Application of CircZC3H11A in promoting myogenic differentiation of bovine skeletal muscle cells

Abstract

The invention belongs to the technical field of molecular breeding of livestock, and discloses application of circZC3H11A in promoting myogenic differentiation of bovine skeletal muscle satellite cells, and the nucleotide sequence of the circZC3H11A is shown as SEQ ID NO.1. The invention further discloses a preparation method of the circZC3H11A. The invention discloses that circZC3H11A of cattle has a function of promoting myogenic differentiation of cattle skeletal muscle satellite cells for the first time. The invention lays a theoretical basis for understanding the effect of circRNA in regulating and controlling cell differentiation, provides a new theoretical basis for the application of circZC3H11A in improving beef quality, and provides a theoretical basis for circZC3H11A as a new target in beef cattle biological breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of livestock molecular breeding, and in particular to an application of CircZC3H11A in promoting myogenic differentiation of bovine skeletal muscle cells. Background Art

[0002] In my country, the growth of beef consumption has driven its proportion in the meat consumption structure to rise, and the market demand for beef is growing. Despite this, domestic beef cattle production cannot meet this huge market demand, resulting in dependence on beef imports. In order to solve this contradiction between supply and demand, it has become a top priority to accelerate the increase in beef cattle meat production. This has prompted animal husbandry researchers to devote themselves to the breeding research of excellent beef cattle breeds. Skeletal muscle cells play an important role in promoting animal muscle regeneration. Muscle development is an extremely complex and precise process, which is the result of the interaction between genetics and the environment. Skeletal muscle growth and development, as a decisive factor in the quality of animal meat production, is closely related to the quality of beef cattle. The regulation of its growth is a highly coordinated complex biological process under the influence of multiple factors. Finding the key regulatory factors can provide new technical directions for beef cattle breeding. Circular RNA (circRNA), as a new type of non-coding RNA, has received extensive research attention in recent years. Studies have shown that circRNA plays an important role in biological processes such as cell differentiation, but its research on the regulation of cattle muscle development is still in its infancy. At present, the circRNA gene library for cattle is still incomplete, and the functions and regulatory mechanisms of many circRNAs have yet to be revealed. In the early stage of the laboratory, a functional circRNA expressed in muscle, namely circZC3H11A, was identified, and circZC3H11A was found to be significantly expressed during the differentiation period of cattle skeletal muscle, so it was selected as a potential regulatory factor for subsequent research. The present invention determines circZC3H11A and its effects on the proliferation and differentiation of cattle muscle satellite cells, uses it as a molecular target in beef cattle breeding, and performs molecular screening on fetal cattle to obtain fetal cattle with excellent developmental potential. It can also be used as a gene editing target to interfere with or overexpress circZC3H11A at different stages of cattle muscle development, or to construct gene-edited cattle in vitro to obtain excellent trait breed cattle for later breeding. By treating circZC3H11A, the specific weight of cattle muscle can be greatly increased, its feeding value and economic value can be increased, and it is also convenient for animal husbandry personnel to eliminate fetal cattle with low production performance during the embryonic period, save breeding costs, and obtain higher economic benefits. In addition, studying the effect of circZC3H11A on bovine skeletal muscle cells can also lay a theoretical foundation for understanding the role of circRNA in regulating cell differentiation and provide a theoretical basis for using circZC3H11A as a new target in beef cattle breeding. Summary of the invention

[0003] The purpose of the present invention is to overcome the deficiencies in the prior art and provide an application of CircZC3H11A in promoting myogenic differentiation of bovine skeletal muscle cells.

[0004] The technical solution adopted by the present invention to solve its technical problem is:

[0005] Application of circZC3H11A in promoting myogenic differentiation of bovine skeletal muscle satellite cells, wherein the nucleotide sequence of circZC3H11A is shown in SEQ ID NO.1.

[0006] Use of a plasmid containing circZC3H11A in promoting myogenic differentiation of skeletal muscle cells, wherein the nucleotide sequence of circZC3H11A is shown in SEQ ID NO.1.

[0007] Application of a plasmid containing circZC3H11A and a siRNA fragment of circZC3H11A in myogenic differentiation of bovine skeletal muscle cells, wherein the nucleotide sequence of circZC3H11A is shown in SEQ ID NO.1.

[0008] Furthermore, the skeletal muscle cells are bovine skeletal muscle cells.

[0009] Application of circZC3H11A in promoting bovine muscle development, the nucleotide sequence of circZC3H11A is shown in SEQ ID NO.1.

