Application of gene NGR1 and / or NGR2 in regulation and control of lateral root antigravity growth

Abstract

The invention discloses application of a soybean gene NGR1 and / or NGR2 in regulation and control of soybean lateral root antigravity growth, the gene editing technology is utilized to knock out the soybean NGR1 and / or NGR2 gene, the lateral root in the obtained mutant material root system can grow in an antigravity mode, and the main root continues to grow downwards; meanwhile, the phosphorus absorption efficiency of the mutant material in a growth environment simulating natural environment phosphorus content distribution is higher than that of a wild type. Therefore, the invention provides a method for regulating anti-gravity growth of soybean lateral roots and promoting soybean root systems to quickly absorb phosphorus in shallow soil through soybean genes NGR1 and / or NGR2, and a new thought is provided for breeding of shallow root system phosphorus efficient absorption type soybean varieties.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and in particular, relates to the application of genes NGR1 and / or NGR2 in regulating the anti-gravity growth of lateral roots. Background Art

[0002] Soybean is an important grain and oil crop selected and bred by our ancestors, and has a history of more than 5,000 years of cultivation and consumption in my country. However, my country's current soybean self-sufficiency rate is seriously insufficient.

[0003] Acidic low-phosphorus soils are widely distributed in South China, and acidic low-phosphorus soils are not conducive to the growth of soybeans. Phosphorus in soil mainly exists in two forms: total phosphorus and available phosphorus. Total phosphorus refers to all phosphorus elements in the soil, including organic phosphorus and inorganic phosphorus, but not all of them can be absorbed and utilized by plants. Available phosphorus refers to phosphorus elements that can be absorbed and utilized by plants, including inorganic phosphorus and a small amount of organic phosphorus. In the soil, phosphorus tends to be distributed in the surface layer of the soil. Therefore, based on the distribution of phosphorus in the soil, using the current genetic knowledge system related to plant root response and root architecture determination, the key factors that control root gravity response and root architecture in soybeans are manipulated to create a shallow-rooted soybean that takes into account shallow phosphorus absorption and water and nutrient absorption in deep soil. This can not only construct a new soybean root variation resource, but also provide theoretical guidance and practical basis for molecular design breeding of phosphorus-efficient soybeans.

[0004] At present, the article "Negative gravitropism in plant roots" discloses that when the three genes AtNGR1, AtNGR2, and AtNGR3 of Arabidopsis are knocked out individually, the root system does not change, but when the above three genes are knocked out together, the root system of Arabidopsis will show a phenotype of anti-gravity growth. Therefore, AtNGR1, AtNGR2, and AtNGR3, as Arabidopsis root growth regulatory genes, will produce functional redundancy in Arabidopsis. There are 4 copies of the NGR gene in soybeans, and there are no reports on the functions of these 4 genes in the soybean root system. It is of great significance to explore whether they can be used to create a soybean that takes into account both shallow phosphorus absorption and water and nutrient absorption in deep soil. Summary of the invention

[0005] The purpose of the present invention is to overcome the above-mentioned defects and deficiencies in the prior art and provide the application of soybean genes NGR1 and / or NGR2 in regulating the anti-gravity growth of soybean lateral roots.

[0006] The second object of the present invention is to provide the use of soybean genes NGR1 and / or NGR2 in cultivating shallow-rooted soybeans with lateral roots growing against gravity.

[0007] The third object of the present invention is to provide an application of an agent for knocking out soybean genes NGR1 and / or NGR2 in cultivating shallow-rooted soybeans with lateral roots growing against gravity.

[0008] The fourth object of the present invention is to provide a method for creating shallow-root soybeans.

[0009] The above-mentioned object of the present invention is achieved through the following technical solutions:

[0010] The present invention selects NGR1 and NGR2 from four NGR genes of soybean, designs gene editing knockout targets of NGR1 (Glyma.07G040800) and NGR2 (Glyma.16G009400) in soybean by using an online CRISPR-P2.0 tool (http: / / cbi.hzau.edu.cn / crispr / ), constructs a CRISPR / Cas9 editing vector, performs genotype identification and phenotypic observation on the obtained mutant materials, and finds that the functional deficiency of NGR1 and / or NGR2 will cause the lateral roots in the soybean root system to grow against gravity, but the main root continues to grow downward, and the root system is largely distributed in a shallow layer, thus becoming shallow root soybean.

[0011] Therefore, the present invention provides the use of soybean genes NGR1 and / or NGR2 in regulating the anti-gravity growth of soybean lateral roots, the nucleotide sequence of NGR1 is shown as SEQ ID No.1; the nucleotide sequence of NGR2 is shown as SEQ ID No.2.

[0012] The present invention also provides the use of soybean genes NGR1 and / or NGR2 in cultivating shallow-root soybeans with lateral roots growing against gravity. The nucleotide sequence of NGR1 is shown in SEQ ID No.1; the nucleotide sequence of NGR2 is shown in SEQ ID No.2.

