtain interfering engineered bacteria for blocking early infection of animal parasitic nematodes.

[0015] On the other hand, the present invention also provides a use of the interfering engineered bacteria in blocking early infection of animal parasitic nematodes.

[0016] Furthermore, the drug is introduced into the infective larvae of nematodes by feeding to prevent the "spring / perinatal climax" phenomenon of ruminant haemonchus disease caused by the activation of diapause larvae.

[0017] Beneficial effects of the invention: The invention is a biological technical solution that does not rely on chemical anthelmintics and can effectively block and prevent animal parasitic nematode infections. The solution is based on the "development-infection" process of animal parasitic nematodes and the parasitic nematode RNAi target genes verified by animal in vivo experiments, has good specificity, and poses no potential threat to the health of livestock, poultry and humans.

[0018] Among them, it will be possible to express cyp-22A1 After the engineered bacteria containing dsRNA gene were fed to the second-stage larvae of Haemonchus contortus in the external environment, the third-stage infective larvae cyp-22A1 The transcription level of the gene decreased by more than 50%; cyp-22A1 After the third-stage infective larvae of the gene knockdown were desheathed in vitro (artificially activated), their development was blocked; cyp-22A1 After the knockdown of the gene, the third-stage infective larvae were fed to four Hu sheep for 21-63 days, the number of eggs in the feces was 0, and the number of adults was 0 after autopsy; this proves that the gene constructed by the present invention can express cyp-22A1 The double-stranded RNA interference engineered bacteria significantly reduced the infectivity of the third-stage larvae cyp- 22A1 The transcription level of the gene 100% blocked its infection-development process in the host. The method of the present invention is expected to serve as a new strategy for the prevention and control of animal parasitic nematode infections. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0020] Figure 1 The developmental stages of Haemonchus contortus cyp Schematic diagram of gene transcription levels; Figure 2 It is the key to the activation and infection establishment of Haemonchus contortus larvae. cyp Schematic diagram of gene screening; Figure 3 Schematic diagram showing that Dafadine A is a non-specific CYP inhibitor, where (A) is the molecular docking of CYP-22A1 protein and dafadine A; (B) is the effect of Dafadine A on the biosynthesis of dafamic acid DA in Haemonchus contortus; (C) is the effect of Dafadine A on other cyp Effects on gene transcription levels; Figure 4 Schematic diagram of the process by which feeding engineered bacteria to second-stage larvae can block the in vivo infection of Haemonchus contortus, where (A) is the effect of feeding on Haemonchus contortus cyp-22a1 Knockdown analysis of gene transcription; (B) The effect of feeding the second-stage larvae of Haemonchus contortus with engineered bacteria on the in vitro development of the infective third-stage larvae; (C) The effect of feeding the second-stage larvae of Haemonchus contortus with engineered bacteria on the number of worm eggs per gram of feces after the larvae developed into the infective third-stage larvae and were orally administered to Hu sheep for 21-63 days; (D) The effect of feeding the second-stage larvae of Haemonchus contortus with engineered bacteria on the number of adults after the larvae developed into the infective third-stage larvae and were orally administered to Hu sheep for 63 days.

[0021] Figure 5 yes cyp-22A1 Genes in Haemonchus contortus and Helicoverpa polymorpha ( Heligmosomoides polygyrus ), Annular Band Nematode ( Teladorsagia circumcincta )、Nipponstrongylus brasiliensis( Nippostrongylus brasiliensis )、Angiostrongylus cantonensis( Angiostrongylus cantonensis )、Dictyocaulus viviparus( Dictyocaulus viviparus ),hookworm( Ancylostoma sp. Necator americanus )、Goetheichthys spp.( Cylicostephanus goldi ), Oesophagostomum dentata ( Oesophagostomum dentatum ), Strongyloides ( Strongylus vulgaris ) is a schematic diagram of the identification results. DETAILED DESCRIPTION

[0022] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described below in conjunction with the accompanying drawings and implementation examples. It should be understood that the specific implementation examples described herein are only used to explain the present invention and are not used to limit the present invention.