[0010] The interference fragment of circZC3H11A, i.e., the siRNA fragment and the overexpression vector are used in bovine muscle development. The nucleotide sequence of circZC3H11A is shown in SEQ ID NO.1.

[0011] Use of a plasmid containing circZC3H11A in promoting bovine muscle development, wherein the nucleotide sequence of circZC3H11A is shown in SEQ ID NO.1.

[0012] Use of circZC3H11A and / or a plasmid containing circZC3H11A in molecular breeding of beef cattle, wherein the nucleotide sequence of circZC3H11A is shown in SEQ ID NO.1.

[0013] Furthermore, the circZC3H11A is derived from the ZC3H11A gene of bovine chromosome 16, consists of two exons, is 320 nt in length, and its nucleotide sequence is shown in SED ID NO.1; RNase R tolerance analysis shows that the circZC3H11A has the general characteristics of a circular molecule and is not easily degraded by RNase R. This proves that the circZC3H11A of the present invention is indeed a circular RNA;

[0014] Alternatively, overexpression of circZC3H11A promoted the proliferation of bovine skeletal muscle cells and inhibited myogenic differentiation.

[0015] The advantages and positive effects achieved by the present invention are:

[0016] 1. The present invention discovered and cloned a circular RNA circZC3H11A related to its muscle development from the muscle tissue of MSTN knocked out Luxi yellow cattle. By using the circZC3H11A, by increasing the expression of circZC3H11A in cattle skeletal muscle cells, the proliferation of cattle skeletal muscle cells can be promoted and the differentiation of cattle skeletal muscle satellite cells can be inhibited. By reducing the expression of circZC3H11A in cattle skeletal muscle cells, the proliferation of cattle skeletal muscle satellite cells can be inhibited and the myogenic differentiation of cattle skeletal muscle cells can be promoted. The present invention not only provides the application of circular RNA circZC3H11A in promoting myogenic differentiation of cattle skeletal muscle cells, but also provides a method for promoting myogenic differentiation of cattle skeletal muscle cells, which not only helps the myogenic differentiation culture of cattle skeletal muscle cells, but also helps the in vitro study of cattle skeletal muscle development-related genes and the molecular breeding of beef cattle.

[0017] 2. The present invention discloses for the first time that circZC3H11A of cattle has the function of promoting myogenic differentiation of cattle skeletal muscle satellite cells. The present invention lays a theoretical foundation for understanding the role of circRNA in regulating cell differentiation, provides a new theoretical basis for the application of circZC3H11A in improving beef quality, and provides a theoretical basis for circZC3H11A as a new target in beef cattle biological breeding.

[0018] 3. The present invention found that overexpression or silencing of circZC3H11A in bovine skeletal muscle cells can significantly change the proliferation marker genes and differentiation marker genes of skeletal muscle cells by transfecting circZC3H11A overexpression vectors and siRNA fragments in bovine skeletal muscle cells. The change results show that overexpression or silencing of circZC3H11A can regulate the myogenic differentiation of skeletal muscle. Therefore, the circZC3H11A of the present invention can be used to promote the myogenic differentiation of bovine skeletal muscle cells, and the plasmid of circZC3H11A and the siRNA fragment of circZC3H11A can also be used to regulate the myogenic differentiation of bovine skeletal muscle cells.

[0019] 4. The present invention draws a temporal expression map of circZC3H11A in bovine skeletal muscle cells, and determines that circZC3H11A mainly plays a role in promoting the differentiation period of bovine skeletal muscle cells; in addition, it is experimentally determined that overexpression of circZC3H11A in bovine skeletal muscle cells in a proliferative state can promote the proliferation of bovine skeletal muscle cells, and silencing of circZC3H11A can inhibit the proliferation of bovine skeletal muscle cells; if the cells are induced to differentiate in vitro when the cell adhesion density is 80% to 90%, so that the bovine skeletal muscle cells are in a differentiated state, then overexpression of circZC3H11A can inhibit the differentiation of skeletal muscle cells, and silencing of circZC3H11A can promote the differentiation of skeletal muscle cells.

