Heat-resistant glucose dehydrogenase mutant and preparation method thereof

Abstract

The present invention discloses thermostable glucose dehydrogenase mutants and methods for preparing them. Specifically, these include five glucose dehydrogenase mutants: E96I, I183V, D255M, E96I / I183V, and E96I / D255M. Enzyme activity assays show that the glucose dehydrogenase mutants provided by the present invention exhibit excellent heat resistance and, after high-temperature treatment, retain higher enzyme activity than the original enzyme. These glucose dehydrogenase mutants are also suitable for establishing NADH and NADPH regeneration systems under high-temperature conditions, providing a new, efficient, and low-cost option for industrial biocatalysis and pharmaceutical applications.

Description

Technical Field

[0001] The invention relates to a glucose dehydrogenase mutant, in particular to a heat-resistant glucose dehydrogenase mutant and a preparation method thereof, and belongs to the field of protein engineering. Background Art

[0002] Glucose dehydrogenase (GDH) is an important oxidoreductase found in Gram-positive and Gram-negative bacteria, including Bacillus amyloidosis, Bacillus subtilis, and Lysinibacillus sphaericus, as well as in plants and mammalian cells. GDH is a tetrameric protein composed of four identical subunits, with an overall fold and oligomeric structure similar to its homologous subunits. GDH participates in a key step in glucose metabolism, catalyzing the oxidation of D-glucose to D-glucono-1,5-lactone and the concomitant reduction of the cofactor NAD(P)+ to NAD(P)H. Consequently, GDH has applications in food processing, pharmaceutical intermediate synthesis, and natural product biosynthesis. Due to its dual cofactor specificity, high activity, ease of preparation, and inexpensive substrates, GDH has been widely used as a biocatalytic coenzyme in industry, particularly in the synthesis of biopharmaceuticals and fine chemicals. However, since many enzymatic reactions rely on cofactors, the high cost of these cofactors can limit the industrial application of biocatalysis. GDH has good activity towards NAD+ and NADP+ and can be used to establish a regeneration system for NADH and NADPH, solving the problems of difficult cofactor recycling and high manufacturing costs in biocatalysis.

[0003] Industrial manufacturing environments are complex and diverse, and some processes require high temperatures. However, high temperatures significantly reduce enzyme activity, leading to low production efficiency and high manufacturing costs. Although GDH from various microorganisms has been used as a coenzyme regenerator in industrial biocatalytic processes, thermostable GDH that can withstand high temperatures remains a goal in enzyme engineering. Heat-resistant GDH has a wider range of applications and can optimize biomanufacturing processes. It is of great significance for establishing efficient and low-cost cofactor regeneration systems and is a more competitive solution for manufacturing products such as pharmaceutical intermediates and chiral chemicals. Summary of the Invention

[0004] Purpose of the invention: The purpose of the present invention is to provide a glucose dehydrogenase mutant that is tolerant to high temperatures, and to provide a nucleic acid molecule encoding the mutant, a vector or recombinant cell or product containing the mutant, and a preparation method and application of the mutant.

[0005] Technical solution: In the first aspect, the present invention provides five glucose dehydrogenase mutants, wherein the amino acid sequence of the glucose dehydrogenase mutant is obtained by mutation of the sequence shown in SEQ ID NO.1, and the mutation is E96I or I183V or D255M or E96I / I183V or E96I / D255M.

[0006] The present invention uses glucose dehydrogenase derived from Lysinibacillus sphaericus as the original enzyme, the amino acid sequence of which is shown in SEQ ID No. 1, and the nucleotide sequence is shown in SEQ ID No. 2. The present invention simulates the single point mutation of the enzyme in the YASARA software, and uses FoldX to calculate its protein folding free energy. After screening, point mutations are performed to finally obtain the glucose dehydrogenase mutant. The present invention uses the standard single letter and standard substitution notation of amino acids: E96I means that glutamic acid (E) at the 96th position of the N-terminus is replaced by isoleucine (I); E96I / I183V means that glutamic acid (E) at the 96th position of the N-terminus is replaced by isoleucine (I), and isoleucine (I) at the 183rd position of the N-terminus is replaced by valine (V).

[0007] In a second aspect, the present invention provides a nucleic acid molecule encoding the glucose dehydrogenase mutant described in the first aspect. The nucleotide sequence of the nucleic acid molecule is obtained by base mutation of the sequence shown in SEQ ID NO. 2.