[0023] Cytochrome P450s (CYPs) are involved in important biological processes such as parasitic nematode metabolism and degradation of xenobiotics, drug resistance formation, nematode development, and lifespan regulation. The present invention uses Haemonchus contortus as a model organism for research (Haemonchus contortus is a well-known technical means in the art for screening new anthelmintic drug targets), aiming to screen out key CYPs encoding genes involved in the activation of infectivity / diapause larvae of animal parasitic nematodes ( cyp ), and attempted to conduct RNAi analysis of target genes through feeding method, blocking larval activation and subsequent infection and development processes, so as to achieve the purpose of preventing and controlling nematode infection.

[0024] The present invention provides an interference engineering bacterium for blocking early infection of animal parasitic nematodes, and constructs an expression vector of Haemonchus contortus cyp-22A1 The L4440 vector plasmid of the homologous gene double-stranded RNA was transformed into competent Escherichia coli to obtain interference engineering bacteria; Express cyp-22A1 The primers for amplifying double-stranded RNA of homologous genes are: Upstream primer: 5′–CATCATCCAAGATTTCGTGTTAGGC–3′ (SEQ ID No. 1); Downstream primer: 5'-TGGCTGCTCGTCTCCGAACACCTGG-3' (SEQ ID No. 2).

[0025] The expression cyp-22A1 The length of the double-stranded RNA gene is 480 bp.

[0026] First, 23 species of Haemonchus contortus were analyzed. cyp The transcription levels of most genes in various developmental stages of nematodes were found cyp The genes are highly expressed in the infective larval stage ( Figure 1 Through host serum stimulation test and relative transcription level analysis, we further screened out the key genes that may be involved in nematode activation and infection. cyp Gene – HCON_00038080 / cyp-22A1 ( Figure 2 ).

[0027] Secondly, the binding characteristics of the known CYP inhibitor dafadine-A and the protein structure of the model organism Caenorhabditis elegans CYP-22A1 were analyzed through molecular docking technology based on structural biology, and it was confirmed that dafadine-A can also bind to the CYP-22A1 of Haemonchus contortus. The addition experiment of the CYP inhibitor dafadine-A was carried out to further analyze the function of CYP-22A1 in Haemonchus contortus (taking dafamic acid biosynthesis as an example), and it was confirmed that dafadine-A can inhibit the biosynthesis of dafamic acid, but it also affects many other cyp The transcription level of the gene suggests that dafadine-A is not a specific inhibitor of a certain CYP ( Figure 3 ).

[0028] To clarify the role of CYP-22A1 in larval activation, we designed a cytosolic cyp-22A1 The double-stranded RNA amplification primers (upstream primer: 5'-tcaagcttatcgataccgCATCATCCAAGATTTCGTGTTAGGC-3' (SEQ ID No.3); downstream primer: 5'-ccgggccccccctcgaggTGGCTGCTCGTCTCCGAACACCTGG-3' (SEQ ID No.4)) were used to amplify the gene. sal I constructs that can express cyp-22A1 The L4440 plasmid containing the double-stranded RNA of the gene was transformed into competent Escherichia coli HT115. The transformed engineered bacteria were fed to the second-stage larvae of Haemonchus contortus (it is a well-known technology in the art that the second-stage larvae of Haemonchus contortus feed on bacteria in the external environment), and the infective larvae that developed to the third stage were collected and gene knockdown analysis was carried out to clarify that the engineered bacteria feeding method can significantly reduce the infective larvae. cyp-22A1 The transcription level of genes. The infectious larvae fed with the engineered bacteria were used to infect Hu sheep. It was found that compared with the control group, they failed to establish infection in the Hu sheep, nor did they develop to adult stage and lay eggs (the third-stage larvae of Haemonchus twister enter the host to establish infection, develop to adult stage and mate and lay eggs, which is a well-known technical means in the art), indicating that the infection process of Haemonchus twister was blocked ( Figure 4 ).

