Salt-tolerant gene 3867 as well as encoding protein and application thereof

Abstract

The invention provides a salt-tolerant gene 3867 as well as an encoding protein and application thereof, and belongs to the technical field of gene engineering. The salt-tolerant gene 3867 disclosed by the invention is as shown in SEQ ID NO. 1, and is derived from bacillus paralicheniformis NJ102; the amino acid sequence of the protein coded by the salt-tolerant gene 3867 is as shown in SEQ ID NO. 2. After the salt-tolerant gene 3867 disclosed by the invention is over-expressed in the bacillus subtilis 168, the salt tolerance of the bacillus subtilis 168 can be remarkably improved. The salt-tolerant gene 3867 is inserted into an overexpression vector to construct the overexpression vector, and then the overexpression vector is transformed into engineering bacteria, so that a new strain with salt tolerance can be obtained, and the method has important significance on development of the new strain with salt tolerance.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a salt-tolerant gene 3867 and its encoded protein and application. Background Art

[0002] Soil salinization is an environmental challenge that the world is currently facing. Soil salinization can lead to low fertility, low and unstable crop yields, and great obstacles to agricultural production. At present, with the increasing demand for food and the shortage of arable land resources, the improvement of saline-alkali land has become an urgent need. The development and utilization of moderately and lightly salinized soils is of great significance to the development of agricultural production and the improvement of the ecological environment.

[0003] Plant growth-promoting rhizobacteria (PGPR) refers to a large class of bacteria that colonize near the root system of plants and have the function of promoting plant growth or inhibiting plant pathogens. PGPR can promote plant growth by improving the availability of nutrients in the rhizosphere of plants, producing volatile gases, regulating plant hormone levels, etc. through various mechanisms. At present, the most studied salt-tolerant growth-promoting bacteria are Pseudomonas and Bacillus. As an important growth-promoting bacteria, Bacillus has the characteristics of high bacterial reproduction coefficient, good effect, long shelf life of preparations and strong stress resistance. It is one of the excellent microbial fertilizer strains. The existing technology has little research on salt-tolerant genes. Therefore, it is crucial to explore and utilize salt-tolerant genes. Summary of the invention

[0004] The purpose of the present invention is to provide a salt-tolerant gene 3867 and its encoded protein and application.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a salt-tolerant gene 3867, and the nucleotide sequence of the salt-tolerant gene 3867 is shown in SEQ ID NO.1.

[0007] Preferably, the salt-tolerance gene 3867 is derived from Bacillus paralicheniformis NJ102, which is deposited in the General Microbiology Center of China National Microbiological Culture Collection Committee with a deposit number of CGMCC No. 31983, a deposit date of September 14, 2024, and a deposit address of No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0008] The present invention also provides a protein encoded by the salt-tolerant gene 3867, and the amino acid sequence of the protein is shown in SEQ ID NO.2.

[0009] The present invention also provides the use of the salt-tolerant gene 3867 in preparing one or more of a recombinant expression vector, an expression cassette, a transformant and a recombinant bacterium.

[0010] The present invention also provides the salt-tolerant gene 3867 and a basic vector.

[0011] Preferably, the basic vector comprises a pBES vector.

[0012] The present invention also provides a method for constructing the recombinant expression vector, and inserting the salt-tolerant gene 3867 into a basic vector to obtain the recombinant expression vector.

[0013] The present invention also provides a cell comprising the recombinant expression vector.

[0014] Preferably, the cells comprise microbial cells.

[0015] The present invention also provides the use of the salt-tolerant gene 3867 in improving the salt-tolerant ability of microorganisms and / or preparing salt-tolerant strains.

[0016] By adopting the above technical scheme, the present invention has the following beneficial effects: the salt-tolerant gene 3867 of the present invention is shown in SEQ ID NO.1, which is derived from Bacillus paralicheniformis NJ102; the amino acid sequence of the protein encoded by the salt-tolerant gene 3867 is shown in SEQ ID NO.2. After the salt-tolerant gene 3867 of the present invention is overexpressed in Bacillus subtilis 168, the salt tolerance of Bacillus subtilis 168 can be significantly improved. Inserting the salt-tolerant gene 3867 into an overexpression vector to construct an overexpression vector, and then transforming the overexpression vector into an engineered bacterium, a new strain with salt tolerance can be obtained, which is of great significance for the development of new salt-tolerant strains. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The figures are the results of the target gene Escherichia coli transformant verification and the target gene Bacillus subtilis transformant verification; A is the pBES-3867 Escherichia coli transformant verification, lanes 1-7 are pBES-3867 Escherichia coli transformants, and N is the negative control (sterile water is used as a template); B is the overexpression strain 168 / pBES:3867 transformant verification, lanes 1-9 are 168 / pBES:3867 Bacillus subtilis transformants, P is the positive control (using the plasmid containing pBES-3867 as a template), and N is the negative control (sterile water is used as a template).