[0013] Furthermore, the invention is specifically used in cultivating shallow-rooted soybeans with main roots growing downward and lateral roots growing upward, and with a large number of roots distributed in the shallow layer of soil.

[0014] Furthermore, the shallow-rooted soybeans can take into account both the absorption of phosphorus in the shallow soil and the absorption of water and nutrients in the deep soil.

[0015] The present invention also provides the use of an agent for knocking out soybean genes NGR1 and / or NGR2 in cultivating shallow-root soybeans with lateral roots growing against gravity. The nucleotide sequence of NGR1 is shown in SEQ ID No.1; the nucleotide sequence of NGR2 is shown in SEQ ID No.2.

[0016] Because in the soil, phosphorus tends to be distributed in the surface layer of the soil, and the phosphorus content in the 0-20 cm soil layer is several times higher than that in the 20-40 and 40-60 cm soil layers. Based on the distribution of phosphorus in the soil, using the current genetic knowledge system related to plant root response and root configuration determination, it is of great significance to manipulate the key factors NGR1 and NGR2 that control root gravity response and root configuration in soybeans, and create a soybean that takes into account both shallow phosphorus absorption and water and nutrient absorption in deep soil. The present invention measured and found that there was no significant difference in phosphorus absorption efficiency of NGR1 and / or NGR2 mutant materials in low phosphorus (-P) and normal phosphorus (+P) environments, but in a growth environment simulating the distribution of phosphorus content in the natural environment (+P / -P), the mutant material had a significantly higher phosphorus absorption efficiency than the wild type (Young), indicating that the mutant material can efficiently absorb phosphorus in a growth environment simulating the distribution of phosphorus content in the natural environment.

[0017] Therefore, the present invention provides a method for creating shallow-root soybeans, wherein the method comprises knocking out the genes NGR1 and / or NGR2 in soybeans to obtain mutant materials with functional loss of the target genes.

[0018] Furthermore, the knockout method is to perform gene editing on the conserved domains of soybean genes NGR1 and / or NGR2 using CRISPR / Cas9 technology, so that the target gene mutates, resulting in premature termination of protein translation, and obtaining a mutant material with a functional deficiency of the target gene.

[0019] Furthermore, the knockout target of the NGR1 conserved domain is sgRNA1 and / or sgRNA2; the nucleotide sequences of sgRNA1 and sgRNA2 are shown in SEQ ID No.3-4.

[0020] Furthermore, the knockout target of the NGR2 conserved domain is sgRNA3 and / or sgRNA4; the nucleotide sequences of sgRNA3 and sgRNA4 are shown in SEQ ID No.5-6.

[0021] Preferably, the sequences of the knockout target sgRNA1 and sgRNA2 amplification primers are as shown in SEQ ID Nos. 7 to 10.

[0022] Preferably, the sequences of the knockout target sgRNA3 and sgRNA4 amplification primers are as shown in SEQ ID Nos. 11 to 14.

[0023] More specifically, the following steps are included:

[0024] 1) synthesizing the target gene fragments of soybean NGR1 and / or NGR2, connecting the target gene fragments to the CRISPR / Cas9 vector, constructing a recombinant plasmid containing the target gene fragments, transforming Agrobacterium, and obtaining Agrobacterium containing the recombinant plasmid containing the target gene fragments;

[0025] 2) Infecting soybean explants with the Agrobacterium solution containing the recombinant vector in step 1), and after continuous breeding, screening for strains that do not contain Cas9 protein and whose NGR1 and / or NGR2 genes have been successfully edited and are homozygous, to obtain homozygous transgenic strains.

[0026] The research results of the present invention show that knocking out NGR1 or NGR2 alone, or knocking out NGR1 and NGR2 simultaneously, will affect the growth of soybean lateral roots, and obtain a plant with lateral roots growing against gravity and main roots growing downward, and can efficiently absorb phosphorus in a growth environment simulating the distribution of phosphorus content in the natural environment, which is a very ideal root system configuration. Therefore, this method can be used for the breeding of soybean varieties with shallow roots and efficient phosphorus absorption.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] The present invention discloses the application of soybean genes NGR1 and / or NGR2 in regulating the anti-gravity growth of soybean lateral roots. The present invention uses gene editing technology to knock out the NGR1 and / or NGR2 genes of soybeans, and the lateral roots of the obtained mutant material root system can grow against gravity and the main root continues to grow downward. At the same time, in a growth environment simulating the distribution of phosphorus content in the natural environment, the phosphorus absorption efficiency of the mutant material is stronger than that of the wild type. Therefore, the present invention provides a method for regulating the anti-gravity growth of soybean lateral roots through soybean genes NGR1 and / or NGR2 to promote the rapid absorption of phosphorus in shallow soil by the soybean root system, which provides a new idea for the breeding of shallow root phosphorus efficient soybean varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Schematic diagram of NGR1 and NGR2 target sites. Note: The SgRNA target sequence is underlined in black. The PAM sequence is highlighted in red.

