Starch synthesis regulatory gene osmfp1, its encoded protein and application thereof
By identifying the rice OsMFP1 protein and constructing a deletion mutant, we studied its role in starch synthesis, solved the problem of insufficient regulation of rice starch synthesis, increased the starch content of rice grains, and improved rice yield and quality.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-25
- Publication Date
- 2026-03-17
AI Technical Summary
There is a lack of research on key regulatory proteins in rice starch synthesis in existing technologies, which affects the improvement of rice yield and quality.
We identified and studied OsMFP1, a thylakoid-associated MAR-binding protein in rice, and its encoded protein. We constructed an OsMFP1 deletion mutant using CRISPR-Cas9 technology and investigated its function and mechanism of action in starch synthesis.
The discovery that loss of function of the OsMFP1 gene leads to a decrease in starch content in rice grains, affecting rice yield and quality, provides a theoretical basis for improving rice yield and quality.
Smart Images

Figure CN119193606B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of plant genetic engineering, and particularly relates to a starch synthesis regulation gene OsMFP1, an encoded protein thereof and application. BACKGROUND
[0002] Rice is an important food crop, and more than half of the world's population relies on rice as their staple food. With the development of social economy and the change of people's dietary structure, the demand for rice yield increases, and higher requirements for its quality are put forward. Starch, as an important component of rice grains, its content and structure affect the yield and quality of rice. Although there are many reports on the synthesis pathway and transcriptional regulation of starch, there are few reports on the key regulatory proteins of starch synthesis.
[0003] At present, in Arabidopsis, it has been found that the thylakoid-associated MAR-binding filamentous protein is involved in the initiation of starch granules in leaves, but the function and mechanism of the protein in rice are still unclear. Based on the above research status, the application provides a starch synthesis regulation gene OsMFP1, an encoded protein thereof and application. SUMMARY
[0004] The purpose of the application is to provide a starch synthesis regulation gene OsMFP1, an encoded protein thereof and application to solve the above problems.
[0005] The application achieves the above purpose through the following technical solutions.
[0006] The application provides a starch synthesis regulation gene OsMFP1, which has a nucleotide sequence as shown in SEQ ID NO. 1.
[0007] The application also provides a protein encoded by the gene OsMFP1, which has an amino acid sequence as shown in SEQ ID NO. 2.
[0008] The application also provides an application of the gene OsMFP1 in regulating the synthesis of starch in rice grains.
[0009] Specifically, starch is total starch, amylose and amylopectin in rice grains.
[0010] Specifically, the gene OsMFP1 has a positive regulation effect on the synthesis of starch in rice grains.
[0011] Specifically, the loss of function of the gene OsMFP1 leads to a decrease in the content of total starch, amylose and amylopectin in rice grains.
[0012] The application also provides an application of the gene OsMFP1 in regulating the yield of rice.
[0013] Specifically, the gene OsMFP1 plays a positive regulatory role in rice yield.
[0014] Specifically, loss of function of the OsMFP1 gene leads to reduced rice yield.