[0018] Figure 2The RT-PCR verification results of whether the 3867 gene can be transcribed in the 168 / pBES:3867 recombinant strain; 1: amplification using the cDNA of the strain 168 / pBES:3867 as a template; 2: amplification using the cDNA of the strain 168 / pBES as a template; N is the negative control (sterile water as a template).

[0019] Figure 3 The expression of 3867 gene in 168 / pBES:3867 overexpression strain under salt stress; "*" between treatments indicates the significance between the treatment group and the control group after t-test (P≤0.05).

[0020] Figure 4 The figure is a Western blot of heterologous expression of protein 3867.

[0021] Figure 5 These are graphs showing the salt tolerance of the 168 / pBES:3867 overexpression strain. AB: Salt tolerance of the 168 / pBES:3867 overexpression strain under 9.5% and 10.5% NaCl salt stress, respectively; CD: Growth curve of the 168 / pBES:3867 overexpression strain under 9.5% and 10.5% NaCl salt stress.

[0022] Figure 6 The number of colonies formed by the 168 / pBES strain and the 168 / pBES:3867 strain under salt stress.

[0023] Figure 7 The hydrophilicity / hydrophobicity prediction results of 3867 proteins.

[0024] Figure 8 Prediction results for transmembrane domains of 3867 proteins.

[0025] Fig. 9 Signal peptide prediction results for 3867 proteins.

[0026] Fig.10 The figure shows the qRT-PCR detection results of the differential gene expression between the 168 / pBES strain and the 168 / pBES:3867 strain. The "*" between the treatments indicates the significance between the treatment group and the control group after the t-test (P≤0.05). DETAILED DESCRIPTION

[0027] The present invention provides a salt-tolerant gene 3867, and the nucleotide sequence of the salt-tolerant gene 3867 is shown in SEQ ID NO.1.

[0028] SEQ ID NO.1:

[0029]

[0030] The salt-tolerance gene 3867 of the present invention is derived from Bacillus paralicheniformis NJ102, and the Bacillus paralicheniformis NJ102 is deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration, with a deposit number of CGMCC No.31983, a deposit date of September 14, 2024, and a deposit address of No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0031] The present invention also provides a protein encoded by the salt-tolerant gene 3867, and the amino acid sequence of the protein is shown in SEQ ID NO.2.

[0032] SEQ ID NO.2:

[0033] .

[0034] The present invention also provides the use of the salt-tolerant gene 3867 in preparing one or more of a recombinant expression vector, an expression cassette, a transformant and a recombinant bacterium.

[0035] The present invention also provides the salt-tolerant gene 3867 and a basic vector.

[0036] Preferably, the basic vector comprises a pBES vector.

[0037] The present invention also provides a method for constructing the recombinant expression vector, and inserting the salt-tolerant gene 3867 into the basic vector to obtain the recombinant expression vector.

[0038] The present invention also provides a cell comprising the recombinant expression vector.

[0039] Preferably, the cells comprise microbial cells.

[0040] The present invention also provides the use of the salt-tolerant gene 3867 in improving the salt-tolerant ability of microorganisms and / or preparing salt-tolerant strains.

[0041] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0042] Example 1.3867 gene salt tolerance verification

[0043] 1. Construction of a sodium transporter overexpression strain

[0044] The genome of Bacillus paralicheniformis NJ102 was used as an amplification template and primers 3867-F and 3867-R were used to amplify a fragment of 1629 bp, which was the CDS sequence of the 3867 gene.

[0045] 3867-F: AGCAAAAGGAGAGGGACGCGTATGAATTATGCTGAGAAGAAAAAAAACT(SEQ IDNO.3);

[0046] 3867-R: CAGGTCGACAAGCTTGAATTCTTAAGCCGCGCGATCGTC (SEQ ID NO. 4).

