Two plant phosphorus absorption and utilization related proteins as well as coding genes and application thereof

Abstract

The invention relates to the technical field of biology, in particular to application of protein related to plant phosphorus absorption and utilization and a coding gene of the protein to control of plant phosphorus absorption and utilization. According to the present invention, the new functions of the proteins OsRBOD-D and OsRBOD-H and the coding genes OsRBOD-D and OsRBOD-H are found, the partial segment CRISPR / Cas9 recombinant expression vector containing the coding genes is obtained, and the target plant is transformed by using the recombinant vector so as to obtain the transgenic plant with the changed phosphorus absorption and utilization. Therefore, the OsRBOD-D and the OsRBOD-H can be used as potential molecular breeding tools, and the plant yield is increased by improving phosphorus absorption and utilization of plants.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to an application of a protein related to plant phosphorus absorption and utilization and a coding gene thereof in controlling plant phosphorus absorption and utilization. Background Art

[0002] Rice (Oryza sativa) is one of the most important food crops in the world, feeding more than half of the world's population (Guo Tao et al. 2019), and the absorption and utilization of phosphorus (P) limits the growth and yield of rice (Neumannet et al. 2012). However, as the main form of phosphorus absorbed and utilized by plants, inorganic phosphate (Pi) easily forms precipitation with organic matter or mineral cations in the soil, resulting in extremely low free Pi content in the soil (Kirkby 2012). Therefore, in agricultural production, rice yield is generally increased by increasing the application of phosphorus fertilizer (Foley et al. 2011). However, excessive application of phosphorus fertilizer will not only reduce the absorption and utilization rate of phosphorus by rice and increase agricultural costs, but also cause environmental problems such as soil acidification and eutrophication of water bodies. [5] Therefore, a deeper understanding of the transduction and regulatory pathways of phosphorus signaling and phosphorus homeostasis in rice, analysis of its molecular mechanism, and breeding new rice varieties with high phosphorus efficiency and high yield on this basis are of great significance to ensuring food security, reducing agricultural costs, and achieving sustainable agricultural development.

[0003] As a reactive oxygen species, H2O2 has unique physical properties (long half-life, 10 -3 Seconds) and chemical properties (rapid and reversible oxidation of target proteins) can act as signal molecules, affecting the growth and development of various intracellular signal-regulated organisms (García-Santamarina et al. 2012). Studies have shown that H2O2 plays an important role in regulating plant growth and development and responses to adversities (pathogen infection, inflammation, high salt, drought, low temperature, etc.) (Mittler et al. 2017; García-Santamarina et al. 2017; Hossain et al. 2015; Tian et al. 2018; Liu et al. 2022). As the main producer of H2O2 in plants, it is still unclear whether respiratory burst oxidase homologues (RBOH) mediate H2O2 signals to regulate plant phosphorus absorption and utilization. Therefore, the isolation and identification of respiratory burst oxidase RBOH that can mediate H2O2 regulation of plant phosphorus absorption and utilization is of great significance to our understanding of improving plant phosphorus absorption and utilization.

[0004] The references mentioned above are as follows:

[0005] Guo Tao, Yu Hong, Qiu Jie, Li Jiayang, Han Bin, Lin Hongxuan. (2019) Research progress of rice genetics and molecular design breeding in China. Science China: Life Sciences, 49, 1185-1212.

[0006] Foley JA, Ramankutty N, Brauman KA et al. (2011) Solutions for acultivated planet. Nature 478, 337-42.

[0007] García-Santamarina S, Boronat S, Hidalgo E. (2014) Reversible cysteine ​​oxidation in hydrogen peroxide sensing and signal transduction. Biochemistry 53, 2560-25680.

[0008] Hossain MA, Bhattacharjee S, Armin SM et al. (2015) Hydrogen peroxide priming modulates abiotic oxidative stress tolerance: insights from ROS detoxification and scavenging. Front Plant Sci 16, 6: 420.

[0009] Kirkby, E. (2012). Introduction, definition and classification of nutrients. In Marschner's Mineral Nutrition of Higher Plants, 3rd edn, H. Marschner, ed. (London: Academic Press), pp. 3–5.

[0010] Liu WC, Song RF, Qiu YM et al. (2022) Sulfenylation of ENOLASE2 facilitates H2O2-conferred freezing tolerance in Arabidopsis. Dev Cell 57, 1883-1898. (Liu WC, Song RF, Qiu YM et al. (2022) Sulfenylation of ENOLASE2 facilitates H2O2-conferred freezing tolerance in Arabidopsis. Developmental Cell 57, 1883-1898).

[0011] Mittler R. (2017) ROS Are Good. Trends Plant Sci. 22, 11-19.