[0015] The beneficial effects of this invention are as follows:
[0016] This invention identified a thylakoid-associated MAR filament-binding protein in rice, named OsMFP1. Using CRISPR-Cas9 technology, knockout mutant rice plants were obtained, and its function and mechanism of action in starch synthesis were investigated. The results showed that the loss of function of the OsMFP1 gene advanced the heading time of rice and led to a decrease in the number of tillers. The morphology of starch granules in rice grains and the chain length distribution of amylopectin in the endosperm were also affected by the loss of function of the OsMFP1 gene. The regulatory effect of the loss of function of the OsMFP1 gene on starch synthesis in rice grains manifested as a decrease in the content of total starch, amylose, and amylopectin, and an increase in the content of soluble and reducing sugars. These findings provide important theoretical value for improving rice yield and quality. Attached Figure Description
[0017] Figure 1 Tissue expression pattern of OsMFP1 gene (A: OsMFP1 gene heatmap analysis, B: OsMFP1 gene tissue expression pattern analysis);
[0018] Figure 2 Biological information analysis of the OsMFP1 gene (A: OsMFP1 amino acid sequence alignment, B: OsMFP1 gene phylogenetic analysis);
[0019] Figure 3 Subcellular localization analysis of OsMFP1 (A: empty vector control, B: subcellular localization of OsMFP1-GFP in rice protoplasts (scale bar: 10 μm));
[0020] Figure 4 Validation of the OsMFP1 rice mutant;
[0021] Figure 5 Phenotypic analysis of the mfp1 rice mutant (A: phenotypic diagram of mfp1 mutant, B: panicle length, number of grains per panicle, and number of tillers of mfp1 mutant);
[0022] Figure 6 Analysis of grain traits of the mfp1 rice mutant (A: grain phenotype of mfp1 mutant, B: grain length, width, thickness and 100-grain weight of mfp1 mutant);
[0023] Figure 7Morphological and structural analysis of starch granules in the endosperm of the mfp1 rice mutant (A: grain phenotype, B: grain cross section, C: iodine staining experiment, D: SEM analysis in blue box, E: SEM analysis in red box, F: TEM analysis in blue box, G: TEM analysis in red box).
[0024] Figure 8 Analysis of grain composition of mfp1 mutant rice (A: total starch content, B: amylose content, C: amylopectin content, D: reducing sugar content, E: soluble sugar content, F: protein content);
[0025] Figure 9 Analysis of the gelatinization characteristics of mfp1 rice mutant (A: gelatinization characteristics of WT and mfp1 starch, B: swelling volume of starch in urea);
[0026] Figure 10 Analysis of amylopectin chain length distribution in the seeds of the mfp1 mutant (A: amylopectin chain length distribution in WT and mfp1, B: differences in amylopectin chain length distribution between WT and mfp1). Detailed Implementation
[0027] The present application will now be described in further detail. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.
[0028] I. Materials
[0029] Unless otherwise specified, all methods used in this invention are conventional methods known to those skilled in the art, and all reagents and materials used are commercially available products.
[0030] Total starch and protein were determined using kits from Nanjing Jiancheng Bioengineering Institute. Amylose was determined according to the Megazyme measurement standard. Amylopectin was determined using kits from Beijing Solarbio Science & Technology Co., Ltd. Soluble sugars were determined using kits from Nanjing Jiancheng Bioengineering Institute. Reducing sugars were determined using kits from Beijing Solarbio Science & Technology Co., Ltd.
[0031] II. Methods and Conclusions
[0032] 1. Analysis of OsMFP1 gene tissue expression patterns
[0033] Transcriptome sequencing technology was used to screen and identify OSMFP1, a key gene in rice that may affect starch synthesis. Data analysis was performed using the Rice Expression Database (https: / / expression.ic4r.org / ) to predict the expression levels of OsMFP1 in various rice tissues. The prediction results are as follows: Figure 1 As shown in Figure A, OsMFP1 is highly expressed in rice leaves and mature seeds.
[0034] To verify the accuracy of the data, root, stem and leaf at the three-leaf stage, root, stem and leaf at the heading stage, glumes and anthers at the heading stage, and grains at different stages after pollination were collected from rice Zhonghua 11. RNA was extracted from the above tissues and reverse transcribed into cDNA. The relative expression level of OsMFP1 in various organs and tissues of rice was analyzed by real-time PCR.
[0035] The primers used for quantitative real-time PCR are:
[0036] SEQ ID NO.3: OsMFP1 quantification-F CAGGAATCGAGGGGATGCTC;
[0037] SEQ ID NO.4: OsMFP1 quantification-R TGTCGTGGGTACTACTCCGT;
[0038] The internal reference gene used is OsActin, and the corresponding primers are:
[0039] SEQ ID NO.5: OsActin-F CTGACGGAGCGTGGTTACTCAT;
[0040] SEQ ID NO.6: OsActin-R TGGTCTTGGCAGTCTTCCATTC;
[0041] The results are as follows Figure 1 As shown in Figure B, the tissue expression pattern analysis results are consistent with the heatmap, indicating that the expression level of OsMFP1 is high in leaves and grains 15 days after pollination.