[0047] The pBES plasmid was double-digested with MluI and EcoR I, and then the 3867 gene fragment was connected to the pBES vector (purchased from the BioVector plasmid vector strain cell protein antibody gene storage center; the vector itself contains a strong promoter). The ligation product was transferred into E. coli Top10 competent cells and cultured in a 37°C incubator overnight; colony PCR verification was performed the next day, and the transformants with the correct band size were sequenced, and finally the pBES-3867 vector with correct sequencing was obtained.

[0048] Genetic transformation of Bacillus subtilis 168: (1) Pick a single colony of Bacillus subtilis 168 and inoculate it into 20 mL LB liquid medium and culture it at 37°C and 200 rpm overnight. (2) Take 800 μL of the culture solution and inoculate it into 25 mL SPI medium in a 50 mL conical flask and culture it at 37°C and 200 rpm in a shaking incubator. Start measuring OD after 2 hours. 600 When the culture reached the end of logarithmic growth phase (OD 600 =1.0), quickly pipette 2.5mL of bacterial solution into 25mL of SPII medium, and culture at 37℃ and 100rpm shaking for 1.5h. (3) Add 250μL of 100×EGTA solution, continue to culture at 37℃ and 100rpm shaking for 10min, and then divide into sterilized 1.5mL EP tubes, 500μL per tube. (4) Add 1μg of pBES-3867 vector plasmid to the centrifuge tube, mix gently, and culture at 37℃ and 100rpm shaking for 30min, and then continue to culture at 200rpm shaking for 1.5h. (5) Collect the bacteria by centrifugation at 4000rpm for 2min, discard an appropriate amount of supernatant, keep 100μL of resuspended bacteria, spread on kanamycin LB plate, and culture at 37℃ overnight (16h) until a single clone grows; observe the growth of the bacteria, pick a single clone, and perform colony PCR verification. The results are as follows: Figure 1 The Bacillus subtilis transformants with the correct band size were sequenced, and finally the correct overexpression strain 168 / pBES:3867 was obtained. At the same time, the pBES empty vector was transformed into the Bacillus subtilis 168 cells to obtain the 168 / pBE strain for later use.

[0049] Example 2. Verification of heterologous expression of 3867 gene at the transcriptional level

[0050] RNA extraction and cDNA reverse transcription of 3867 gene overexpression strain: Activate glycerol strains of strain 168 / pBES and strain 168 / pBES:3867 in solid culture medium containing kanamycin, and culture at 37°C overnight. After single colonies grow, pick single colonies of strain 168 / pBES and strain 168 / pBES:3867, inoculate them in 20mL LB liquid culture medium, culture at 200r / min, 37°C overnight; collect bacteria, and adjust the concentration of bacterial suspension of each strain to the same (OD 600 =1.0), the cells were collected, RNA was extracted using a bacterial RNA extraction kit (Beijing Zhuangmeng International Biogene Technology Co., Ltd.), and cDNA was extracted using cDNA was synthesized using a cDNA synthesis kit (Nanjing Novozyme Biotechnology Co., Ltd.), and RT-PCR was performed to obtain cDNA. The gel electrophoresis results were as follows: Figure 2As shown, the gel electrophoresis results showed that the 3867 gene was transcribed normally in Bacillus subtilis 168.

[0051] Expression of 3867 gene (sodium ion transporter gene) overexpression strain under salt stress: simulate 13% NaCl high salt stress environment, take 1% NaCl growth environment as control, extract RNA of overexpression strain 168 / pBES:3867 under different growth environments, verify the expression of 3867 gene under different salt stress by qRT-PCR technology, use rpsj gene as internal reference, and the primer encoding 3867 gene is: F: GGGAAACCTGTTTTGGAACTG (SEQ ID NO.5);

[0052] R: CCGATTTTGCCGAAAGAACG (SEQ ID NO.6);

[0053] The primers encoding the rpsj gene are:

[0054] F: GTATCTGGTCCGATTCCGTTG (SEQ ID NO.7);

[0055] R: GTGTTGGGTTCACAATGTCG (SEQ ID NO. 8). The reaction system is shown in Table 1:

[0056] Table 1 Reaction system

[0057]

[0058]

[0059] The qRT-PCR reaction was performed on a QS5 fast real-time PCR detection system with the following program: 95°C, 30 s; 95°C, 5 s; 60°C, 34 s; 40 cycles. The relative expression of all genes was calculated based on 2 -ΔΔCT The method was used for computational analysis, and each treatment was repeated three times. Figure 3 The results showed that under 13% NaCl high salt stress, the sodium ion transporter encoding gene gene3867 was significantly up-regulated, with an up-regulation of 14.59-18.17 times.