[0029] Finally, if Figure 5 As shown in the figure, the biological information of common nematodes in livestock and poultry, such as Helicoverpa polymorpha, Angiostrongylus annularis, Nippostrongylus brasiliensis, Angiostrongylus cantonensis, Dictyocaulus viviparus, Hookworm, Corynebacterium gonorrhoeae, Esophagus dentata, and Strongyloides, was mined and analyzed, and Haemonchus twisterus was identified. cyp-22A1 The orthologous genes of cyp-22A1It and its analogs are relatively conservative target genes in animal parasitic nematodes and can be widely used in the activation of animal parasitic nematode larvae and the blocking of early infection.

[0030] In summary, the present invention uses the selected nematodes that play a key role in the activation of infective larvae of Haemonchus contortus cyp-22A1 Genes are used as target molecules to construct cyp-22A1 The engineered bacteria expressing double-stranded RNA were used to feed the second-stage larvae of Haemonchus contortus in the environment, which significantly reduced the number of infective third-stage larvae. cyp-22A1 The transcription level of the gene was reduced, and the infection-development process in the host was 100% blocked. This method is expected to be a new strategy for the prevention and control of animal parasitic nematode infections.

[0031] Based on the above design process, the specific embodiments provided by the present invention are as follows: Example 1: Analysis of CYPs transcription levels at various developmental stages of Haemonchus contortus

[0032] (1) Collecting parasitic nematodes at different developmental stages After collecting feces infected with Haemonchus contortus, the eggs were enriched by the saturated salt water flotation method. The enriched eggs were resuspended in D-Hank's culture medium and placed on agar plates for incubation at 28°C. L1 larvae were collected after 24 hours, L2 larvae were collected after 72 hours, and L3 (infectious) larvae were collected after 168 hours. L4 larvae and adults were obtained by dissecting the abomasum of infected animals. The collected worm bodies were quickly frozen in liquid nitrogen and stored at -80°C for later use.

[0033] (2) Total RNA extraction (TRIzol method) and reverse transcription reaction Take an appropriate amount of collected insect bodies into a 1.5mL grinding tube, add 1mL trizol and 3 grinding beads, grind at 60HZ for 180s, and let stand at room temperature for 10min to fully lyse. Add 0.2mL chloroform, shake vigorously for 10s, let stand for 10min, and centrifuge at 12000rpm / 4℃ for 10min; carefully draw the upper aqueous phase into a new centrifuge, add an equal volume of isopropanol and mix, let stand at room temperature for 10min, and centrifuge at 12000rpm / 4℃ for 10min to precipitate RNA; discard the supernatant, and wash the RNA precipitate with 1mL 75% (v / v) ethanol solution 2-3 times; centrifuge and discard ethanol and dry for 10min until the RNA white precipitate becomes transparent. Add an appropriate amount of RNase-free water to dissolve the precipitate, perform quality inspection on a micro nucleic acid analyzer, and then take 1ug RNA for reverse transcription using FSQ-301 reagent.

[0034] (3) Fluorescence quantitative PCR by Hc-18sThe gene was used as an internal reference, and qPCR reactions were performed using specific primers.

[0035] The qPCR reaction system was as follows: pre-denaturation at 95°C for 30 sec, denaturation at 95°C for 10 sec, annealing at 60°C for 10 sec, and 40 cycles to collect fluorescence information; denaturation at 95°C for 15 sec, annealing at 60°C for 60 sec, denaturation at 95°C for 15 sec, and collection of melting curve information.

[0036] The obtained CT values ​​were converted into 2 -ΔCT The relative quantitative analysis was performed by comparing the values, the significance analysis was performed by t-test and one-way analysis of variance, and the software GraphPad Prism 8.0 was used to draw graphs to analyze the transcription levels of CYPs genes at different developmental stages of the insect body. The results are shown in Figure 1 shown.

[0037] Example 2: Key factors involved in infecting the host cyp Filter (1) Preparation of exocyst L3 (xL3) larvae Collect L3 larvae of Haemonchus contortus, add 1 mL of 0.9% (w / v) sodium hypochlorite NaClO solution, and shake at 190 rpm for 20 min in a 37°C constant temperature shaker to fully desheath. Wash with 1 mL of saline 5 times, centrifuge at 800 g for 5 min each time, and discard the supernatant to fully remove NaClO.