[0008] In a third aspect, the present invention provides a vector comprising the nucleotide sequence described in the second aspect. The vector may be a cloning vector or an expression vector.

[0009] In a fourth aspect, the present invention provides a recombinant cell comprising the vector described in the third aspect.

[0010] In a fifth aspect, the present invention provides a method for preparing the glucose dehydrogenase mutant described in the first aspect, comprising the following steps: (1) designing point mutation primers, using a plasmid containing the nucleotide sequence of SEQ ID NO.2 as a template, performing a PCR reaction, digesting the template with an endonuclease, and then recombining the digestion product to obtain an expression vector carrying the mutant gene; (2) transferring the expression vector into a host bacterium for fermentation expression; (3) collecting the host bacterium expressing the glucose dehydrogenase mutant, resuspending the bacteria, breaking the cells, and centrifuging to obtain the supernatant to obtain the glucose dehydrogenase mutant.

[0011] In a sixth aspect, the present invention provides a product comprising the glucose dehydrogenase mutant described in the first aspect, the nucleic acid molecule described in the second aspect, the vector described in the third aspect, or the recombinant cell described in the fourth aspect.

[0012] In a seventh aspect, the present invention provides a use of the product of the sixth aspect in catalyzing D-glucose to produce D-glucono-1,5-lactone, wherein the catalysis is accompanied by the reduction of NAD(P)+ to NAD(P)H.

[0013] Beneficial effects: Compared with the existing technology, the present invention has the following significant advantages: 1. The five glucose dehydrogenase mutants provided by the present invention have good heat resistance and still have higher enzyme activity than the original enzyme after high-temperature treatment; 2. The glucose dehydrogenase mutants provided by the present invention are suitable for establishing an NADH and NADPH regeneration system under high-temperature conditions, providing a new high-efficiency and low-cost option for industrial biocatalysis and pharmaceutical applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Schematic diagram of the structure of glucose dehydrogenase used in the present invention;

[0015] Figure 2 NADH-OD 340 Standard curve;

[0016] Figure 3 is the enzymatic activity of glucose dehydrogenase and mutant enzyme after treatment at different temperatures. DETAILED DESCRIPTION

[0017] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0018] Example 1 Thermostable Glucose Dehydrogenase Mutant E96I

[0019] In this example, the 96th glutamic acid in the original enzyme sequence of glucose dehydrogenase as shown in SEQ ID No.1 is mutated to isoleucine; the nucleic acid sequence of the original enzyme of glucose dehydrogenase is shown in SEQ ID No.2, and the structure is shown in Figure 1 The preparation method of mutant E96I is as follows: 1. Constructing a recombinant plasmid; 2. Expressing the enzyme mutant and preparing crude enzyme solution. The specific method is as follows:

[0020] 1. Construction of recombinant plasmid

[0021] Using the pET22b plasmid carrying the original enzyme gene as a template, a plasmid carrying a site-directed mutation gene was constructed by PCR reaction. The template plasmid was digested with DpnI endonuclease, and the digest was subjected to a recombination reaction.

[0022] Plasmids pET-22b and E.coli BL21 (DE3) are both preserved in the applicant's laboratory and are sourced from commercial sources. The original glucose dehydrogenase gene derived from Lysinibacillus sphaericus was synthesized by Jin Weizhi (Suzhou) Company and inserted between the NdeI and XhoI restriction sites of plasmid pET-22b. The primers used to introduce the mutation site are shown in Table 1, the PCR reaction system is shown in Table 2, the template for point mutation PCR is the pET-22b plasmid with the wild-type glucose dehydrogenase gene sequence, and the other components used for point mutation PCR are all from MutUFO Fast Mutagenesis Kit Rapid Mutation Kit (Nanjing Jujiang Biology). Point mutation PCR reaction conditions are shown in Table 3.

[0023] Table 1 Primers for mutant E96I point mutation

[0024] Point mutation primer name Sequence (5'-3') E96I-F GCGGGCATTATTAACCCGGTGGCGAGCCATGAAATG E96I-R CACCGGGTTAATAATGCCCGCGTTGTTAATCATCAC

[0025] Note: "F" in the primer name stands for upstream primer, "R" stands for downstream primer, and the underlined part in the primer sequence is the mutation site.