[0060] Example 3. Verification of heterologous expression of 3867 gene at the protein level

[0061] Protein immunoblotting to verify heterologous expression of 3867 gene: A Flag tag was added in front of the target gene 3867 by primer synthesis. The primers are as follows:

[0062] 3867-FLAG-F:

[0063] AGGAGAGGGACGCGTatgGATTACAAGGACGACGATGACAAGATGA ATTATGCTGAGAAG(SEQ IDNO.9);

[0064] 3867-FLAG-R:

[0065] CAGGTCGACAAGCTTGAATTCAGCCGCGCGATCGTCTTT (SEQ ID NO. 10);

[0066] Then, a FLAG tag was fused to the N-terminus of the 3867 protein, and the total protein of strain 168 / pBES:3867 was extracted for western blotting experiments.

[0067] (1) Preparation of total bacterial protein: Take 1 mL of the bacterial suspension of 168 / pBEs and 168 / pBES:3867 recombinant bacteria cultured for 24 hours, centrifuge at 12000 rpm for 2 minutes, remove the supernatant, place each bacterial cell on ice, add 150 μL of lysis solution, 10 μL of lysozyme and 1 μL of PMSF (so that the final concentration of PMSF is 1 mM), mix by pipetting, and lyse on ice for 10 minutes. After sufficient lysis, centrifuge at 12000 rpm for 3 minutes, take 50 μL of supernatant and add 50 μL of colorimetric drug, boil in water bath for 5 minutes to obtain crude protein samples, and store in a -20°C refrigerator.

[0068] (2) SDS-PAGE polyacrylamide gel electrophoresis: Prepare the separation gel and the stacking gel separately. When the stacking gel is completely polymerized, fix it on the electrophoresis tank, add glycine electrophoresis buffer, and carefully remove the comb. Add the samples in order and set the constant voltage mode for electrophoresis. Electrophoresis conditions: Start with a constant voltage of 74V for 30min and then switch to a constant voltage of 100V. When bromophenol blue disappears under the action of voltage, transfer to the membrane.

[0069] (3) Transfer: Cut the gel according to the marker and the position of the target band. Immerse the PVDF membrane in methanol for 5 seconds on both sides, and then immerse it in transfer buffer for 15 seconds on both sides to prepare a "sandwich": follow the following order: fiber pad - filter paper - gel - PVDF membrane - filter paper - fiber pad. Note: Align each item to ensure there are no bubbles. Cover the lid, put it in the transfer tank, pour in transfer buffer, turn on the electrophoresis instrument, and keep it at a constant current of 400mA for 1.5h. Connect one side of the PVDF membrane to the positive electrode (red) and the other side of the gel to the negative electrode (black).

[0070] (4) Membrane blocking and antibody incubation: 1g skim milk powder is added to 20mL TBST blocking solution and incubated at room temperature for 2h, then Flag primary antibody is added and shaken slowly at room temperature for 2h. The primary antibody is recovered and can be reused. Wash the membrane 3 times with 15mL TBST, 10 minutes each time. Add fluorescent secondary antibody (shake gently at room temperature for 1.5h). Wash the membrane 3 times with 15mL TBST, 10 minutes each time, and scan the membrane. The results are as follows: Figure 4 A band of 50 KDa can be seen from the protein immunoblot, indicating that the 3867 protein was successfully heterologously expressed.

[0071] Example 4. Determination of salt tolerance of strains overexpressing the 3867 gene (sodium ion transporter gene)

[0072] Single colonies of strain 168 / pBES and strain 168 / pBES:3867 were picked up respectively, inoculated into 20 mL LB liquid medium, and cultured overnight at 200 r / min and 37°C; the bacteria were collected, and the concentration of the bacterial suspension of each strain was adjusted to the same (OD 600 =1.0); 5 μL of bacterial solution was aspirated and plated on LB solid medium containing 9.5%, 10.5%, and 11.5% NaCl, and cultured at 37°C; after 24-96 hours, the growth of the bacteria under salt stress was observed. The results were as follows Figure 5 As shown. Figure 5 It can be seen that under the salt stress of 10.5% NaCl, the colony number of strain 168 / pBES:3867 was significantly greater than that of strain 168 / pBES, indicating that gene3867 can significantly improve the ability of Bacillus subtilis 168 to tolerate salt stress.