[0012] Neumann, G., and R€omheld, V. (2012). Rhizosphere chemistry in relation to plant nutrition. In Marschner's Mineral Nutrition of Higher Plants, 3rd edn, H. Marschner, ed. (London: Academic Press), pp. 347–368.

[0013] Tian Y, Fan M, Qin Z et al. (2018) Hydrogen peroxide positively regulates brassinosteroid signaling through oxidation of the BRASSINAZOLE-RESISTANT1 transcription factor. Nat Commun 9: 1063.

[0014] Yuan HM, Liu WC, Lu YT. (2017) CATALASE2 Coordinates SA-Mediated Repression of Both Auxin Accumulation and JA Biosynthesis in Plant Defenses. Cell Host Microbe 21, 143-155. Summary of the invention

[0015] The technical problem to be solved by the present invention is to provide a protein related to regulating plant phosphorus absorption and utilization, a coding gene and an application thereof.

[0016] In order to solve the above technical problems, the protein (OsRBOH-D and OsRBOH-H) provided by the present invention is from Oryza sativa L.ssp.japonicacv.Xiushui134, which is the following protein (a) or (b):

[0017] (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 in the sequence listing;

[0018] (b) a protein of SEQ ID NO: 1 in which one or more amino acid residues are replaced and / or deleted and / or added and a protein derived therefrom that is related to phosphorus absorption and utilization by plants; the plant development is reflected in traits such as phosphorus absorption and utilization by plants.

[0019] In order to facilitate the purification of OsRBOH-D and OsRBOH-H in (a), a tag including but not limited to those shown in Table 1 may be connected to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 in the sequence listing.

[0020] Table 1. Sequences of tags

[0021] Label Residue sequence Po1y-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHQ c-myc 10 EQKLISEEDL

[0022] The OsRBOH-D and OsRBOH-H in (b) above can be synthesized artificially, or their coding genes can be synthesized first and then expressed biologically. The coding genes of OsRBOH-D and OsRBOH-H in (b) above can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in sequence 3 or sequence 4 in the sequence table, and / or performing missense mutation of one or several base pairs, and / or connecting the coding sequence of the tag shown in Table 1 to its 5' end and / or 3' end.

[0023] The coding gene of the protein also belongs to the protection scope of the present invention.

[0024] The coding genes of the proteins (OsRBOH-D and OsRBOH-H) can be DNA molecules of 1) or 2) or 3) or 4) as follows:

[0025] 1) Its coding sequence is a DNA molecule shown in SEQ ID NO:3 or SEQ ID NO:4 in the sequence listing;

[0026] 2) a DNA molecule shown in SEQ ID NO: 5 or SEQ ID NO: 6 in the sequence listing;

[0027] 3) a DNA molecule that hybridizes with the DNA sequence defined in 1) or 2) under stringent conditions and encodes a protein with the same function;

[0028] 4) A DNA molecule that has more than 90% homology with the DNA sequence defined in 1) or 2) or 3) and encodes a protein with the same function.

[0029] The recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria containing the gene or its antisense gene all fall within the protection scope of the present invention.

[0030] Existing plant expression vectors can be used to construct recombinant expression vectors containing OsRBOH-D and OsRBOH-H genes.

[0031] The plant expression vector includes, but is not limited to, binary Agrobacterium vectors and vectors that can be used for plant microprojectile bombardment. The plant expression vector may also contain the 3' non-translated region of the foreign gene, i.e., a polyadenylic acid signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylic acid signal can guide the addition of polyadenylic acid to the 3' end of the mRNA precursor, including but not limited to the non-translated region transcribed at the 3' end of Agrobacterium crown gall induction (Ti) plasmid genes (such as rouge synthase Nos gene) and plant genes (such as soybean storage protein gene), all of which have similar functions.

[0032] In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used may be processed, such as adding genes including but not limited to enzymes or luminescent compounds that can be expressed in plants (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin marker, kanamycin marker, etc.) or chemical agent resistance marker genes (such as herbicide resistance genes), etc. Considering the safety of transgenic plants, no selective marker genes may be added, and transformed plants may be directly screened by adversity.