[0042] 2. Biological information analysis of the OsMFP1 gene
[0043] Bioinformatics analysis using the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) revealed that the OsMFP1 gene DNA sequence is 4750 bp in length, with a CDS sequence length of 2301 bp encoding 766 amino acids. Figure 2As shown in Figure A, it contains a thylakoid Tat signal sequence and a short transmembrane domain, with a long coiled-coil domain. Homologous proteins of OsMFP1 in different species were retrieved using the BLASTp function in NCBI. Domain sequences of these genes were compared and phylogenetic trees were constructed to explore the relationship between OsMFP1 and other higher plant homologues. The results are as follows: Figure 2 As shown in Figure B, MFP1 has two homologous genes in maize and Arabidopsis thaliana, exhibiting high similarity. In rice, these genes are named OsMFP1 and OsMFP2. Phylogenetic analysis indicates that these genes are closely related.
[0044] 3. Subcellular localization analysis of OsMFP1
[0045] To detect the subcellular localization of OsMFP1, the pCAMBIA1305 vector (hereinafter referred to as 1305) containing GFP signal was used. Based on the vector map, two restriction enzyme sites (SpeⅠ and BamHI restriction enzyme sites were selected in the experiment) were selected for double digestion. After obtaining the target band of OsMFP1 gene by PCR and gel recovery, homologous recombination was used to add a homologous arm (removing the stop codon) to the primer of the cloned gene, and the 35S-OsMFP1-GFP expression vector was successfully constructed.
[0046] The primer sequences used in homologous recombination are as follows:
[0047] SEQ ID NO.7:
[0048] p1305-OsMFP1-F ggacagcccagatcaactagtATGGGGTACCTCCTCCTCGC;
[0049] SEQ ID NO.8:
[0050] p1305-OsMFP1-R gcccttgctcaccatggatccCGTTGATGCACCACCTTTTCT;
[0051] The recombinant vector was transferred into rice protoplasts via PEG-mediated transformation. Using the P1305 empty vector as a control, the cells were cultured in the dark for two days and observed under a confocal microscope. Figure 3 As shown, the colocalization results of the GFP signal and chloroplast II autofluorescence signal of the OsMFP1-GFP fusion protein indicate that OsMFP1 is located in the chloroplasts of the cytoplasm.
[0052] 4. Validation of CRISPR / Cas9 gene editing to knock out OsMFP1 rice mutants
[0053] To elucidate the biological function of the OsMFP1 gene in rice, we commissioned Weimi Biotechnology Co., Ltd. to construct and obtain F1 generation seeds of the OsMFP1 mutant. Then, we carried out multiple generations of self-pollination and extracted DNA from the leaves at the three-leaf stage of the material. We designed specific primers for PCR amplification.
[0054] The primer sequences are as follows:
[0055] SEQ ID NO.9: osmfp1-identification-F CGAACCCTGTCGTGGTCTAC;
[0056] SEQ ID NO.10: osmfp1-identification-R TGTGTATGCATGCAAAGATGGT;
[0057] SEQ ID NO.11: osflo6-identification-F ATGCTCCCCCTCCTCCTCC;
[0058] SEQ ID NO.12: osflo6-identification-R TCAAGTGACAGTCAGAAGGTTGTTT;
[0059] The PCR products were sent to the company for sequencing. The sequencing results were compared with the CDS sequences downloaded from the gene bank. The results showed that the two mutant lines obtained were both homozygous mutant lines, named mfp1-1 and mfp1-2 (in the wild-type genetic background of Zhonghua 11). Figure 4 As shown, mfp1-1 and mfp1-2 have one and two adenine (A) deletions, respectively, in the second exon of their gene sequences, leading to frameshift and premature termination of translation.