[0020] In view of the fact that silencing circZC3H11A in the present invention can promote myogenic differentiation of bovine skeletal muscle cells, and bovine skeletal muscle cells are an important component of muscle. Therefore, the circZC3H11A of the present invention can be used to promote bovine muscle development. The siRNA fragment and plasmid of circZC3H11A can be used in regulating bovine muscle development, and the siRNA fragment and plasmid of circZC3H11A can also be used in molecular breeding of beef cattle. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 These are microscopic photographs of bovine skeletal muscle cells isolated and cultured in Example 1 of the present invention at different stages;

[0022] Figure 2 Figure 1 is a graph showing the authenticity verification and nuclear-cytoplasmic separation experimental results of circZC3H11A in the present invention; Figure A shows the expression level of circZC3H11A in cDNA and gDNA after RNase R treatment; Figure B shows the cyclization site confirmed by Sanger sequencing; Figure C shows the temporal expression map of circZC3H11A; Figure D shows the nuclear-cytoplasmic localization results of circZC3H11A;

[0023] Figure 3 Figure 1 is the effect of silencing circZC3H11A on the proliferation phase of bovine skeletal muscle cells in the present invention; wherein, Figure A is the interference effect of circZC3H11A; Figure B is the expression level of mRNA of cell proliferation marker factors after interference with circZC3H11A; Figure C is the expression level of protein of cell proliferation marker genes after interference with circZC3H11A; Figure D is the Western blot quantification result; Figure E is EdU staining of bovine skeletal muscle cells after interference with circZC3H11A in the GM phase (100×); Figure F is the EdU labeling index, expressed as the number of positive cell nuclei / total number of cell nuclei;

[0024] Figure 4Figure 1 is a graph showing the effect of silencing circZC3H11A on the differentiation period of bovine skeletal muscle cells in the present invention; Figure A shows the mRNA expression level of cell differentiation marker factors after interfering with circZC3H11A; Figure B shows the protein expression level of cell differentiation marker genes after interfering with circZC3H11A; Figure C shows the Western blot quantification result;

[0025] Figure 5 Figure 1 is a graph showing the effect of overexpression of circZC3H11A on the differentiation stage of bovine skeletal muscle cells in the present invention; wherein, Figure A shows the effect of overexpression of circZC3H11A; Figure B shows the mRNA expression level of cell proliferation marker factors after overexpression of circZC3H11A; Figure C shows the protein expression level of cell proliferation marker genes after overexpression of circZC3H11A; Figure D shows the results of Western blot quantification; Figure E shows EdU staining of bovine skeletal muscle cells after overexpression of circZC3H11A in the GM stage (100×); Figure F shows the EdU labeling index, expressed as the number of positive cell nuclei / total number of cell nuclei;

[0026] Figure 6 Figure 1 is a graph showing the effect of overexpression of circZC3H11A on the differentiation period of bovine skeletal muscle cells in the present invention; Figure A shows the mRNA expression level of cell differentiation marker factors after overexpression of circZC3H11A; Figure B shows the protein expression level of cell differentiation marker genes after overexpression of circZC3H11A; Figure C shows the Western blot quantification result;

[0027] Figure 7 This is the plasmid map of the circZC3H11A overexpression vector in the present invention. DETAILED DESCRIPTION

[0028] The present invention will be further described below in conjunction with the embodiments. The following embodiments are descriptive rather than restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0029] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0030] Application of circZC3H11A in promoting myogenic differentiation of bovine skeletal muscle satellite cells, wherein the nucleotide sequence of circZC3H11A is shown in SEQ ID NO.1.

[0031] Use of a plasmid containing circZC3H11A in promoting myogenic differentiation of skeletal muscle cells, wherein the nucleotide sequence of circZC3H11A is shown in SEQ ID NO.1.

[0032] Application of a plasmid containing circZC3H11A and a siRNA fragment of circZC3H11A in myogenic differentiation of bovine skeletal muscle cells, wherein the nucleotide sequence of circZC3H11A is shown in SEQ ID NO.1.

[0033] Preferably, the skeletal muscle cells are bovine skeletal muscle cells.

[0034] Application of circZC3H11A in promoting bovine muscle development, the nucleotide sequence of circZC3H11A is shown in SEQ ID NO.1.

[0035] The interference fragment of circZC3H11A, i.e., the siRNA fragment and the overexpression vector are used in bovine muscle development. The nucleotide sequence of circZC3H11A is shown in SEQ ID NO.1.

[0036] Use of a plasmid containing circZC3H11A in promoting bovine muscle development, wherein the nucleotide sequence of circZC3H11A is shown in SEQ ID NO.1.

[0037] Use of circZC3H11A and / or a plasmid containing circZC3H11A in molecular breeding of beef cattle, wherein the nucleotide sequence of circZC3H11A is shown in SEQ ID NO.1.