[0030] Figure 2 Schematic diagram of the CRISPR-Cas9 vector structure of NGR1 and NGR2 genes.

[0031] Figure 3 It is the soybean genetic transformation step and PCR identification of positive strains and herbicide resistance screening. Figure 3a in the figure represents the genetic transformation process of soybean cotyledon node; b represents the screening results of herbicide resistance in T2 generation transgenic lines, and 4 transgenic lines were obtained in the figure and were not resistant to herbicides; c represents PCR identification of T2 transgenic lines, M is 100 bp DNA Ladder, the size is as indicated by the label, lanes 1 to 11 represent the PCR identification results of NGR1 gene of different transgenic lines, and lanes 12 to 22 represent the PCR identification results of NGR2 gene of different transgenic lines.

[0032] Figure 4 The target site mutation types of one strain of ngr1 single knockout mutant, one strain of ngr2 single knockout mutant, and one strain of ngr1 / 2 double knockout mutant. Note: The WT sequence is shown at the top of the figure, the red short dashed line indicates the deletion, and the sequencing peak graph is displayed.

[0033] Figure 5 The root phenotype and lateral root angle of the NGR gene knockout mutant. Figure 5 a in the figure shows the root phenotype of the wild type (Young, left) and ngr1, ngr2 and ngr1 / 2 mutants (right) planted in a root box filled with substrate, with the seed attached to the wall facing downward and placed in the root box at a 30° tilt, after about 15 days of growth, scale bar, 5 cm; b shows the root phenotype of the wild type (Young, left) and ngr1, ngr2 and ngr1 / 2 mutants (right) taken out of the substrate after about 15 days of planting in the root box filled with substrate, scale bar, 5 cm. c shows the lateral root angle statistics of the wild type (Young, left) and ngr1, ngr2 and ngr1 / 2 mutants (right), with vertical downward as 0°, n represents the number of samples, and t-test analysis is used, **** indicates significant differences between samples (P<0.0001).

[0034] Figure 6The experimental design diagram for planting wild-type and mutant materials under different phosphorus treatments. Note: The first row in the figure is low-phosphorus treatment, and the soil used is low-phosphorus red soil and coconut bran mixed at a ratio of 3:1; 13 cm of low-phosphorus soil is placed at the bottom, 2 cm of perlite is placed in the middle, and 5 cm of low-phosphorus soil is placed on the top. The second row is stratified phosphorus treatment, with 13 cm of low-phosphorus soil placed at the bottom, 2 cm of perlite placed in the middle as a buffer layer to prevent the infiltration of phosphorus-containing Hogland nutrient solution, and 5 cm of normal phosphorus soil (low-phosphorus red soil with 1 mM potassium dihydrogen phosphate solution added) placed on the top to simulate the phosphorus stratification of soil in the natural environment; the third row of normal phosphorus treatment uses low-phosphorus red soil irrigated with phosphorus-containing Hogland nutrient solution, and similarly 13 cm of low-phosphorus red soil irrigated with phosphorus-containing Hogland nutrient solution is placed at the bottom, 2 cm of perlite is placed in the middle, and 5 cm of low-phosphorus red soil irrigated with phosphorus-containing Hogland nutrient solution is placed on the top. Each pot was divided into two chambers, the wild type (Young) was planted in the left chamber, and the mutants ngr1, ngr2 and ngr1 / 2 were planted in the right chamber. Twenty plants were planted in each line for 30 days.

[0035] Figure 7 The phosphorus content of mutant materials under different phosphorus treatments. Note: In the figure, WT represents wild type (Young), ngr1, ngr2 and ngr1 / 2 represent mutant materials. After 30 days of planting in low-phosphorus red soil (-P), stratified phosphorus red soil (+P / -P), and normal phosphorus soil (+P), the plants were collected for phosphorus content determination. The data in the figure are 3 replicates ± standard error, and one-way ANOVA was used. ns means that there is no significant difference between the samples (P>0.05), * means that there is a significant difference between the samples (P<0.05), *** means that there is a significant difference between the samples (P<0.001), and **** means that there is a significant difference between the samples (P<0.0001). DETAILED DESCRIPTION

[0036] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0037] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0038] Example 1 CRISPR / Cas9 vector construction

[0039] 1. Gene editing knockout targets of NGR in soybean were designed by the online CRISPR-P 2.0 tool (http: / / cbi.hzau.edu.cn / crispr / ). Two target sites sgRNA1 and sgRNA2 were designed for the NGR1 (Glyma.07G040800) gene (nucleotide sequence as shown in SEQ ID No.1), located in the third exon region. Two target sites sgRNA3 and sgRNA4 were designed for the NGR2 (Glyma.16G009400) gene (nucleotide sequence as shown in SEQ ID No.2), located in the third exon region (as shown in Figure 1 shown).