[0060] 5. Agronomic trait analysis of the mfp1 rice mutant
[0061] Two mutant lines and wild-type (Zhonghua 11) plants were planted simultaneously. After completing the entire growth cycle, the agronomic traits of the wild-type and mutant plants obtained in the experimental field and greenhouse were observed separately. Figure 5 As shown in Figure A, in the rice trough, both mfp1-1 and mfp1-2 headed earlier than the wild type, about 3 days earlier. Furthermore, the panicle length and number of grains per panicle of the two mutants obtained in the experimental field showed no significant difference compared to the wild type. Since the number of tillers is one of the factors affecting yield, the tiller number of the wild type and mutants was investigated. The tiller number of the wild type and mutants was counted in the experimental field. Both mutants had a significantly lower number of tillers than the wild type. The wild type had 20 tillers, while mfp1-1 and mfp1-2 had 8 and 7 fewer tillers, respectively, compared to the wild type. Figure 5 B).
[0062] When investigating grain traits in wild-type and mutant rice, 100 rice seeds were selected for grain length, width, and 100-grain weight. The length and width data were acquired using an A3 Scanner ultraviolet light scanner, and the 100-grain weight was measured using a balance. For grain thickness, 50 seeds were selected, and the grain thickness was measured using vernier calipers. The results obtained after three biological and technical replicates are as follows: Figure 6 As shown, the mfp1-1 and mfp1-2 mutants did not show significant differences from the wild type in grain length, width, thickness, and 100-grain weight.
[0063] The above results indicate that the OsMFP1 gene has a certain impact on rice yield.
[0064] 6. Morphological and structural analysis of endosperm starch granules in mfp1 rice mutant
[0065] The altered grain size in the mutant plants suggests that MFP1 may regulate grain development. Based on this, further research was conducted on the structure of starch granules in the mutant rice grains. The grain phenotypes of wild-type and two mutant plants are shown below. Figure 7 As shown in Figure A, wild-type and two mutant plants were cross-sectioned, and the results are as follows: Figure 7 As shown in Figure B, approximately 75% of the endosperm of mature seeds from the mfp1-1 and mfp1-2 mutants is opaque, and a chalky white appearance is observed on the surface of the seeds after cross-section. Subsequently, iodine staining experiments were performed on wild-type and mutant plants, with the results shown below. Figure 7 As shown in C, both the wild type and the mutants are purplish-red, but the two mutants are lighter in color than the wild type, indicating that the starch content in the grains is affected by the mutation.
[0066] Because the morphology of the mutant grains changed, the structural changes of starch granules were further investigated. Scanning electron microscopy was performed on two parts of mature grains: the transparent (blue-marked) and chalky (red-marked) regions. The results showed that the arrangement of starch granules in the transparent and chalky parts of the endosperm was significantly different. In the wild type and both mutants, the starch granules in the transparent region were arranged regularly and tightly. Figure 7 D), while in wild-type rice grains, the gaps between starch granules in the chalky part are increased. The abnormal morphology of starch granules in the chalky part of both mutants is mostly manifested as spheres of varying sizes, resulting in a looser arrangement of starch granules. Figure 7 E), which may be the reason for the chalkiness. Further transmission electron microscopy observation of the endosperm 18 days after pollination showed that the starch granules in the transparent portions of the wild type and the two mutants developed into an elliptical shape. Figure 7F), in both mutants, the starch granules in the chalky portion mostly exhibit fragmented development, and the spacing between the starch granules in the two mutants is much larger compared to the wild type. Figure 7 G).
[0067] The above results indicate that the structure of starch granules in rice grains is affected to some extent during the development of the mfp1 mutant.