[0038] Preferably, the circZC3H11A is derived from the ZC3H11A gene of bovine chromosome 16, consists of two exons, is 320 nt in length, and its nucleotide sequence is shown in SED ID NO.1; RNase R tolerance analysis shows that the circZC3H11A has the general characteristics of a circular molecule and is not easily degraded by RNase R. This proves that the circZC3H11A of the present invention is indeed a circular RNA;

[0039] Alternatively, overexpression of circZC3H11A promoted the proliferation of bovine skeletal muscle cells and inhibited myogenic differentiation.

[0040] Specifically, the relevant preparation and detection are as follows:

[0041] Main reagents: DMEM high glucose medium (Hyclone, USA), fetal bovine serum (FBS) and pregnant mare serum (HS) (Gibco, USA), penicillin-streptomycin double antibody solution (Gibco, USA), PBS solution (Solarbio, Beijing), pancreatin (Solarbio, Beijing), Opti- Medium (Gibco, USA), 3000 Reagent (Invitrogen, USA), EZNATM PF Micro RNA Kit (Omega, USA), EASYspin Plus Tissue / Cell RNA Rapid Extraction Kit (Aidlab, Beijing), PrimeScript II 1st Strand cDNA Synthesis Kit (Takara, Dalian), HiFiScript Cdna Synthesis Kit (Cellular Biotechnology), 2×Super Pfx MasterMix (Cellular Biotechnology), High-efficiency RIPA Tissue / Cell Rapid Lysis Buffer (Solarbio, Beijing), All-in-OneTM miRNAqRT-PCR Detection Kit (GeneCopoeia, USA), CCK-8 Cell Proliferation Detection Reagent (Hanheng Biotechnology), EDU (Ruibo Biotechnology), RNase (Guangzhou Jisai Biotechnology), RNase-Free H2O (Cellular Biotechnology).

[0042] Example 1 Recovery, culture, passage and differentiation induction of bovine skeletal muscle cells

[0043] To prevent cell contamination, the entire experiment needs to be carried out under sterile conditions. The proliferation medium is 10% FBS + 1% penicillin-streptomycin double antibody solution + 89% DMEM, and the differentiation medium is 1% HS + 1% penicillin-streptomycin double antibody solution + 98% DMEM.

[0044] (1) Thaw the cells taken out of the liquid nitrogen tank in a 37°C water bath. The thawing process requires small and rapid shaking. After the cells are thawed, an equal volume of proliferation medium must be quickly added to the cryopreservation tube to neutralize them.

[0045] (2) Transfer the mixed solution to a centrifuge tube and centrifuge at 1000 rpm / min for 10 min. Discard the supernatant. At this point, the cells are all deposited at the bottom of the centrifuge tube.

[0046] (3) Resuspend the cells in 3 mL of proliferation medium preheated at 37°C, pipette and mix thoroughly, transfer to a 60 mm cell culture dish, and culture in a 37°C 5% CO2 cell culture incubator.

[0047] (4) When the cell confluence reaches 75%-80%, discard the proliferation medium, slowly wash the cells with preheated sterile PBS, and then add 3 mL of preheated differentiation medium to induce cell differentiation.

[0048] The cell inoculation area can be set according to the cell quantity required for subsequent experiments, and proliferation culture can be carried out in different cell well plates.

[0049] Microscopic photographs of bovine skeletal muscle cells isolated and cultured in this example at different stages are shown in the figure below. Figure 1 As shown by Figure 1 It can be seen that the isolated bovine skeletal muscle cells can differentiate and fuse to form myotubes after induction, indicating that the isolated primary cells are skeletal muscle cells and can be directed to differentiate and be used to establish an in vitro skeletal muscle induced differentiation model for in vitro research.

[0050] Example 2 Authenticity verification and nuclear-cytoplasmic separation experiment of circZC3H11A

[0051] The circZC3H11A described in the present invention is derived from the ZC3H11A gene of bovine chromosome 16, consists of two exons, is 320 nt in length, and its nucleotide sequence is shown as follows (SED ID NO.1):