[0033] The recombinant expression vector may be any of the following:

[0034] (I) According to the g-RNA requirements in CRISPR / Cas9, primers were searched and designed in the gene DNA sequence shown in SEQ ID NO: 3 in the sequence table, connected to the pYLgRNA-OsU3 intermediate vector, and then inserted into the plasmid pYLCRISPR / Cas9-MH to obtain the recombinant expression vector CRISPR-OsRBOH-D;

[0035] (II) According to the g-RNA requirements of CRISPR / Cas9, primers were searched and designed in the gene DNA sequence shown in SEQ ID NO:4 in the sequence list, connected to the pYLgRNA-OsU3 intermediate vector, and inserted into the plasmid pYLCRISPR / Cas9-MH to obtain the recombinant expression vector CRISPR-OsRBOH-H;

[0036] (III) According to the g-RNA requirements in CRISPR / Cas9, primers were searched and designed in the gene DNA sequences shown in SEQ ID NO:3 and SEQ ID NO:4 in the sequence list, and the primers were connected to the intermediate vectors pYLgRNA-OsU3 and pYLgRNA-OsU6a, and then inserted into the plasmid pYLCRISPR / Cas9-MH to obtain the recombinant expression vector CRISPR-OsRBOH-D / H;

[0037] Note: The plasmids pYLCRISPR / Cas9-MH, pYLgRNA-OsU3 and pYLgRNA-OsU6a in (I) or (II) or (II) were all donated to our laboratory by Professor Liu Yaoguang of South China Agricultural University.

[0038] The present invention also provides the application of respiratory burst oxidase encoding gene RBOH-D or H in rice phosphorus absorption and utilization: regulating the expression amount of RBOH-D and / or H to control the phosphorus absorption and utilization of rice.

[0039] As an improvement of the application of the present invention: after knocking out RBOH-D and / or H, the absorption and utilization of phosphorus by rice will be significantly reduced.

[0040] By using any vector that can guide the expression of exogenous genes in plants, the OsRBOH-D and OsRBOH-H genes or gene fragments provided by the present invention are introduced into plant cells by constructing a CRISPR vector, and transgenic cell lines and transgenic plants that absorb and utilize phosphorus can be obtained. The CRISPR expression vector carrying the OsRBOH-D and OsRBOH-H genes can be transformed into plant cells or tissues by conventional biological methods including but not limited to the use of Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, etc., and the transformed plant tissues are cultivated into plants. The transformed plant host can be a grass plant, such as rice (specifically, Xiushui 134).

[0041] When cultivating transgenic plants whose phosphorus absorption and utilization is lower than that of the target plants; the method is to introduce the recombinant expression vectors of (I), (II) and (III) into the target plants to obtain transgenic plants with reduced phosphorus absorption and utilization.

[0042] The present invention discovered new functions of proteins OsRBOH-D and OsRBOH-H and their encoding genes OsRBOH-D and OsRBOH-H, and obtained a CRISPR / Cas9 recombinant expression vector containing a partial fragment of the encoding gene. By transforming the target plant with the recombinant vector, a transgenic plant with altered phosphorus absorption and utilization can be obtained. Therefore, OsRBOH-D and OsRBOH-H can be used as a potential molecular breeding tool to increase plant yield by improving plant phosphorus absorption and utilization. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0044] Figure 1 The exogenous application in Example 1 promotes the absorption and utilization of phosphorus by rice;

[0045] Figure 1 middle:

[0046] A is the H2O2 content in the aboveground part and root of 7-day-old wild-type XS134 plants treated with high phosphorus (200 μM KH2PO4) and low phosphorus (10 μM KH2PO4) hydroponic conditions 2 days after treatment; the values ​​are expressed as mean ± SD (the number of statistical samples is equal to 5), ***P < 0.001 (T test);

[0047] B shows the phenotype of wild-type plants of XS134 treated with 1 mM H2O2 or 10 μM KI for 28 days under high-phosphorus and low-phosphorus hydroponic conditions (scale bar is 10 cm); C, D, and E are the total biomass (dry weight) (C), the available phosphorus concentration in the aboveground part (D), and the available phosphorus concentration in the root (E) of the corresponding plants in Figure B. The values ​​are expressed as mean ± error value SD (the number of samples counted in Figure C is equal to 3, and the number of samples counted in Figures D and E is equal to 5), ***P<0.001 (T test).

[0048] Figure 2 The transcription level of rice OsRBOH gene family under low phosphorus treatment in Example 2; the values ​​are expressed as mean ± SD (the statistical samples are derived from 3 independent biological replicates).

[0049] Figure 3 Creation and identification of rice mutants rboh-D, rboh-H, and rboh-DH in Example 2; A and B are schematic diagrams of the gene structures of genes OsRBOH-D (A) and OsRBOH-D (B) and CRISPR / Cas9 target sites, respectively; exons and introns are represented by rectangles (coding sequences are represented by black rectangles) and lines, respectively. CRISPR / Cas9 target sites are marked with black capital letters. The numbers below the target sequence indicate the distance from the start codon (ATG, from 5' to 3'). The stop codon (TAA or TAG) is indicated; C and D are the alignments of mutant sequences in mutants rboh-D (C), rboh-H (C), and rboh-DH (C and D), respectively; the wild-type XS134 sequence is shown at the top, the target sequence is blue, and the PAM sequence is red; nucleotide deletions are represented by black hyphens, and the numbers of deletions or insertions are shown on the right.