[0073] Example 5. Determination of colony formation quantity of recombinant strain 68 / pBES:3867 under salt stress

[0074] Single colonies of strain 168 / pBES and strain 168 / pBES:3867 were picked and inoculated into 20 mL LB liquid medium at 200 r / min and 37°C overnight. The concentration of the bacterial suspension was adjusted to a uniform value (OD 600 =1.0), transferred to liquid LB medium containing 9% NaCl, and after 24 hours, 100 μL of bacterial suspension was transferred to a sterilized centrifuge tube containing 900 μL of sterile water, and mixed evenly with a vortex oscillator to obtain a bacterial solution diluted 10 times; according to the above steps, the 10-fold diluted bacterial solution was obtained in turn. 2 -10 4 times of bacterial liquid; 10 μL of bacterial suspension of each concentration gradient was taken and plated onto LB solid medium containing kanamycin resistance, cultured at 37°C, and the number of bacteria formed by each strain was observed and calculated after 24 hours. The results are as follows Figure 6The results showed that at 24 h, the number of colonies formed by strain 168 / pBES:3867 reached 8×10 6 CFU / mL, while the number of colonies formed by strain 168 / pBES was only 7.8×10 5 CFU / mL, the number of colonies formed by strain 168 / pBES:3867 was greater than that formed by strain 168 / pBES, which further proved that 3867 protein could improve the salt tolerance of Bacillus subtilis 168.

[0075] Example 6. Prediction of the structure of sodium ion transporter 3867 protein

[0076] The online tools Deep TMHMM (https: / / dtu.biolib.com / DeepTMHMM) and SMART (http: / / smart.embl-heidelberg.de / ) were used to predict and analyze the structure of 3867 protein (sodium ion transporter protein) sequences (the higher the amino acid score, the stronger its hydrophobicity). The results are as follows Figure 7 , 8 , as shown in Figure 9.

[0077] Analysis results: 3867 protein has 14 regions with strong hydrophobicity, and the rest of the regions are strong hydrophilicity. The transmembrane domain of the protein was predicted, and it was found that the protein contains 14 transmembrane regions, of which 7 transmembrane regions are concentrated after the N-terminus and before the middle region, and the remaining 7 transmembrane domains are concentrated after the middle region and before the C-terminus. The N-terminus and the middle region are intracellular, and the C-terminus region is concentrated outside the cell. The results are consistent with the hydrophilicity / hydrophobicity analysis results. The signal peptide of the protein was predicted, and the results showed that the protein has no signal peptide. In short, the 3867 protein is a transmembrane protein with 14 transmembrane domains without a signal peptide, the transmembrane region is a hydrophobic region, and the non-transmembrane region is a hydrophilic region.

[0078] Example 7. qRT-PCR verification of differential gene expression between 168 / pBES and 168 / pBES:3867 under salt stress

[0079] RNA extraction and cDNA reverse transcription of strains 168 / pBES and 168 / pBES:3867: Activate the glycerol bacteria of 168 / pBES and 168 / pBES:3867, culture them at 37°C overnight, and after a single colony grows on the plate, pick a single colony and put it into LB liquid culture medium, culture it at 37°C, 200r / min, overnight; when the concentration of the bacterial suspension is OD 600 =1.0, transfer the bacterial suspension to 20 mL of 10% NaCl medium at 1% and culture until the concentration of the bacterial suspension of 168 / pBES and 168 / pBES:3867 reaches OD600＝ At 1.0, the cells were collected and RNA was extracted. RNA extracted from 168 / pBES and 168 / pBES:3867 at 10% NaCl was extracted using a bacterial RNA extraction kit (OMEGA Bio-tek, Inc.), and cDNA was extracted from cDNA synthesis kit (Applied Biological Materials, Inc.) was used for synthesis.