[0038] (2) Serum stimulation of larvae Dilute with DMEM medium containing 10% (v / v) sheep serum to a density of about 6 / μL, and transfer to a 96-well plate for culture (50 μL / well). Set up a control group without serum. Place the 96-well plate in an incubator at 38°C and 10% CO2 for 48 hours.

[0039] (3) qPCR reaction detection cyp Changes in gene transcription levels.

[0040] The culture medium in the experimental group and the control group was collected and centrifuged at 800 g for 5 min, and the supernatant was discarded to enrich the worms. qPCR primers for different CYPs encoding genes were designed for amplification. The results are shown in Figure 2 shown. Example 3: Further validation of CYP-22A1 as an intervention target

[0041] (1) Molecular docking of CYP-22A1 (HCON_00038080) and dafadine A The three-dimensional protein structure of CYP-22A1 was obtained in advance through AlphaFold2 simulation. The protein was preprocessed with the help of the "Prepwiz" module of the software Schrödinger. That is, through modeling calculations, bond order assignment, charge assignment, adding hydrogen atoms, and creating missing side chains or ring atoms, the target protein was converted into a form that can be docked with the ligand.

[0042] The chemical structure of dafadine A was downloaded from pubchem. The ligand file was converted into the lowest energy three-dimensional structure using the “LigPrep” module of the software Schrödinger, and standardized processing such as hydrogenation, charge addition, and generation of molecular conformation was performed for subsequent docking.

[0043] The prepared CYPs protein was used as the receptor and the dafadine A molecule was used as the ligand. The software Maestro V11.8 was used to perform protein-molecule docking. The "Glide" module in the software was used to generate a receptor grid containing docking sites and possible conformations of the ligand. The Monte Carlo method was used to minimize the energy score and output the docking score table. The docking results were visualized using the software PyMOL V2.5 (Schrödinger) (Delano, 2002). The results are shown in Figure 2. Figure 3 As shown in A.

[0044] (2) Analysis of differences in dafadine A metabolism in larvae after treatment with dafadine A The larval samples were treated with appropriate amounts for lipid extraction, and the extracted lipids were homogenized by adding 40% (v / v) methanol and zirconium oxide beads. Chloroform with a volume twice that of methanol was added and centrifuged at 10,000 × g for 10 minutes at room temperature to separate the aqueous and organic phases. The organic phase was retained and dried and resuspended in methanol, and then analyzed by mass spectrometry using an Orbitrap Fusion Lumos mass spectrometer. The results are shown in Figure 3 As shown in B.

[0045] (3) Differential expression analysis of larval CYPs encoding genes after Dafadine A treatment The real-time fluorescence quantitative PCR operation steps and data analysis methods in Example 2 were used to analyze the changes in the transcription levels of the genes encoding CYPs after treatment with dafadine A. The results are shown in Figure 2. Figure 3 As shown in C.

[0046] Example 4: RNA interference cyp-22A1 Validation of post-target blocking effect (1) cyp-22A1 (HCON_00038080) Interference strain construction and feeding The interference plasmid L4440- cyp-22A1 , respectively, L4440 no-load, L4440- cyp- 22A1 Transform into E. coli HT115 competent cells and perform PCR identification using universal primers L4440 F / R. Expand the positive clones and add them to the culture plate to feed the larvae. After culture, collect the larvae and extract RNA for qPCR reaction to confirm the interference effect, such as Figure 4 As shown in A.

[0047] (2) Phenotypic identification after interference After the interference, the development of nematodes was continuously observed. It was found that the oral sac of the infected larvae was not developed compared with that of the control group, and the worm body was curled up (e.g. Figure 4 B in the figure); when the disturbed insect strains were fed to Hu sheep, the EPG was significantly reduced compared with the control group (such as Figure 4 C in the figure); at the same time, the number of adult worms in the abomasum was significantly reduced compared with the control group (e.g. Figure 4 D in.