[0050] Figure 4Phenotypic analysis of rboh-D, rboh-H, and rboh-DH transgenic plants in Example 2; A and B are high phosphorus (200 μM KH2PO4) and low phosphorus (10 μM Figure 3. H2O2 contents in the upper part (A) and roots (B) of 7-day-old wild-type XS134 plants, rboh-D, rboh-H, and rboh-DH mutant plants treated with KH2PO4 hydroponic conditions 2 days after seedlings were grown; values ​​are expressed as mean ± SD (the number of samples counted is 5), ***P < 0.001 (T test); C shows the phenotypes of wild-type XS134 plants, rboh-D, rboh-H, and rboh-DH mutant plants 28 days after cultivation under high-P and low-P hydroponic conditions (scale bar is 10 cm); D, E, and F are the total biomass (dry weight) (D), the available phosphorus concentration in the aboveground part (E), and the available phosphorus concentration in the roots (F) of the corresponding plants in Figure C, respectively; values ​​are expressed as mean ± SD (the number of samples counted in Figure C is 3, and the number of samples counted in Figures D and E is 5), ***P < 0.001 (T test). DETAILED DESCRIPTION

[0051] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0052] The composition of the hydroponic culture medium is shown in Table 2 (Yoshida et al., 1976, Laboratory Manual for Physiological Studies of Rice, Ed 3. The International Rice Research Institute: The Philippines):

[0053] Table 2

[0054]

[0055]

[0056] In the gene expression detection results in the following examples, unless otherwise specified, the target gene expression level of the wild-type XS134 plant is taken as 1, and the target gene expression levels of other plants are compared with the target gene expression level of the wild-type plant.

[0057] Example 1

[0058] 1. Exogenous application of H2O2 promotes the absorption and utilization of phosphorus in rice.

[0059] The wild-type japonica rice variety Xiushui 134 (XS134) with a seedling age of 7 days was used as the material. After being hydroponically cultured for 7 days under high phosphorus (200 μM KH2PO4) and low phosphorus (10 μM KH2PO4) conditions (12 hours during the day at 30°C, 12 hours at night at 22°C, and a light intensity of 200 μmol m -2 s -1 , humidity 60%), and detected the H2O2 content in the aboveground part and roots. It was found that low phosphorus treatment promoted the accumulation of H2O2 in the aboveground part and roots of rice (see Figure 1 A).

[0060] The wild-type japonica rice variety Xiushui 134 (XS134) with a seedling age of 7 days was used as the material, and cultured under high-phosphorus and low-phosphorus hydroponic conditions, respectively, after being treated with different concentrations of H2O2 or H2O2 inhibitor KI (culture conditions are the same as above). The details are as follows:

[0061] Experiment 1: Set up the following high phosphorus experimental groups:

[0062] Control: hydroponics with 200 μM KH2PO4;

[0063] H2O2: 200μM KH2PO4+1mM H2O2 in hydroponics;

[0064] KI: 200μM KH2PO4+10μM KI in hydroponics.

[0065] Experiment 2: Set up the following low-phosphorus experimental groups:

[0066] Control: hydroponics with 10 μM KH2PO4;

[0067] H2O2: 10μM KH2PO4+1mM H2O2 hydroponics;

[0068] KI: 10μM KH2PO4+10μM KI in hydroponics.

[0069] After 28 days of cultivation, the biomass of rice and the concentration of available phosphorus in the roots and aboveground parts were counted. It was found that compared with the control, the biomass of wild-type XS134 plants increased and the concentration of available phosphorus in the aboveground and root tissues increased after exogenous application of H2O2; however, after exogenous application of KI, the biomass of XS134 plants decreased and the concentration of available phosphorus in the aboveground and root tissues decreased compared with the wild-type plants (see Figure 1 BE).