[0040] sgRNA1: 5'- AGACGACCAAAATACACAAG AGG-3'

[0041] sgRNA2: 5'- TAACTGCCCTTCAAGCTTGG AGG-3'

[0042] sgRNA3: 5'- GGATGACCAAAATACACAAG AGG-3'

[0043] sgRNA4: 5'- AGAGGATCCATCTTCTTCAG AGG-3'

[0044] (The underlined sequence is 20 bp sgRNA).

[0045] 2. After the target is designed, it needs to be integrated into the vector. First, synthesize the target primers of NGR1 and NGR2 genes. The primer sequences are:

[0046] sgRNA1-F: 5'-GGATTGGACGACCAAAATACACAAG-3'

[0047] sgRNA1-R: 5'-AAACCTTGTGTATTTTGGTCGTCCA-3'

[0048] sgRNA2-F: 5'-GGATTGAACTGCCCTTCAAGCTTGG-3'

[0049] sgRNA2-R: 5'-AAACCCCAAGCTTGAAGGGCAGTTCA-3'

[0050] sgRNA3-F: 5'-GGATTGGATGACCAAAATACACAAG-3'

[0051] sgRNA3-R: 5'-AAACCTTGTGTATTTTGGTCATCCA-3'

[0052] sgRNA4-F: 5'-GGATTGGAGGATCCATCTTCTTCAG-3'

[0053] sgRNA4-R: 5'-AAACCTGAAGAAGATGGATCCTCCA-3'

[0054] 1 μL of sgRNA1-F and sgRNA1-R primers (primer concentration is 10 μM) were added to the 10 μL system, 8 μL of Anneal Buffer (TE+50 mM NaCl) was added, and annealed at 95°C, 0.1°C / s to 16°C. After annealing, the annealing product of sgRNA1 with blunt ends was obtained. sgRNA2-F, sgRNA2-R and sgRNA3-F, sgRNA3-R and sgRNA4-F, sgRNA4-R were carried out according to the above operation. After all the operations were completed, the target annealing products sgRNA1 and sgRNA2 with blunt ends of NGR1 and the target annealing products sgRNA3 and sgRNA4 with blunt ends of NGR2 were obtained respectively.

[0055] 3. Construction of CRISPR / Cas9 editing vector

[0056] 1) Use restriction endonuclease BsaI-HF to digest the intermediate vectors PUC1, PUC3, PUC5, and PUC6, and recover the digested vectors PUC1, PUC3, PUC5, and PUC6.

[0057] 2) In a 20 μL system, add 10 μL of annealed product of sgRNA1, 6 μL of ddH2O, 2 μL of 10×T4 buffer, 1 μL of digested intermediate vector PUC1, and 1 μL of T4 ligase, and react at 25°C for 2 h. sgRNA2, sgRNA3, and sgRNA4 are connected to the intermediate vectors PUC3, PUC5, and PUC6 respectively according to the above operation.

[0058] 3) The ligation products of sgRNA1, sgRNA2, sgRNA3, and sgRNA4 were transformed into competent E. coli DH5α, respectively, spread on LB+Amp solid culture medium, picked single clones, and after correct sequencing, extracted plasmids sgRNA1, sgRNA2, sgRNA3, and sgRNA4, and detected the plasmid concentration.

[0059] 4. In a 20 μL system, add 100 ng each of plasmids sgRNA1, sgRNA2, sgRNA3, and sgRNA4, 50 ng of CRISPR / Cas9 vector pCas9 plasmid, 1 μL of 10×T4 ligation buffer, 0.4 μL of 50×oligo, 1 μL of AarI restriction endonuclease, and 1 μL of T4 ligase, and finally add ddH2O to make up to 20 μL.

[0060] The PCR amplification reaction steps are as follows: 37°C for 5 min, 25°C for 10 min, 15 cycles; 50°C for 5 min; 80°C for 10 min; 16°C forever.

[0061] 5. Transform the CRISPR / Cas9 ligation product into competent E. coli DH5α, spread it on LB+Kan solid medium, pick a single clone, and extract the recombinant plasmid CRISPR / Cas9 after sequencing is correct, named Cas9-NGR1 / 2 (such as Figure 2 The cloned DNA was then transformed into Agrobacterium competent cells AGL1.

[0062] Example 2 Soybean Genetic Transformation

[0063] The successfully constructed Cas9-NGR1 / 2 was transformed into soybean variety Young using Agrobacterium-mediated method. The specific steps are as follows (e.g. Figure 3 a):

[0064] 1. Seed disinfection

[0065] 1) Select Young soybean seeds that are free of pests and spots, have full grains, are uniform in size, and are dry. Place them in a 500 mL conical flask, wash them several times with deionized water, add deionized water to cover the soybeans, and place them on a horizontal shaker at 80 rpm to allow them to swell overnight.