[0068] 7. Analysis of the grain composition of the mfp1 mutant
[0069] To further investigate the reasons for the changes in the morphology and starch granule structure of mutant grains, the grain composition of wild-type and mutant plants was analyzed. The experiment selected rice grains from mature wild-type (Zhonghua 11) and homozygous mutant plants of mfp1-1 and mfp1-2 to determine the contents of total starch, amylose, amylopectin, total protein, soluble sugar, and reducing sugar. The results are as follows: Figure 8 As shown in AC, the total starch content of Zhonghua 11 was 73.12%, while the total starch content of the mfp1-1 mutant was 63.38%, a decrease of approximately 10%, and the total starch content of the mfp1-2 mutant decreased by approximately 11%. Significant differences were also found in the amylose content of the seeds of the mfp1-1 and mfp1-2 mutants, accounting for 10.76% and 12.07% respectively, representing decreases of approximately 3% and 2% compared to the wild type. Similarly, significant differences were found in the amylopectin content; the wild type had an amylopectin content of 60.36%, while the two mutants showed decreases of approximately 8% and 12% respectively compared to the wild type. These results are consistent with the conclusions drawn from the iodine staining experiment.
[0070] The reducing sugar content, soluble sugar content, and protein content in wild-type and mutant seeds were measured separately, and the results are as follows: Figure 8 As shown in the DF diagram, the contents of reducing sugars and soluble sugars in both mutants were significantly higher than those in the wild type, while the protein content in both mutants was not significantly different from that in the wild type. Since sugars are substrates for starch synthesis, and the sugar content in the mutants was higher than that in the wild type, the starch content in the mutants was decreased.
[0071] The above results indicate that the OsMFP1 gene affects starch synthesis in grains.
[0072] 8. Analysis of the gelatinization characteristics of the mfp1 mutant
[0073] Because the starch content in the endosperm of mfp1-1 and mfp1-2 mutant rice changed, and this change in starch content alters the gelatinization characteristics of rice, thus affecting its cooking quality, further research was conducted on the gelatinization characteristics of the mutant rice. A urea gelatinization experiment was performed, mixing starch with different concentrations of urea to measure the solubility of starch in urea solution and calculating the swelling volume of the mutant and wild-type rice in urea solution. The results are as follows: Figure 9 As shown in Figure A, compared with the wild type, mfp1-1 and mfp1-2 showed the greatest differences under the treatment condition of 5 mol / L urea, such as... Figure 9 As shown in B, both the wild type and the mutant are difficult to dissolve in urea at concentrations of 0-4 mol / L. The solubility of the wild type reaches its maximum at 6 mol / L and then tends to stabilize, while the solubility of the mfp1-1 and mfp1-2 mutants reaches its maximum at 7 mol / L and then tends to stabilize.
[0074] The above results indicate that the OsMFP1 gene affects the gelatinization properties of rice.
[0075] 9. Analysis of amylopectin chain length distribution in mfp1 mutant grains
[0076] Since the amylopectin content in the mutant was significantly lower than that in the wild type, it was speculated that the amylopectin structure in the mutant may also have changed. Based on this, the amylopectin structures of the wild type and the mutant were further compared. Plants of the Zhonghua 11 and mfp1-1 mutants were selected, and the amylopectin chain length distribution was determined using ion chromatography. Figure 10 As shown in Figure A, the chain length distribution (CLD) of amylopectin exhibits a similar pattern in both mutants and wild types, with a peak at degree of polymerization (DP) 12 in both. Figure 10 As shown in B, compared with the wild type, the proportion of short or medium-length chains between DP7-12, DP23-35 and DP49-70 was significantly increased in the mutant, while the proportion of short or medium-length chains between DP13-22 and DP36-48 was significantly decreased.
[0077] The above results indicate that the OsMFP1 gene affects the chain length distribution of amylopectin in endosperm starch.
[0078] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.
Claims
1. A gene OsMFP1 In the regulation of starch synthesis in rice grains, characterized in that, The gene OsMFP1 The nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by this gene is shown in SEQ ID NO.2; Genes OsMFP1 Loss of function of the gene leads to a decrease in total starch content, amylose content and amylopectin content in rice grains.