[0070] 2. Response of transcriptional levels of the rice OsRBOH gene family to low phosphorus

[0071] Seven-day-old wild-type XS134 plants were used as materials and cultured under high-phosphorus and low-phosphorus hydroponic conditions for specific periods of time (e.g. Figure 2 The culture conditions are the same as above; specifically as follows:

[0072] High phosphorus (control group): 200 μM KH2PO4 hydroponics;

[0073] Low phosphorus (experimental group): 10 μM KH2PO4 hydroponics;

[0074] Total RNA was extracted from root tissue and reverse transcribed to obtain the corresponding cDNA. Real-time quantitative PCR was used to detect and determine its expression level. OsACTIN1 was used as an internal reference gene. The specific data processing method is as follows:

[0075] By comparing the target gene Ct (Ct target) with its own internal reference Ct value (Ct internal reference), the ΔCt of each group can be obtained, and then the experimental group and the control group are calculated to obtain ΔΔCt. The size of ΔΔCt is related to the fold difference of the target gene expression level. The fold difference = 2 –ΔΔCt

[0076] Target gene experimental group (Ct) – reference gene experimental group (Ct) = experimental group (ΔCt)

[0077] Target gene control group (Ct) – reference gene control group (Ct) = control group (ΔCt)

[0078] Experimental group (ΔCt)–control group (ΔCt) = ΔΔCt;

[0079] The results showed that OsRBOH-D and OsRBOH-H could be induced to express at a high level by low phosphorus (see Figure 2 ). This suggests that OsRBOH-D and OsRBOH-H may be involved in the phosphorus starvation signal of rice, so OsRBOH-D and OsRBOH-H were selected for follow-up research.

[0080] Figure 2 middle:

[0081] OsRBOH-A represents the rice respiratory burst oxidase encoding gene RBOH-A

[0082] OsRBOH-B represents the rice respiratory burst oxidase encoding gene RBOH-B

[0083] OsRBOH-C stands for rice respiratory burst oxidase encoding gene RBOH-C

[0084] OsRBOH-D represents the rice respiratory burst oxidase encoding gene RBOH-D

[0085] OsRBOH-E represents the rice respiratory burst oxidase encoding gene RBOH-E

[0086] OsRBOH-F represents the rice respiratory burst oxidase encoding gene RBOH-F

[0087] OsRBOH-G represents the rice respiratory burst oxidase encoding gene RBOH-G

[0088] OsRBOH-H represents the rice respiratory burst oxidase encoding gene RBOH-H

[0089] OsRBOH-I represents the rice respiratory burst oxidase encoding gene RBOH-I.

[0090] Example 2. Obtaining OsRBOH-D and OsRBOH-H Transgenic Rice Materials

[0091] 1. Construction of CRISPR-OsRBOH-D recombinant vector

[0092] According to the g-RNA requirements in CRISPR / Cas9, the PAM sequence of CRISPR / Cas9 was found in the gene DNA sequence shown in SEQ ID NO: 3 in the sequence list, 5'-AGTTCGGATCAGGATGGCGG GGG -3' (the underline indicates the PAM sequence of CRISPR / Cas9); and design primers:

[0093] F 5'-GGCAGTTCGGATCAGGATGGCGG-3'

[0094] R 5'-AAACCCGCCATCCTGATCCGAAC-3'

[0095] After primer annealing (90°C, 2 minutes), connect to pYLgRNA-OsU3 vector cut with restriction endonuclease BsaI (37°C for 20 minutes). The connection system is:

[0096]

[0097] The connection was allowed to proceed at room temperature (25°C) for about 10-15 minutes.

[0098] After the connection is completed, use this as a template and use a high-fidelity enzyme to perform the first round of PCR reaction. The primer sequences are:

[0099] F 5'-CTCCGTTTTACCTGTGGAATCG-3'

[0100] R 5'-CGGAGGAAAATTCCATCCAC-3'

[0101] The PCR system is:

[0102]

[0103] The PCR program is:

[0104]

[0105] After amplification, 1 μl of the product was diluted 10 times with H2O and used as a template. A second round of PCR reaction was performed using a high-fidelity enzyme, and the primer sequence was

[0106] F 5'-TTCAGAGGTCTCTCTCGACTAGTGGAATCGGGCAGCAAAGG-3'

[0107] R 5'-AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC-3'

[0108] The PCR system and procedure were the same as above.

[0109] After PCR was completed, gel electrophoresis was performed, and the target band (SEQ ID NO: 3 in the sequence table) was recovered by cutting the gel. Finally, it was inserted into the plasmid pYLCRISPR / Cas9-MH by the cutting and ligation method to obtain the recombinant expression vector CRISPR-OsRBOH-D, which was sequenced and verified to be correct (i.e., the sequence 5'-CTCCGTTTTACCTGTGGAATCG-3' could be detected).