[0052] GATTAACATTTAAAAGACGATTTCTGTGATTGACTTGTCTTTTGGAAGATTAAACCCATAT

[0053] CAAGAGGACTTGGAGCTGGTCCTCGCCTAGAGGAAGCAGTGGCTTGTTTTCAAAAAGC

[0054] CACTTCTCATCTAAGGATCTACTCAGCATGCCTAATCAAGGAGAAGACTGCTATTTTTTTT

[0055] TCTATTCTACTTGTACTAAAGGTGACAGCTGTCCATTCCGTCACTGTGAAGCTGCACTGG

[0056] GAAATGAAACTGTTTGCACATTATGGCAAGAAGGGCGCTGTTTTCGACAGGTGTGCAGG

[0057] TTTCGGCACATGGAGATTGAT

[0058] 1. RNase R digestion of linear RNA

[0059] Linear RNA was digested with RNase R to determine the specific circular structure of RNA. The reaction procedure of circRNA digestion experiment is shown in Table 1:

[0060] Table 1 circZC3H11A restriction enzyme system

[0061]

[0062] 2. Nuclear-cytoplasmic separation experiment

[0063] Use the NE-PER Nuclear and Cytoplasmic Extraction Reagents Kit to extract nuclear and cytoplasmic RNA from cell RNA respectively. The specific steps are as follows:

[0064] (1) Digest the cells cultured to the DM3 stage with trypsin and transfer them to a centrifuge tube. After centrifugation, collect the precipitated cells, resuspend them in pre-cooled sterile PBS, and then count the cells.

[0065] (2) When the number reaches 1-10×10^6 cells, centrifuge at 500×g at 4°C for 3 min and collect the cell pellet.

[0066] (3) Add 4°C precooled CER I containing RNase Inhibitor, shake for 15 seconds, and place on ice for 10 minutes.

[0067] (4) Add pre-cooled CER II, shake for 5 seconds, place on ice for 1 minute, shake for another 5 seconds, and centrifuge at 16,000 × g at 4°C for 5 minutes.

[0068] (5) Collect the supernatant and add 350 μL of lysis buffer RLTPlus.

[0069] (6) Wash 2-3 times with pre-cooled PBS and add 350 μL of lysis buffer RLTPlus.

[0070] 3. Detection of the expression characteristics of circZC3H11A - Extraction of total RNA from bovine skeletal muscle cells

[0071] The total RNA of cells was extracted according to the instructions of EZNATM PF MIC Meat RNA Kit. The extraction process is as follows:

[0072] (1) Aspirate the cell culture medium in the cell culture dish, wash with pre-cooled enzyme-free PBS, and add RNA-Solv Reagent to lyse the cells. Add as needed based on the amount of RNA-Solv Reagent that can lyse 10^7 cells per mL.

[0073] (2) Place the lysed cells at room temperature for 2-3 minutes, add chloroform to the lysate, oscillate and mix for 15 seconds, then place on ice for 10 minutes. Add 200uL of chloroform per 1mL of RNA-Solv Reagent as needed.

[0074] (3) Centrifuge at 4°C, 12,000 rpm / min for 15 min, transfer 80% of the aqueous phase solution to a 2 mL enzyme-free centrifuge tube, and add 1.5 times the volume of anhydrous ethanol to the solution, and mix by pipetting.

[0075] (4) Transfer the mixed solution to a HiBind RNA Mini column in a collection tube and centrifuge at 10,000 rpm / min for 60 seconds before discarding the solution.

[0076] (5) Add 500uL RWB Wash Buffer to the HiBindRNA Mini column after centrifugation and centrifuge at 10000rpm / min for 60s before discarding. Repeat this operation once.

[0077] (6) 12000 rpm / min, idling for 5-10 min.

[0078] (7) Place the HiBindRNAMini column into a 1.5 mL enzyme-free tube, add 40-50 μL of DEPC Water preheated at 70°C, place at room temperature for 5 minutes, and centrifuge at maximum speed for 1 minute. Elution can be performed twice.

[0079] (8) Aliquot 4-5uL of the eluate for concentration measurement and quality inspection.

[0080] 4. Synthesis of the first strand of cDNA and real-time fluorescence quantitative PCR

[0081] The first strand of cDNA was synthesized using the PrimeScript II 1st Strand cDNA Synthesis Kit as follows:

[0082] (1) The mRNA reverse transcription cDNA synthesis reaction procedure is:

[0083] A. Prepare the reaction system according to Table 2 and place it in a PCR instrument at 65°C for 5 minutes, followed by an ice bath for 3 minutes.

[0084] Table 2 cDNA first-strand reaction system

[0085]

[0086] B. Prepare reaction system 2 according to Table 3 and conduct PCR amplification experiment. The reaction conditions are 10 min at 30°C, 1 h at 42°C, and 5 min at 95°C. Store in a -20°C refrigerator.