[0026] Table 2 Point mutation PCR reaction system

[0027] Ingredients volume 2×ProofastMaxMasterMix 12.5μL 10 pmol / μL Forward Primer 1 μL 10 pmol / μL Reverse Primer 1 μL pET22b plasmid carrying the original enzyme gene <50ng <![CDATA[ddH2O]]> up to 25 μL

[0028] Table 3 Point mutation PCR reaction conditions

[0029]

[0030] After PCR, the product contains the original template plasmid and must be digested with DpnI to prevent false positive transformants in subsequent transformations. The digestion reaction system is described in Table 4.

[0031] Table 4 DpnI digestion system

[0032] Ingredients content Point mutation PCR reaction products 25 μl DpnI 1 μl

[0033] The above reaction system was placed in a constant temperature of 37°C for 2 hours.

[0034] After the DpnI digestion reaction was completed, the DpnI digestion product was subjected to a recombination reaction to form a complete circular plasmid. The reaction system was as described in Table 5.

[0035] Table 5 Recombination reaction system

[0036] Ingredients content DpnI digestion products 4 μl 5×UFOBuffer 4 μl UvsXase 2 μl <![CDATA[ddH2O]]> up to 20 μL

[0037] The reaction system was placed in a constant temperature reaction at 37°C for 1 hour. The resulting product was a recombinant plasmid containing the designed point mutation, and the mutation result was confirmed by sequencing by Genwi (Suzhou) Co., Ltd.

[0038] 2. Expressing enzyme mutants and preparing crude enzyme solution

[0039] The recombinant product was transformed into E. coli BL21 (DE3), and IPTG was used to induce the expression of the heterologous protein. The cells were collected by centrifugation of the fermentation broth, and then ultrasonically disrupted and centrifuged again. The supernatant was the crude enzyme solution containing the glucose dehydrogenase mutant.

[0040] The recombinant plasmid was transformed into the E. coli BL21 (DE3) host strain and spread on the surface of LB solid medium (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar powder 15 g / L) containing 100 μg / mL ampicillin and cultured overnight at 37°C. A single E. coli colony was picked and inoculated into 3 mL of LB liquid medium (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L) containing 100 μg / mL ampicillin and cultured at 37°C, 200 rpm in a shaker for 10 h as the fermentation seed liquid. The seed solution was inoculated at 5% to a 250 mL Erlenmeyer flask containing 30 mL of TB medium (11.8 g / L tryptone, 23.6 g / L yeast extract, 9.4 g / L K2HPO4, 2.2 g / L KH2PO4, and 4 mL / L glycerol) and incubated at 37°C in a shaker at 200 rpm. After 6 hours of incubation, IPTG was added to a final concentration of 0.4 mM, and the incubation temperature was set to 24°C for another 18 hours. The fermentation broth was centrifuged at 4000 g for 10 minutes, and the cells were harvested and resuspended in pre-prepared Tris-HCl buffer (pH 8.5). The cells were ultrasonically disrupted for 3-5 minutes until the liquid became slightly clear. The supernatant was then centrifuged at 4000 g for 10 minutes, and the crude enzyme solution of mutant E96I was obtained. The above strain culture and crude enzyme solution preparation experiments were performed in triplicate.

[0041] Example 2 Thermostable Glucose Dehydrogenase Mutant I183V

[0042] In this example, the isoleucine at position 183 of the original glucose dehydrogenase sequence shown in SEQ ID No. 1 was mutated to valine. The primers are shown in Table 6, and the rest of the preparation method is the same as in Example 1.

[0043] Table 6 Primers for mutant I183V point mutation

[0044]

[0045]

[0046] Example 3 Thermostable glucose dehydrogenase mutant D255M

[0047] In this example, the aspartic acid at position 255 of the original glucose dehydrogenase sequence shown in SEQ ID No. 1 was mutated to methionine. The primers are shown in Table 7, and the rest of the preparation method was the same as in Example 1.

[0048] Table 7 Primers for mutant D255M point mutation

[0049] Point mutation primer name Sequence (5'-3') D255M-F GTATCCGATGTTTCAAGCGGGCCGCGGCCTC D255M-R GCTTGAAACATCGGATACAGGGTCATGCCGCC

[0050] Example 4 Thermostable Glucose Dehydrogenase Mutant E96I / I183V

[0051] In this example, the isoleucine at position 183 of glucose dehydrogenase E96I in Example 1 was mutated to valine. The primers are shown in Table 6, and the rest of the preparation method is the same as in Example 1.