[0110] The steps of cutting and connecting are:

[0111]

[0112] After 10 minutes of enzyme digestion at 37°C, add the ligation system

[0113] T4 ligase 1μl

[0114] 10×T4 ligase Buffer 1.5μl

[0115] Carry out the following reaction

[0116]

[0117] 2. Construction of CRISPR-OsRBOH-H recombinant vector

[0118] According to the g-RNA requirements in CRISPR / Cas9, the PAM sequence of CRISPR / Cas9 was found in the gene DNA sequence shown in SEQ ID NO: 4 in the sequence list, 5'-ATTACCGGAGCTCGGACAGC AGG-3' (the underline indicates the PAM sequence of CRISPR / Cas9); and design primers:

[0119] F 5'-GGCATTACCGGAGCTCGGACAGC-3'

[0120] R 5'-AAACGCTGTCCGAGCTCCGGTAA-3'

[0121] After the primers were annealed (90°C, 2 minutes), they were connected to the pYLgRNA-OsU3 vector cut with restriction endonuclease BsaI (37°C, 20 minutes) according to the corresponding steps of the above-mentioned "Construction of CRISPR-OsRBOH-D recombinant vector".

[0122] The ligation system and ligation process parameters were the same as those described in “Construction of CRISPR-OsRBOH-D recombinant vector”.

[0123] After the connection is completed, use this as a template, use a high-fidelity enzyme, and refer to the system and procedure of the first round of PCR reaction in the above "Construction of CRISPR-OsRBOH-D recombinant vector" for amplification. After the amplification is completed, take 1μl of the product and dilute it 10 times with H2O as a template. Refer to the second round of PCR reaction system and procedure of the above "Construction of CRISPR-OsRBOH-D recombinant vector" for amplification. After the amplification is completed, perform gel electrophoresis and cut the gel to recover the target band. Finally, insert it into the plasmid pYLCRISPR / Cas9-MH through the above cutting and connecting method to obtain the recombinant expression vector CRISPR-OsRBOH-H, which is correct after sequencing verification.

[0124] 3. Construction of CRISPR-OsRBOH-DH recombinant vector

[0125] According to the g-RNA requirements in CRISPR / Cas9, the PAM sequence of CRISPR / Cas9 was found in the gene DNA sequence shown in SEQ ID NO: 3 in the sequence list, 5'-AGTTCGGATCAGGATGGCGG GGG -3' (the underline indicates the PAM sequence of CRISPR / Cas9); and design primers

[0126] F 5'-GGCAGTTCGGATCAGGATGGCGG-3'

[0127] R 5'-AAACCCGCCATCCTGATCCGAAC-3'

[0128] After the primers were annealed (90°C, 2 minutes), they were connected to the pYLgRNA-OsU3 vector cut with restriction endonuclease BsaI (37°C, 20 minutes) according to the corresponding steps of the above-mentioned "Construction of CRISPR-OsRBOH-D recombinant vector".

[0129] Then search for the PAM sequence of CRISPR / Cas9 in the gene DNA sequence shown in SEQ ID NO: 4 in the sequence list, 5'-ATTACCGGAGCTCGGACAGC AGG -3' (the underline indicates the PAM sequence of CRISPR / Cas9); and design primers

[0130] F 5'-GCCGATTACCGGAGCTCGGACAGC-3'

[0131] R 5'-AAACGCTGTCCGAGCTCCGGTAA-3'

[0132] After the primers were annealed (90°C, 2 minutes), they were connected to the pYLgRNA-OsU6a vector cut with restriction endonuclease BsaI (37°C, 20 minutes) according to the corresponding steps of the "Construction of CRISPR-OsRBOH-D recombinant vector" mentioned above.

[0133] After the connection is completed, pYLgRNA-OsU3 and RNA-OsU6a are used as templates, and high-fidelity enzymes are used to amplify them respectively, referring to the first round PCR reaction system and procedures of the above-mentioned "Construction of CRISPR-OsRBOH-D recombinant vector". After the amplification is completed, 1μl of the product is diluted 10 times with H2O and used as a template. Refer to the second round PCR reaction system and procedures of the above-mentioned "Construction of CRISPR-OsRBOH-D recombinant vector" for amplification. The primers using pYLgRNA-OsU3 as a template are

[0134] F 5'-TTCAGAGGTCTCTCTCGACTAGTGGAATCGGGCAGCAAAGG-3'

[0135] R 5'-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3'

[0136] The primers for pYLgRNA-OsU6a as template were

[0137] F 5'-TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3'

[0138] R 5'-AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC-3'

[0139] After PCR was completed, gel electrophoresis was performed and the target band was recovered by cutting the gel. Finally, it was inserted into the plasmid pYLCRISPR / Cas9-MH by cutting and ligating, and the recombinant expression vector CRISPR-OsRBOD / H was obtained, which was verified to be correct by sequencing.