[0066] 2) After the soybeans in the conical flask have completed swelling, the excess water is poured out, and after adding 15% sodium hypochlorite aqueous solution, the bottle mouth is sealed and placed on a horizontal shaker with a speed of 80 rpm for 10 minutes. Then, it is transferred to a clean bench and the soybeans are cleaned with sterile water.

[0067] 2. Preparation of infection solution

[0068] 1) Use 300 mL of LB liquid medium containing Kan and Rif to culture Cas9-NGR1 / 2 Agrobacterium at 28°C and 200 rpm on a shaker. When the bacterial solution OD600 nm is between 0.6-0.8, divide the bacterial solution into 50 mL centrifuge tubes in an ultra-clean workbench, centrifuge at 5000 r / min for 10 min, collect the bacteria, pour out the supernatant, divide 300 mL of the prepared co-culture infection liquid medium into 50 mL centrifuge tubes for collecting bacteria, and resuspend them for later use.

[0069] 2) After cleaning the soybeans, separate the two cotyledons along the back seam of the soybeans with a scalpel in a clean bench, peel off the seed coat, keep the cotyledons with complete hypocotyls, cut off a part of the hypocotyl, and gently scratch the connection between the hypocotyl and the cotyledons 3-4 times with the tip of the knife. Transfer the cut soybean cotyledons to a 50mL conical flask with sterile water.

[0070] 3) After all the soybeans are cut, pour out the sterile water in the 50mL conical flask, pour the resuspended bacterial solution in a 50mL centrifuge tube into the 50mL conical flask, cover it with a sealing film, ultrasonicate for 3 minutes, and shake the bottle every 30 seconds. After the ultrasonication is completed, wipe the bottle dry, vacuumize to -60KPa, let it stand for 10 minutes under vacuum conditions, and repeat the vacuuming operation. After the vacuuming is completed, place the conical flask on a horizontal shaker with a speed of 80rpm and infect for 30 minutes.

[0071] 4) The infected soybean cotyledons were transferred to a clean bench, dried, and then spread with the cut surface (smooth surface) facing upward on a co-culture solid medium covered with sterile filter paper at 21° C. in the dark for 2 days.

[0072] 5) Two days later, transfer to 21°C, 16h light / 8h dark conditions and culture until the cotyledons turn green. Then transfer the explants to cluster bud induction medium at 21°C, 16h light / 8h dark conditions and culture for 15 days. After 15 days, remove the explants, remove the new buds, cut off part of the cotyledons, and then transfer the treated explants to the screening medium containing herbicides and continue to culture for 15 days.

[0073] 6) After 15 days of screening and induction, the explants produce a large number of adventitious buds. Remove the brown or yellow leaves, cut off some cotyledons, transfer the treated explants to elongation medium, and culture them at 21°C, 16 h light / 8 h dark for 15 days.

[0074] 7) In the elongation medium, when the clustered buds elongate to about 5 cm, they can be cut obliquely from the base of the buds (the incision is an inclined surface). After the base of the stem is soaked in 1 mg / ml IBA solution for 1 min, it is transferred to the rooting medium and cultured at 21°C, 16 h light / 8 h dark conditions for 7 days. After a large number of roots grow at the base of the stem, it is transplanted into a pot. The grown plant is the T0 generation transformed soybean.

[0075] Example 3 Identification of edited plants

[0076] 1. Screening T0 generation plants for herbicide resistance

[0077] Since the knockout vector contains the herbicide resistance marker gene Bar, herbicides can be used to screen positive plants containing the knockout vector.

[0078] 0.4% glyphosate herbicide was applied on the surface of a leaf of the T0 generation plant and marked. If the marked leaf did not turn yellow or dry after 4-5 days, it was determined to be a transgenic positive plant.

[0079] 2. Molecular identification of T0 edited plants

[0080] DNA from leaves of T0 generation herbicide-resistant plants was used as a template for PCR detection, with wild-type soybean (Young) as a control.

[0081] PCR primers were designed near the target sites of NGR1 and NGR2 genes, and PCR amplification and sequencing analysis were performed to identify the editing type of T0 generation plants.

[0082] The primer sequences for amplifying the NGR1 gene were F: 5′-GATCTTGCAAAACAAGAGCCTAGA-3′ and R: 5′-GACTCTTGAAGGGTATCTCTTAGGCTA-3′.

[0083] The primer sequences for amplifying the NGR2 gene were F: 5′-GATTGGAACATTTGGAAACAAGACTGC-3′ and R: 5′-CTCTTGAAGGGTATCTCTAAGGCTT-3′.