[0087] Table 3 cDNA first chain reaction system

[0088]

[0089] (2) Real-time fluorescence quantitative PCR (qRT-PCR) was performed using All-in-One™ qPCR Mix. qRT-PCR (primers used are detailed in Appendix 1), the reaction system is as shown in Table 4 below:

[0090] Table 4 qRT-PCR reaction system

[0091]

[0092] The qRT-PC reaction procedure is shown in Table 5:

[0093] Table 5 qRT-PCR reaction system

[0094]

[0095] The results of RNase R treatment of circZC3H11A in this example are as follows Figure 2 As shown in A, the results show that circZC3H11A can resist RNase R digestion, which is different from linear ZC3H11A, proving that its molecule is a stable circular structure. The results of the nuclear-cytoplasmic separation experiment of circZC3H11A are shown in Figure 2 As shown in B, the experimental results show that it is mainly located in the cytoplasm, and it is speculated that it may play a biological role by competitively adsorbing miRNA. Figure 2 As shown in C, the results showed that the expression level of circZC3H11A gradually increased with the growth of bovine skeletal muscle cells, and the expression levels in DM1, DM2, and DM3 were significantly different, and the expression level was highest in DM3.

[0096] Example 3 Construction of circZC3H11A overexpression vector Figure 7 shown.

[0097] Example 4 Effect of overexpression of circZC3H11A on myogenic differentiation of bovine skeletal muscle cells

[0098] 1. Transfection of Bovine Skeletal Muscle Cells

[0099] First, observe whether the cell density of cultured bovine skeletal muscle cells reaches about 70-80% before transfection. Take 1 well of a 6-well plate as an example, and each group has three biological replicates. The transfection process is as follows:

[0100] (1) Dilute LIP 3000 and si-circZC3H11A / si-NC or DNA / Vector respectively with Opti serum-free medium, as follows:

[0101] 1) A.94ul opti+6μL lip3000

[0102] B.90μL opti+10μL si-circZC3H11A / si-NC

[0103] 2) A.94ul opti+6μL lip3000

[0104] B.94μL opti+1μP3000+2000μg DNA / Vector

[0105] (2) After dilution according to the ratio in (1), incubate at room temperature for 5 min. Mix tubes A and B by pipetting and incubate at room temperature for 15 min.

[0106] (3) First, aspirate and discard the original culture medium in the cell culture dish, and then add 200 μL of transfection reagent to each well.

[0107] 2. Extraction of total RNA from bovine skeletal muscle cells is the same as above

[0108] 3. Synthesis of the first strand of cDNA and real-time fluorescence quantitative PCR

[0109] The implementation steps are the same as above, and the information of all gene primers tested is shown in Table 6 below.

[0110] Table 6 qRT-PCR primers

[0111]

[0112] 4. Extraction of Total Protein from Bovine Skeletal Muscle Cells

[0113] 1) The experiment usually uses 6-well plates to culture cells to extract total protein from cells. High-efficiency RIPA tissue / cell rapid lysis buffer and PMSF solution are mixed at a volume ratio of 100:1 in the dark, 200uL of the mixture is added to each well, and the mixture is lysed on ice for 10 minutes and then collected.

[0114] 2) After centrifugation at 4°C, 12,000 rpm / min for 10 min, collect the supernatant and aliquot 10 uL for BCA determination of protein concentration.

[0115] 3) After the protein concentration is determined by the BCA kit, the protein is denatured according to the calculated data and used for Western blot test.

[0116] 5.Western blot

[0117] 1) Prepare the glue. Clean the glass plate and the rack used in the test in advance and dry them. Prepare the lower layer of glue according to the concentration of the glue in the kit instructions, inject it into the seam of the glass plate and wait for it to solidify. After injecting the prepared upper layer of glue, immediately insert the comb and wait for it to solidify and then remove the comb. Spot the sample according to the experimental design, the marker volume is 3uL, and the protein sample volume is 15μL.

[0118] 2) Electrophoresis: 80V for 30min to run the upper separation gel, then 120V for 45min to complete the electrophoresis.

[0119] 3) Electrotransfer: Use a scraper to cut the target gel band appropriately and keep it. Make the filter paper slightly larger than the lower gel with the target band, and the PVDF membrane slightly larger than the filter paper, and then prepare a "sandwich" in a white porcelain plate filled with electrotransfer solution. Run at 300mA for 90 minutes.