[0140] IV. Obtaining rboh-D, rboh-H, and rboh-DH transgenic rice

[0141] The vectors constructed in steps 1, 2, and 3 were respectively transferred into Agrobacterium EHA105 for transformation of Xiushui 134 rice. The specific steps are as follows:

[0142] (1) Take 500 μl of the cultured bacterial solution in a 1.5 ml centrifuge tube, centrifuge at room temperature, 4000 rpm for 2 minutes, and remove the supernatant. Use 30 ml of AAM bacterial solution containing 200 μmol / L acetosyringone to make a suspension. The final concentration of the bacterial solution is OD 600 is 0.01; 80 to 120 rice calli that have grown to a certain size are picked out, put into the Agrobacterium suspension, and shaken on a horizontal shaker for 5 minutes;

[0143] (2) Remove the callus tissue and place it on sterile filter paper to drain for 30 to 40 minutes;

[0144] (3) Place the callus on a co-culture medium with a piece of sterile filter paper and culture in the dark at 25°C for 3 days;

[0145] (4) The callus tissue was removed and washed with sterile water for 5 to 6 times, with constant shaking. Washed twice with sterile water containing 300 mg / L carbenicillin sodium (Carb), shaking on a horizontal shaker for 30 minutes each time. Finally, placed on sterile filter paper to drain for 2 hours;

[0146] (5) The dried callus was transferred to a selection medium containing 300 mg / L carbenicillin sodium and the corresponding selection pressure for the first round of selection at 28°C under light for 14 days;

[0147] (6) The initial callus with resistant callus was transferred to a medium containing 300 mg / L carbenicillin sodium and corresponding selection pressure for a second round of selection, and cultured at 28°C under light until granular resistant callus tissue grew (about 14 days);

[0148] (7) Pick 3 to 5 bright yellow resistant calli from different calli, transfer them into a plastic wide-mouth bottle containing differentiation medium, seal it with a sealing film, and place it in a constant temperature (25°C) culture room (photoperiod: 16 hours of light), and wait for differentiation into seedlings (about 40 days);

[0149] (8) When the seedlings grow to about 3 cm, use scissors to cut off the old roots and callus tissue from the base of the seedlings, and place them in the rooting medium to strengthen the seedlings (about 1 week). Pick out the test tubes with relatively well-differentiated roots, stems and leaves (open the lid in time when the seedlings grow to the top of the test tube), open the sealing film, add an appropriate amount of distilled water or sterile water (to prevent bacteria from growing in the culture medium), harden the seedlings for 2 to 3 days, then wash off the agar and transplant them to the hydroponic conditions of the greenhouse for growth.

[0150] The CRISPR-OsRBOH-D recombinant vector corresponds to the rboh-D transgenic rice;

[0151] The CRISPR-OsRBOH-H recombinant vector corresponds to the rboh-H transgenic rice;

[0152] The CRISPR-OsRBOH-DH recombinant vector corresponds to rboh-DH transgenic rice.

[0153] The universal primers of CRISPR vector were used for PCR detection of transgenic plants. The primer sequences are as follows:

[0154] F 5'-GCGCGGTGTCATCTATGTTACTA-3';

[0155] R 5'-CCCGACATAGATGCAATAACTTC-3',

[0156] Then, PCR was performed using gene-specific primers and the products were sequenced to identify the mutation sites.

[0157] The specific primers for identification of OsRBOH-D are:

[0158] F 5'-AGTGTAGTCAGGTAAATAAAT-3';

[0159] R 5'-AGAATATTCGTAGTCGTGAAT-3',

[0160] The specific primers for identification of OsRBOH-D are:

[0161] F 5'-AGCTCACCTCTGAAAATTCCT-3';

[0162] R 5'-AGAAAGTCTGCAGCTTGGCAT-3'.

[0163] The results showed that the corresponding sites in rboh-D, rboh-H and rboh-DH mutants were mutated (see Figure 3 ).

[0164] The nucleotide sequence of rboh-D is CCGACACTGAAGCTGAAGCGG, the nucleotide sequence of rboh-H is ATTACCGGAGCTCGGCACAGCAGG, and the nucleotide sequence of rboh-DH is CCGA-AGCTGAAGCGG and ATTACCTCGGACAGCAGG.

[0165] 5. Phenotypic analysis of phosphorus absorption and utilization of rboh-D, rboh-H, and rboh-DH.

[0166] The wild-type XS134 plants, rboh-D, rboh-H and rboh-DH mutants at 7 days old were used as materials. After being hydroponically cultured for 7 days under high phosphorus (200 μM KH2PO4 control group) and low phosphorus (10 μM KH2PO4) conditions, the H2O2 content in the shoots and roots was detected. It was found that compared with the wild-type XS134, the low phosphorus-induced H2O2 accumulation was significantly inhibited in the rboh-D, rboh-H mutants, especially the rboh-DH mutant (see Figure 4 AB).