[0084] PCR reaction system: 2× Rapid Taq Master Mix 12.5μL, F 0.5ul, R (10μM) 0.5μL, DNA 1μL, ddH2O 11μL, total volume 25μL.

[0085] The PCR amplification reaction steps are as follows: 94°C for 30s; 98°C for 10s, 58°C for 30s, 72°C for 1min, 40 cycles; 72°C for 2min; 16°C forever.

[0086] The PCR product was sent to the company for sequencing verification. The sequencing results showed overlapping peaks at the target site, indicating that the plant was a heterozygous edited plant and was named T0 generation transgenic ngr soybean.

[0087] 3. Next generation group separation

[0088] According to the results of PCR identification, the heterozygous edited plants were selected and harvested, and then planted to obtain T1 plants. The T1 plants were identified, and the heterozygous edited plants that were not resistant to herbicides were selected and harvested, and then planted to obtain T2 plants.

[0089] The test results of T2 generation plants are as follows Figure 3 As shown in bc, it means that the screened plants do not contain the herbicide resistance marker gene and gene mutation has occurred.

[0090] The T2 generation mutant plants with various ngr gene mutation types are further cultivated until T3 generation mutant plants are obtained.

[0091] The sequencing results are as follows Figure 4 As shown, homozygous mutant plants were obtained, including ngr1 single mutant, ngr2 single mutant, and ngr1 / 2 double mutant. The mutant plants had the following mutations at the target sites of NGR1 and NGR2 genes, causing the translation of proteins to terminate prematurely. The base mutation type at the target site of the NGR1 gene was: -2bp, and the base mutation type at the target site of the NGR2 gene was: -5bp.

[0092] Example 4 Phenotypic Analysis of Mutant Materials

[0093] 1. Analysis of the root tilt angle of mutants

[0094] The wild type (Young) and mutant materials ngr1, ngr2 and ngr1 / 2 were planted in a transparent root box with a length of 40 cm, a width of 1.5 cm and a height of 50 cm. The root box was divided into two chambers, with the wild type material planted in the left chamber and the mutant material planted in the right chamber. The root box was placed with the seed surface facing downward and tilted at 60°. After growing in the greenhouse cultivation room for 15 days, the root system configuration of the mutant material was observed and its lateral root angle was measured with vertical downward as 0°.

[0095] The results are as follows Figure 5 As shown in the figure, the lateral root angles of ngr1, ngr2 and ngr1 / 2 are significantly larger than those of the wild type. The lateral root angles of the ngr1 mutant are close to 90°, the lateral root angles of the ngr2 mutant are almost perpendicular to the gravity direction at 90°, and the lateral root angles of ngr1 / 2 exceed 90° and grow toward the soil surface, showing an anti-gravity phenomenon.

[0096] 2. Determination of Phosphorus Content in Mutants

[0097] (1) Material planting (such as Figure 6 (shown)

[0098] The black rectangular flowerpot is 40.5cm long, 22cm wide and 21cm high, with a partition in the middle to divide the flowerpot into chambers. Three flowerpots are filled with low-phosphorus red soil, the lower layer is filled with 13cm low-phosphorus soil, which is irrigated with 1mM potassium dihydrogen phosphate Hogland nutrient solution, covered with 2cm thick perlite in the middle, and then covered with 5cm thick low-phosphorus red soil that has been irrigated with 1mM potassium dihydrogen phosphate Hogland nutrient solution. Three flowerpots are filled with low-phosphorus red soil, the lower layer is filled with 13cm low-phosphorus red soil, which is irrigated with phosphorus-deficient Hogland nutrient solution, covered with 2cm thick perlite in the middle, and then covered with 5cm thick low-phosphorus red soil that has been irrigated with phosphorus-deficient Hogland nutrient solution. Three flowerpots simulate the distribution of phosphorus in environmental soil, the lower layer is filled with 13cm low-phosphorus red soil, which is irrigated with phosphorus-deficient Hogland nutrient solution, covered with 2cm thick perlite in the middle, and then covered with 5cm thick low-phosphorus red soil that has been irrigated with 1mM potassium dihydrogen phosphate Hogland nutrient solution. Each treatment was mostly planted with wild-type (Young) soybeans on one side and transgenic strains on the other side. 20 seeds were evenly planted on each side, and seedlings with uniform growth were left after germination. Planted in a cultivation room with a photoperiod of day: night = 16h: 8h, a temperature of 21°C, and a relative humidity of 70%. The flower pot position was changed every five days, and Hoagland's nutrient solution was watered every other day. The high-phosphorus treatment tray was watered with 500mL of Hoagland's nutrient solution containing 1mM potassium dihydrogen phosphate, and 100mL of Hoagland's nutrient solution containing 1mM potassium dihydrogen phosphate was watered on the soil surface on both sides. The low-phosphorus treatment tray was watered with 500mL of phosphorus-deficient Hoagland's nutrient solution, and 100mL of phosphorus-deficient Hoagland's nutrient solution was watered on the soil surface on both sides. The simulated soil phosphorus distribution treatment tray was watered with 500mL of phosphorus-deficient Hoagland's nutrient solution, and 100mL of Hoagland's nutrient solution containing 1mM potassium dihydrogen phosphate was watered on the soil surface on both sides. One month after planting, the whole plant was collected for total phosphorus content determination.