[0048] Example 5: Bioinformatics analysis of nematode CYPs

[0049] Based on Caenorhabditis elegans cyp Gene information, using the EnsemblCompara GeneTrees pipeline tool to identify dozens of selected nematodes and Caenorhabditis elegans cyp 1-to-1 (red dots) and 1-to-many (orange dots) orthologs of the gene. Amino acid sequences were obtained from the WormBase ParaSite database and analyzed using InterProScan software. cyp -family structure can be considered as CYP candidate sequences. Candidate sequences were corrected by bidirectional optimal BLAST. cyp Orthologs were considered valid identifications. Orthologs that were not identified and classified into a nematode clade were manually calibrated.

[0050] The above embodiments are used to illustrate the present invention rather than to limit the present invention. Any modification and change made to the present invention within the spirit of the present invention and the protection scope of the claims shall fall within the protection scope of the present invention.

Claims

1. An interfering engineering bacterium for blocking early infection of animal parasitic nematodes, characterized in that: Haemonchus contortus cyp-22A1 The L4440 vector plasmid of the homologous gene double-stranded RNA was transformed into competent Escherichia coli to obtain interference engineering bacteria; Express cyp-22A1 The primers for amplifying double-stranded RNA of homologous genes are: Upstream primer: 5′–CATCATCCAAGATTTCGTGTTAGGC–3′ (SEQ ID No. 1); Downstream primer: 5'-TGGCTGCTCGTCTCCGAACACCTGG-3' (SEQ ID No. 2).

2. The interfering engineering bacteria for blocking early infection of animal parasitic nematodes according to claim 1, characterized in that: The expression cyp-22A1 The length of the double-stranded RNA gene is 480 bp.

3. The interfering engineering bacteria for blocking early infection of animal parasitic nematodes according to claim 1, characterized in that: Said cyp-22A1 The homologous gene is a target molecule that plays a key role in the activation of infective larvae of Haemonchus contortus.

4. The interfering engineering bacteria for blocking early infection of animal parasitic nematodes according to claim 1, characterized in that: The interference engineering bacteria are used to feed the second-stage larvae of the animal parasitic nematode larvae, reducing cyp-22A1 The transcription level of the gene is reduced, inhibiting the activation and development of the third-stage infective larvae and blocking the infection process.

5. The interfering engineering bacteria for blocking early infection of animal parasitic nematodes according to claim 1, characterized in that: The biological information of Helicoverpa polymorpha, Angiostrongylus annularis, Nippostrongylus brasiliensis, Angiostrongylus cantonensis, Dictyocaulus viviparus, Hookworm, Corynebacterium gonorrhoeae, Oesophagostomum dentata, and Strongyloides was mined and analyzed, and Haemonchus contortus was identified. cyp-22A1 orthologous genes.

6. The interfering engineering bacteria for blocking early infection of animal parasitic nematodes according to claim 1, characterized in that: The construction method of the interference engineering bacteria comprises the following steps: (1) Collect and purify infective larvae of Haemonchus contortus, extract RNA and perform reverse transcription reaction; (2) Hc-18s The gene was used as an internal reference, and the specific primers were used for qPCR reaction to analyze the expression of cyp Transcription levels of genes at various developmental stages of nematodes; (3) Screening out key genes involved in nematode activation and infection through host serum stimulation test and relative transcription level analysis cyp Gene cyp-22A1 , and validate them as intervention targets; (4) Design of Haemonchus contortus cyp-22A1 Gene double-stranded RNA amplification primers, using homologous recombination method to construct interference plasmid L4440- cyp-22A1 , transformed into Escherichia coli HT115 competent cells to obtain interfering engineered bacteria for blocking early infection of animal parasitic nematodes.

7. Use of the interfering engineered bacteria according to any one of claims 1 to 6 in blocking early infection of animal parasitic nematodes.

8. The use according to claim 7, characterized in that: Introduced into the body of infective larvae of nematodes through feeding, it is used to prevent the "spring / perinatal surge" phenomenon of ruminant haemonchus disease caused by the activation of large numbers of infective larvae.

Images