[0080] Under 10% NaCl salt stress environment, RNA of 168 / pBES and 168 / pBES:3867 bacteria was extracted respectively, and the differential expression of functional genes related to salt stress tolerance in Bacillus subtilis 168 was verified by qRT-PCR technology, and the key way for 3867 protein to improve 168 tolerance to salt stress was speculated. In order to clarify the expression pattern of differential genes between strain 168 / pBES and 3867 gene overexpression strain 168 / pBES:3867 under salt stress, 15 genes related to salt stress in Bacillus subtilis 168 were selected, as shown in Table 2. qRT-PCR experiments were performed with rpsj gene as the internal reference gene to verify the differential expression of these genes in strain 168 / pBES and strain 168 / pBES:3867, and three biological replicates were performed for each treatment.

[0081] Table 2 Salt tolerance related genes

[0082]

[0083] Fifteen salt-tolerance pathway-related genes, putB, gltB, bmrD, ahpA, cimH, ydfj, nhaK, maeN, yoaW, mcpA, yhaQ, putP, katE, sodA, and yflt, were detected, and the rpsj gene was used as an internal reference. The detection primers are shown in Table 3.

[0084] Table 3 Detection primers

[0085]

[0086]

[0087] The qRT-PCR reaction was performed on a QS5 fast real-time PCR detection system with the following program: 95°C, 30 s; 95°C, 5 s, 60°C, 34 s; 40 cycles. The relative expression of all genes was calculated based on 2 -ΔΔCT The calculation results are as follows Fig.10 shown.

[0088] The results showed that under salt stress, the Na + / malate symporter (Na + / malate symporter)maeN was upregulated by 1.65-1.80 times. This transporter can maintain the osmotic pressure balance inside and outside the bacterial cells by transporting substances such as sodium ions and malic acid, thereby protecting the growth of Bacillus subtilis 168. The key regulatory gene yoaW for biofilm formation was upregulated by 2.54-3.22 times, and gltB was upregulated by 9.02-9.45 times; the methyl accepting chemotactic protein encoding gene mcpA was upregulated by 1.95-2.50 times; the ABC transporter bmrD was upregulated by 2.50-3.20 times; the proline permease encoding gene putP was upregulated by 2.12-2.23 times; in addition, the catalase encoding gene katE and the stress regulatory protein yflt were upregulated by 2.30-2.80 times and 2.34-2.75 times, respectively. This shows that the 3867 gene can maintain the growth of Bacillus subtilis 168 by regulating the stress under salt stress, and the peroxidase can reduce the damage to cells caused by salt stress by clearing the large amount of ROS produced by the bacteria under adversity, thereby protecting the growth of the bacteria under salt stress.

[0089] From the above examples, it can be seen that the present invention provides a salt-tolerant gene 3867 and its encoded protein and application. After the salt-tolerant gene 3867 of the present invention is overexpressed in Bacillus subtilis 168, the salt tolerance of Bacillus subtilis 168 can be significantly improved, which is of great significance for the development of new salt-tolerant strains.

[0090] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A salt tolerance gene 3867, characterized in that: The nucleotide sequence of the salt-tolerance gene 3867 is shown in SEQ ID NO.

1.

2. The salt-tolerant gene 3867 according to claim 1, characterized in that: The salt-tolerance gene 3867 is derived from Bacillus paralicheniformis NJ102, which is deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration, with a deposit number of CGMCC No.31983, a deposit date of September 14, 2024, and a deposit address of No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

3. A protein encoded by the salt-tolerant gene 3867 according to claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

2.

4. Use of the salt-tolerance gene 3867 according to claim 1 in preparing one or more of a recombinant expression vector, an expression cassette, a transformant and a recombinant bacterium.

5. A recombinant expression vector, characterized in that: It comprises the salt-tolerant gene 3867 and a basic vector as described in claim 1.

6. The recombinant expression vector according to claim 5, characterized in that The basic vector includes a pBES vector.

7. The method for constructing the recombinant expression vector according to claim 5 or 6, characterized in that: The salt-tolerance gene 3867 was inserted into the basic vector to obtain a recombinant expression vector.

8. A cell comprising the recombinant expression vector according to claim 5 or 6.

9. The cell according to claim 8, characterized in that The cells include microbial cells.

10. Use of the salt-tolerant gene 3867 according to claim 1 in improving the salt tolerance of microorganisms and / or preparing salt-tolerant strains.

Images