[0099] (2) Sample preparation

[0100] First, wipe the surface impurities of the freshly collected plants with a wet cotton cloth, then rinse with clean water one to two times and quickly dry them. Next, cut the cleaned plants into pieces and weigh them in a glass dish that has been dried to a constant weight. After recording the data, quickly put the samples into a blast drying oven at 80℃ to 90℃ and bake for 15min to 30min to kill the green. After that, lower the temperature to 60℃ to 70℃ and continue drying until the plants become brittle. After the samples have cooled slightly, crush them immediately to ensure that all of them pass through the 0.25mm sieve, and finally seal them for storage for future use.

[0101] (3) Determination of moisture content

[0102] Weigh 2 g of the sample (accurate to 0.0001 g) from the collected plant samples, place it in a glass dish of known mass, and dry it in an oven at (105±2)°C for 2 h. After taking it out, immediately transfer it to a desiccator to cool to room temperature, weigh it, and calculate the moisture content.

[0103] (4) Test solution preparation

[0104] Accurately weigh 0.25g (accurate to 0.0001g) of the crushed and sieved sample and place it at the bottom of the digestion tube to ensure that the sample does not adhere to the tube wall. First, soak the sample with 3mL of distilled water, let it stand for 10min, then add 8mL of sulfuric acid and shake gently to mix evenly. Place a small curved-neck funnel at the mouth of the tube, cover it with a layer of plastic wrap, and let it stand overnight. Then, heat it at 250℃ in the digestion furnace for about 10min. When a large amount of white smoke comes out of the digestion tube, increase the temperature to 380℃ and continue heating until the digestion solution becomes a uniform brown-brown color. After the solution cools down slightly, start adding about 2mL of hydrogen peroxide dropwise to the bottom of the digestion tube and shake it evenly. Then, heat it to a slightly boiling state for about 10min, then remove it and cool it. Add 1mL of hydrogen peroxide again and continue digestion. This process needs to be repeated several times, and the amount of hydrogen peroxide added each time should be reduced gradually until the solution becomes clear. Finally, heat it again for more than 30min to ensure that the remaining hydrogen peroxide is completely decomposed. Remove the digestion tube, cool it to room temperature, and rinse the funnel with a small amount of distilled water to ensure that the washing solution flows into the digestion tube. Then, transfer the digestion solution to a 100mL volumetric flask, adjust the volume after cooling, and shake well. Finally, use phosphorus-free filter paper for dry filtration for subsequent determination.

[0105] (5) Test solution determination

[0106] Take 5.00mL of the test solution obtained from (4), place it in a 50mL volumetric flask, and add water to about 30mL mark. Next, add 2 drops of dinitrophenol indicator and carefully adjust with sodium hydroxide solution or sulfuric acid solution until the solution appears slightly yellow. Subsequently, add 5.00mL of molybdenum antimony anti-color developer and make up to the mark with distilled water. Let this solution stand for 30 minutes in an environment above 20°C to ensure that the color development reaction is complete. Finally, use an enzyme marker to adjust the zero point according to the zero point of the standard curve at a wavelength of 700nm, and then perform a colorimetric determination.

[0107] (6) Blank sample

[0108] Except for not adding the sample, the remaining operations are carried out according to the provisions of steps (4) and (5).

[0109] (7) Standard curve drawing

[0110] Accurately pipette 0.00mL, 1.00mL, 2.00mL, 4.00mL, 6.00mL, 8.00mL, and 10.00mL of phosphorus standard solution into their respective 50mL volumetric flasks. Subsequently, add the same volume of blank digestion solution as that used in the sample determination to each volumetric flask, and add water to about 30mL. Next, add 2 drops of dinitrophenol indicator and carefully adjust with sodium hydroxide solution or sulfuric acid solution so that the solution just turns slightly yellow. Then, add 5.00mL of molybdenum antimony anti-coloring agent to each volumetric flask and dilute to the scale with distilled water. The concentrations of this series of standard solutions are 0.00mg / L, 0.10mg / L, 0.20mg / L, 0.40mg / L, 0.60mg / L, 0.80mg / L, and 1.00mg / L, respectively. After completing the determination of the absorbance value, draw a standard curve based on these data for subsequent analysis.