[0120] 4) Blocking: Take out the membrane after electroporation, mark the front and back, and put it into a plate. Pour TBST containing 5% milk powder and block it on a shaker for 2 hours.

[0121] 5) Incubate the primary antibody, gently pour off the milk powder, and wash the blocked PVD membrane with TBST on a shaker for 3 times for 10 minutes each time. Prepare a hybridization bag of appropriate size, seal the membrane and the primary antibody diluted in proportion, and incubate overnight in a 4°C refrigerator.

[0122] 6) Incubate with secondary antibody, remove the membrane and place on a shaker, wash with TBST for 10 min, 3 times. Dilute the secondary antibody, incubate on a shaker for 1 hour, and wash 3 times.

[0123] 7) Exposure: evenly drop the luminescent liquid prepared in a 1:1 ratio onto the PVDF membrane, and store the image after exposure.

[0124] 6. EDU

[0125] During subculturing, cells were seeded into 96-well plates and four biological replicates were set. When cells were in the proliferation phase, experimental operations were performed according to the instructions of the EdU kit, and 100 μL PBS was retained in each well for light-proof photography.

[0126] 8. Statistical Analysis

[0127] qRT-PCR results were analyzed by 2 -△△CtMethods The relative expression levels of genes were calculated (GAPDH was the internal reference gene); the chi-square test was used to analyze the EdU and immunofluorescence labeling indexes; Image Lab software was used to quantify the Western blot results, and t-test was used to analyze the significance of differences with GAPDH or Tubulin as the internal reference. The results are expressed as "mean ± standard error", "*" indicates significant difference (P<0.05), "**" indicates extremely significant difference (P<0.01), and "ns" indicates no significant difference.

[0128] In this example, siRNA fragments and si-NC fragments were transfected and RNA was extracted from the GM phase. The silencing effect of circZC3H11A was detected by qRT-PCR. The results showed that the expression level of circZC3H11A after silencing was significantly lower than that of the control group (NC) (P < 0.01) ( Figure 3 A), indicating that circZC3H11A was successfully silenced. Based on the successful silencing of circZC3H11A, qRT-PCR was used to detect the changes in the mRNA expression levels of four known proliferation markers (CyclinD1, Pax7, Ki-67, and PCNA). The experimental results showed that after silencing circZC3H11A, the expression level of Pax7 mRNA level was extremely significantly downregulated (P < 0.01), the expression level of CyclinD1 mRNA level was significantly downregulated (P < 0.05), while the mRNA expression levels of proliferation markers Ki-67 and PCNA did not change significantly (P > 0.05) ( Figure 3 B). At the same time, the expression of the proliferation marker Pax7 was detected in the GM phase of bovine skeletal muscle cells treated with circZC3H11A silencing. The results showed that the expression of Pax7 was significantly reduced after silencing circZC3H11A compared with the NC group (P<0.05)( Figure 3 C, 3D). At the same time, the EDU cell proliferation experiment was conducted, and the experimental results showed that the positive cells in the circZC3H11A overexpression group were significantly reduced compared with the NC group ( Figure 3 E), EDU quantification results showed that the labeling index of the circZC3H11A overexpression group was significantly reduced (P < 0.05) ( Figure 3 F).

[0129] Furthermore, the siRNA fragments and si-NC fragments were transfected to induce differentiation in vitro to the DM2 stage and RNA was extracted. The changes in the expression levels of the three known differentiation markers MyHC, MyOG and MyOD at the mRNA level were detected by qRT-PCR. The experimental results showed that after silencing circZC3H11A, the expression levels of the bovine skeletal muscle cell differentiation markers MyHC, MyOD and MyOG at the mRNA level were significantly upregulated (P < 0.05) ( Figure 4 A). At the protein level, Western blot assay showed that after silencing circZC3H11A, the protein expression levels of MyHC and MyOG, the differentiation markers of bovine skeletal muscle cells, were different. The expression of MyOG at the protein level was significantly upregulated (P < 0.01), while the expression of MyHC at the protein level did not change significantly (P > 0.05) ( Figure 4 B and 4C).