[0052] Example 5 Thermostable Glucose Dehydrogenase Mutant E96I / D255M

[0053] In this example, the aspartic acid at position 255 of glucose dehydrogenase E96I in Example 1 was mutated to methionine. The primers are shown in Table 7, and the rest of the preparation method is the same as in Example 1.

[0054] Example 6 Determination of glucose dehydrogenase activity after treatment at different temperatures

[0055] The method in Example 1 was used to express the original glucose dehydrogenase and prepare a crude enzyme solution.

[0056] Based on the principle that glucose dehydrogenase catalyzes the synthesis of gluconic acid and NADH from glucose and NAD+, and the specific absorption of NADH at 340 nm, the enzyme activities of the glucose dehydrogenase mutants of Examples 1-5 and the original glucose dehydrogenase after treatment at different temperatures were measured. Enzyme activity definition: One unit (U) of enzyme activity is defined as 1 nmol of NADH produced per minute per 1 mL of sample. The specific determination method is as follows:

[0057] Prepare 0.50, 0.25, 0.10, 0.05, and 0.00 mM NADH solutions, take 250 μL of each into a clean ELISA plate, measure the absorbance at 340 nm, and draw a standard curve. Figure 2. Add 100μL of 20mM glucose solution, 100μL of 20mM NAD solution, and 50μL of crude enzyme solution to a clean ELISA plate, and quickly measure the absorbance at 340nm. After reacting at 30℃ for 10min, measure the absorbance at 340nm again, and calculate the difference between the two measurements. When the absorbance is greater than 1.5, dilute appropriately and retest. Treat the supernatant of the crude enzyme solution of the original enzyme and the mutant at 30℃, 40℃, 50℃, and 60℃ for 30min, respectively, centrifuge at 4000g for 10min, and take the supernatant to determine the enzyme activity according to the above method.

[0058] The results are as follows Figure 3 As shown in the figure, the enzymatic activities of the five glucose dehydrogenase mutants were all improved compared to the original enzyme after treatment at 30°C, 40°C, 50°C, and 60°C. After treatment at 40°C for 30 minutes, the residual enzyme activity of mutant D255M was 57.4% higher than that of the original enzyme. After treatment at 50°C for 30 minutes, the residual enzyme activity of mutant E96I / I183V was 79.2% higher than that of the original enzyme. After treatment at 60°C for 30 minutes, the enzyme activities of the original enzyme, mutant I183V, and mutant E96I / D255M were lost by over 90%, while mutants E96I, D255M, and E96I / I183V retained high enzyme activities, with residual enzyme activities increased by 23.1-fold, 21.2-fold, and 27.4-fold, respectively, compared to the original enzyme.

Claims

1. A glucose dehydrogenase mutant, characterized in that The amino acid sequence of the glucose dehydrogenase mutant is obtained by mutation of the sequence shown in SEQ ID NO. 1, wherein the mutation is E96I or E96I / I183V or E96I / D255M.

2. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the glucose dehydrogenase mutant according to claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that The nucleotide sequence of the nucleic acid molecule is obtained by base mutation of the sequence shown in SEQ ID NO.

2.

4. A carrier, characterized in that Comprising the nucleotide sequence of claim 3.

5. The carrier according to claim 4, characterized in that The vector is a cloning vector or an expression vector.

6. A recombinant bacterium, characterized in that The recombinant bacterium comprises the vector according to claim 4.

7. A method for preparing the glucose dehydrogenase mutant according to claim 1, characterized in that: The following steps are involved: (1) Designing point mutation primers, using a plasmid containing the nucleotide sequence of SEQ ID NO.2 as a template, conducting a PCR reaction, digesting the template with an endonuclease, and then recombining the digestion product to obtain an expression vector carrying the mutant gene; (2) Transforming the expression vector into a host bacterium for fermentation expression; (3) Collecting the host bacterium, disrupting the cells, and centrifuging to obtain the supernatant to obtain the glucose dehydrogenase mutant.

8. A product, characterized in that The product comprises the glucose dehydrogenase mutant according to claim 1, or the nucleic acid molecule according to any one of claims 2 to 3, or the vector according to claim 4, or the recombinant bacterium according to claim 6.

9. Use of the product according to claim 8 in catalyzing D-glucose to produce D-glucono-1,5-lactone.

10. The application according to claim 9, characterized in that: The catalysis is accompanied by NAD(P) + Reduced to NAD(P)H.

Images