[0111] (9) Result calculation

[0112] The total phosphorus (P) content in the plant is expressed as mass fraction (g / kg) and calculated according to the following formula

[0113]

[0114] Where:

[0115] ρ—Phosphorus concentration in the colorimetric solution obtained from the standard curve, in milligrams per liter (mg / L);

[0116] ρ0—Phosphorus concentration in blank sample obtained from standard curve, in milligrams per liter (mg / L);

[0117] V—measured volume, in milliliters (mL);

[0118] D—dispensing multiple, the ratio of fixed volume to dispensing volume;

[0119] 10 -3 —mL to L conversion factor;

[0120] m—sample mass, in grams (g)

[0121] f—Moisture content of the sample.

[0122] The results of parallel determinations were expressed as arithmetic means with two decimal places retained.

[0123] (10) Results Analysis

[0124] The results of phosphorus content determination of mutants are as follows Figure 7As shown, after analysis, it was found that there was no significant difference in the phosphorus absorption efficiency of the mutant material in low-phosphorus (-P) and normal phosphorus (+P) environments, but the phosphorus absorption efficiency in the growth environment (+P / -P) simulating the phosphorus content distribution in the natural environment was significantly higher than that of the wild type (Young), indicating that the mutant material can efficiently absorb phosphorus in a growth environment simulating the phosphorus content distribution in the natural environment.

[0125] The experiment of the present invention proves that soybean genes NGR1 and / or NGR2 can regulate the anti-gravity growth of soybean lateral roots. The conservative domains of soybean NGR1 and / or NGR2 genes are edited and knocked out by CRISPR / Cas9 technology, so that the target gene mutates and the translation protein is terminated prematurely, thereby obtaining a mutant material with a functional loss of the target gene. The mutant material is found to have anti-gravity growth of its lateral roots, that is, a root system configuration in which the lateral roots grow toward the sky and the main root grows downward. At the same time, the mutant material has a stronger phosphorus absorption efficiency than the wild type (Young) in a growth environment simulating the distribution of phosphorus content in the natural environment, which provides new materials for the breeding of shallow root phosphorus efficient soybean varieties.

Claims

1. Application of soybean genes NGR1 and / or NGR2 in regulating the anti-gravity growth of soybean lateral roots, characterized in that: The nucleotide sequence of NGR1 is shown in SEQ ID No.1; the nucleotide sequence of NGR2 is shown in SEQ ID No.

2.

2. Application of soybean genes NGR1 and / or NGR2 in cultivating shallow-rooted soybeans with lateral roots growing against gravity, characterized in that: The nucleotide sequence of NGR1 is shown in SEQ ID No.1; the nucleotide sequence of NGR2 is shown in SEQ ID No.

2.

3. Use of an agent for knocking out soybean genes NGR1 and / or NGR2 in cultivating shallow-rooted soybeans with lateral roots growing against gravity, characterized in that: The nucleotide sequence of NGR1 is shown in SEQ ID No.1; the nucleotide sequence of NGR2 is shown in SEQ ID No.

2.

4. A method for producing shallow root soybeans, characterized in that: The genes NGR1 and / or NGR2 in soybean are knocked out to obtain mutant materials with loss of function of the target gene.

5. The method according to claim 4, characterized in that: The knockout method is to perform gene editing on the conserved domains of soybean genes NGR1 and / or NGR2 using CRISPR / Cas9 technology, so that the target gene mutates, resulting in premature termination of translation protein, and obtaining a mutant material with loss of target gene function.

6. The method according to claim 5, characterized in that: The knockout target of the NGR1 conserved domain is sgRNA1 and / or sgRNA2; the nucleotide sequences of sgRNA1 and sgRNA2 are shown in SEQ ID No.3-4.

7. The method according to claim 5, characterized in that: The knockout target of the NGR2 conserved domain is sgRNA3 and / or sgRNA4; the nucleotide sequences of sgRNA3 and sgRNA4 are shown in SEQ ID No.5-6.

8. The method according to claim 6, characterized in that: The sequences of the knockout target sgRNA1 and sgRNA2 amplification primers are shown in SEQ ID Nos. 7 to 10.

9. The method according to claim 7, characterized in that: The sequences of the knockout target sgRNA3 and sgRNA4 amplification primers are shown in SEQ ID Nos. 11 to 14.

10. The method according to any one of claims 4 to 9, characterized in that: The steps include: 1) synthesizing the target gene fragments of soybean NGR1 and / or NGR2, connecting the target gene fragments to the CRISPR / Cas9 vector, constructing a recombinant plasmid containing the target gene fragments, transforming Agrobacterium, and obtaining Agrobacterium containing the recombinant plasmid containing the target gene fragments; 2) Infecting soybean explants with the Agrobacterium solution containing the recombinant vector in step 1), and after continuous breeding, screening for strains that do not contain Cas9 protein and whose NGR1 and / or NGR2 genes have been successfully edited and are homozygous, to obtain homozygous transgenic strains.

Images