[0130] The experimental group and control group were transfected with pcDNA3.1(+)CircRNAMini Vector-circZC3H11A vector and pcDNA3.1(+)CircRNA Mini Vecto, respectively, and RNA was extracted from the GM phase. The overexpression effect of circZC3H11A was detected by qRT-PCR. The results showed that the expression level of circZC3H11A after overexpression was significantly increased compared with the control group (NC) (P < 0.01) ( Figure 5 A), indicating that circZC3H11A was successfully overexpressed. Based on the successful overexpression of circZC3H11A, qRT-PCR was used to detect the changes in the mRNA expression of four known proliferation markers (CyclinD1, Pax7, Ki-67, and PCNA). The experimental results showed that after overexpression of circZC3H11A, the mRNA expression levels of CyclinD1 and Ki-67 were significantly upregulated (P < 0.05), while the mRNA expression levels of proliferation markers Pax7 and PCNA did not change significantly (P > 0.05) ( Figure 5 B). At the same time, the expression of the proliferation marker Pax7 was detected in the GM phase of bovine skeletal muscle cells overexpressing circZC3H11A. The results showed that the expression of Pax7 was significantly increased after overexpression of circZC3H11A compared with the NC group (P<0.05) ( Figure 5 C, 3D). At the same time, the EDU cell proliferation experiment was conducted, and the experimental results showed that the positive cells in the circZC3H11A overexpression group increased significantly compared with the NC group ( Figure 5 E), EDU quantification results showed that the labeling index of the circZC3H11A overexpression group was significantly increased (P < 0.01) ( Figure 5 F).

[0131] Furthermore, the cells were transfected with pcDNA3.1(+)CircRNA Mini Vector-circZC3H11A and pcDNA3.1(+)CircRNAMini Vecto, respectively, and then induced to differentiate in vitro to the DM2 stage and RNA was extracted. The expression levels of three known differentiation markers, MyHC, MyOG and MyOD, were detected by qRT-PCR. The experimental results showed that the expression level of the bovine skeletal muscle cell differentiation marker MyHC at the mRNA level was significantly downregulated after overexpression of circZC3H11A (P < 0.05), and the expression levels of MyOG and MyOD at the mRNA level did not change significantly (P > 0.05) ( Figure 6 A). At the protein level, Western blot assay showed that after silencing circZC3H11A, the protein expression levels of MyHC and MyOG, the differentiation markers of bovine skeletal muscle cells, were different. The expression of MyHC at the protein level was significantly downregulated (P < 0.01), while the expression of MyOG at the protein level did not change significantly (P > 0.05) ( Figure 4 B and 4C).

[0132] The above results indicate that overexpression of circZC3H11A can promote the proliferation of bovine skeletal muscle cells and inhibit myogenic differentiation.

[0133] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. Application of circZC3H11A in promoting myogenic differentiation of bovine skeletal muscle satellite cells, characterized in that: The nucleotide sequence of circZC3H11A is shown in SEQ ID NO.

1.

2. Use of a plasmid containing circZC3H11A in promoting myogenic differentiation of skeletal muscle cells, characterized in that: The nucleotide sequence of circZC3H11A is shown in SEQ ID NO.

1.

3. Use of a plasmid containing circZC3H11A and a siRNA fragment of circZC3H11A in myogenic differentiation of bovine skeletal muscle cells, characterized in that: The nucleotide sequence of circZC3H11A is shown in SEQ ID NO.

1.

4. The use according to any one of claims 1 to 3, characterized in that: The skeletal muscle cells are bovine skeletal muscle cells.

5. Application of circZC3H11A in promoting cattle muscle development, characterized in that: The nucleotide sequence of circZC3H11A is shown in SEQ ID NO.

1.

6. Application of the interference fragment of circZC3H11A, i.e., siRNA fragment and overexpression vector in bovine muscle development, characterized in that: The nucleotide sequence of circZC3H11A is shown in SEQ ID NO.

1.

7. Use of a plasmid containing circZC3H11A in promoting bovine muscle development, characterized in that: The nucleotide sequence of circZC3H11A is shown in SEQ ID NO.

1.

8. Use of circZC3H11A and / or a plasmid containing circZC3H11A in molecular breeding of beef cattle, characterized in that: The nucleotide sequence of circZC3H11A is shown in SEQ ID NO.

1.

9. The use according to any one of claims 1 to 8, characterized in that: The circZC3H11A is derived from the ZC3H11A gene of bovine chromosome 16, consists of two exons, is 320 nt in length, and its nucleotide sequence is shown in SED ID NO.1; RNase R tolerance analysis shows that the circZC3H11A has the general characteristics of a circular molecule and is not easily degraded by RNaseR. This proves that the circZC3H11A of the present invention is indeed a circular RNA; Alternatively, overexpression of circZC3H11A promoted the proliferation of bovine skeletal muscle cells and inhibited myogenic differentiation.

Images