[0167] The 7-day-old wild-type XS134 plants, rboh-D, rboh-H and rboh-DH mutants were used as materials. The biomass of rice and the concentration of available phosphorus in the roots and aboveground parts were counted after 28 days of cultivation under high-phosphorus and low-phosphorus hydroponic conditions. It was found that compared with the wild-type XS134, the biomass of rboh-D, rboh-H mutants, especially the rboh-DH mutant, was reduced, and the concentration of available phosphorus in the aboveground and root tissues was reduced (see Figure 4 CF).

[0168] Based on the above results, the present invention found through physiological experiments that exogenous application of H2O2 can improve the absorption and utilization of phosphorus in rice. Molecular detection experiments show that the expression of the respiratory burst oxidase encoding gene RBOH-D / H is induced to be highly expressed by low phosphorus. Genetic experiments show that after knocking out RBOH-D / H, the absorption and utilization of phosphorus by rice will be significantly reduced. These results show that RBOH-D / H plays an important role in the absorption and utilization of phosphorus by rice, and the absorption and utilization of phosphorus by rice can be controlled by regulating the expression of RBOH-D / H.

[0169] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above examples, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. A protein, characterized in that A protein which is (a) or (b) as follows: (a) the amino acid sequence is as shown in SEQ ID NO: 1 or SEQ ID NO: 2; (b) A protein derived from a protein described in SEQ ID NO:1 or SEQ ID NO:2, wherein one or more amino acid residues are replaced and / or deleted and / or added, and the protein is related to plant development; the plant development is reflected in the trait of phosphorus absorption and utilization.

2. The respiratory burst oxidase encoding gene RBOH-D or H encoded by the protein as claimed in claim 1.

3. The gene according to claim 2, characterized in that : The coding gene of the protein is a DNA molecule as follows 1) or 2) or 3) or 4): 1) The coding sequence is a DNA molecule shown in SEQ ID NO: 3 or SEQ ID NO: 4; 2) a DNA molecule represented by SEQ ID NO:5 or SEQ ID NO:6; 3) a DNA molecule that hybridizes with the DNA sequence defined in 1) or 2) under stringent conditions and encodes a protein with the same function; 4) A DNA molecule that has more than 70% homology with the DNA sequence defined in 1) or 2) or 3) and encodes a protein with the same function.

4. A recombinant expression vector, expression cassette, transgenic cell line or recombinant bacterium containing the gene or antisense gene of claim 2 or 3.

5. The recombinant expression vector according to claim 4, characterized in that: The recombinant expression vector is any of the following: (I) According to the g-RNA requirements in CRISPR-Cas9, primers were searched and designed in the DNA sequence of the gene shown in SEQ ID NO: 3, connected to the pYLgRNA-OsU3 intermediate vector, and inserted into the plasmid pYLCRISPR / Cas9-MH to obtain the recombinant expression vector CRISPR-OsRBOH-D; (II) According to the g-RNA requirements of CRISPR-Cas9, primers were searched and designed in the DNA sequence of the gene shown in SEQ ID NO: 4, connected to the pYLgRNA-OsU3 intermediate vector, and inserted into the plasmid pYLCRISPR / Cas9-MH to obtain the recombinant expression vector CRISPR-OsRBOH-H; (III) According to the g-RNA requirements in CRISPR-Cas9, primers were searched and designed in the gene DNA sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4, and the primers were connected to the intermediate vectors pYLgRNA-OsU3 and pYLgRNA-OsU6a, and then inserted into the plasmid pYLCRISPR / Cas9-MH to obtain the recombinant expression vector CRISPR-OsRBOH-D / H.

6. Application of respiratory burst oxidase encoding gene RBOH-D or H in phosphorus absorption and utilization of rice, characterized in that: Regulating the expression of RBOH-D and / or H controls phosphorus absorption and utilization in rice.

7. The use according to claim 6, characterized in that: After knocking out RBOH-D and / or H, the absorption and utilization of phosphorus by rice will be significantly reduced.

8. A method for cultivating transgenic plants, characterized in that: The recombinant expression vector of claim 5 is introduced into a target plant to obtain a transgenic plant; the transgenic plant is a transgenic plant whose phosphorus absorption and utilization is changed compared with the target plant.

9. The method for cultivating transgenic plants according to claim 8, characterized in that: The recombinant expression vector CRISPR-OsRBOH-D, the recombinant expression vector CRISPR-OsRBOH-H, and the recombinant expression vector CRISPR-OsRBOH-D / H are introduced into the target plants to obtain transgenic plants with reduced phosphorus absorption and utilization.

10. The method for cultivating transgenic plants according to claim 9, characterized in that: The plant is rice; the rice is the wild japonica rice variety Xiushui 134.

Images