Application of CtCYP81D2 gene in improving quercetin content of safflower variety

Abstract

The invention discloses application of a CtCYP81D2 gene in improving quercetin content of a safflower variety, and belongs to the technical field of biology. Mutagenesis treatment is carried out on a Jinhong No.1 safflower variety through a cobalt-60 mutagenesis technology to obtain 42 safflower strains with genetic stability; the content of quercetin in different varieties of safflower is compared and analyzed, RNA is extracted from safflower petals with different contents, cDNA is subjected to reverse transcription, the expression quantity of key enzyme genes in a safflower flavone synthesis route is analyzed, and the result shows that in an M9 strain with high quercetin content, CtCYP81D2 gene expression in cytochrome P450 oxidase is remarkably up-regulated. The research finds that the quercetin content of the transient silencing CtCYP81D2 gene is obviously reduced, and the quercetin content of the overexpressed CtCYP81D2 gene is obviously improved. The method can be used for breeding and cultivation of safflower with high quercetin content, and development in medicines, cosmetics and health food.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of CtCYP81D2 gene in improving the quercetin content of safflower varieties. Background Art

[0002] Quercetin is a natural flavonoid compound widely found in many plants and has attracted widespread attention due to its significant biological activity. Studies have shown that quercetin has a variety of health benefits such as antioxidant, anti-inflammatory, anti-tumor, and cardiovascular protection, and is therefore widely used in medicine, health foods, and functional foods. In recent years, with people's attention to healthy diet and natural therapy, the market demand for plant materials rich in quercetin has continued to grow.

[0003] Safflower (Carthamus tinctorius L.), as an important economic crop, not only has a long history of application in traditional Chinese medicine, but also its petals are rich in a variety of active ingredients, including pigments, fatty acids and polyphenol compounds, among which quercetin is one of the important components of safflower. Safflower is not only used as a dye and food, but also as a Chinese medicinal material, with the effects of promoting blood circulation, removing blood stasis, detoxifying and reducing swelling. Therefore, increasing the content of quercetin in safflower is of great significance to improving its economic value and medicinal value.

[0004] However, there are still some shortcomings in the current research on safflower quercetin. First, although some studies have explored the extraction methods of quercetin in safflower, there is still a lack of systematic comparison of the quercetin content in different varieties of safflower. Secondly, in the breeding process of safflower, a systematic and standardized quercetin content assessment method has not yet been formed, which makes the cultivation and screening of new germplasm difficult. Finally, the quercetin content of existing safflower varieties is generally low and cannot meet the market demand for high-quercetin plant materials.

[0005] Therefore, it is particularly important to develop a new safflower breeding method, especially an efficient screening and extraction technology for quercetin content. The present invention aims to select safflower varieties rich in quercetin by optimizing the extraction method and liquid chromatography conditions to achieve efficient utilization and value enhancement of safflower. This can not only provide theoretical support for the industrial development of safflower, but also provide new perspectives and methods for research in related fields.

[0006] In summary, in response to the current demand for increasing the quercetin content in safflower and the shortcomings of the existing technology, the present invention proposes a new safflower breeding method, in order to provide strong support for the development of related industries. Summary of the invention

[0007] The purpose of the present invention is to solve the above problems and provide the application of CtCYP81D2 gene in increasing the quercetin content of safflower varieties.

[0008] CtCYP81D2 gene, the base sequence of which is shown in SEQ ID NO.1 in the sequence listing;

[0009] A plant expression vector pGreenIISK-CtCYP81D2 is obtained by inserting the CtCYP81D2 gene into pGreenIISK.

[0010] The CtCYP81D2 gene is used to increase the quercetin content of safflower varieties.

[0011] The present invention provides an application of CtCYP81D2 gene in improving the quercetin content of safflower varieties. By using cobalt 60 mutagenesis technology, the Jihong No. 1 safflower variety is mutagenized to obtain 42 genetically stable safflower strains; by comparing and analyzing the quercetin content of safflowers of different varieties, RNA is extracted from safflower petals with different contents, cDNA is reversely transcribed, and the expression of key enzyme genes in the safflower flavonoid synthesis pathway is analyzed. The results show that in the M9 strain with high quercetin content, the expression of CtCYP81D2 gene in cytochrome P450 oxidase is significantly upregulated. Studies have found that the quercetin content is significantly reduced by transiently silencing the CtCYP81D2 gene, and the quercetin content is significantly increased by overexpressing the CtCYP81D2 gene. It can be used for breeding and cultivation of safflowers with high quercetin content, as well as development in medicine, cosmetics and health foods. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 HPLC determination results of quercetin standard;

[0013] Figure 2 HPLC determination results of quercetin content in M9 safflower strain;

[0014] Figure 3 HPLC determination results of quercetin content in M28 safflower strain;

[0015] Figure 4 Figure 1. Electrophoresis results of RNA extraction from safflower petals;

[0016] Figure 5 PCR electrophoresis of CtCYP81D2 gene;

[0017] Figure 6 The expression level of CtCYP81D2 in the two strains;

[0018] Figure 7 PCR identification of bacterial solution of plant expression vector of CtCYP81D2 gene;

[0019] Figure 8 Transient silencing of safflower CtCYP81D2 gene and determination of quercetin content;

[0020] Fig. 9 Transient overexpression of safflower CtCYP81D2 gene and determination of quercetin content. DETAILED DESCRIPTION

[0021] Example 1 HPLC determination of quercetin content in safflower varieties

[0022] 1. Extraction Method

[0023] 1.1 Material preparation

[0024] The safflower variety Jihong No. 1 was induced with cobalt 60 mutagenesis technology to obtain 42 genetically stable safflower lines; 30 safflower varieties were selected for HPLC determination of quercetin content, and 0.1 g of safflower petals were weighed for each line and processed using a high-speed mill. 0.1 g of safflower petals were weighed for each variety for subsequent processing.

[0025] 1.2 Grinding

[0026] Grind the safflower petals thoroughly to improve the extraction efficiency. The grinding degree should be based on the principle of ensuring the fineness of the petals, and use a high-speed mill for processing.

[0027] 1.3 Solvent extraction

[0028] 90% methanol was used as the extraction solvent. The specific operation steps are as follows:

[0029] Add the ground safflower petals to a container and add 90% methanol to make up to 10 mL;

[0030] Ultrasonic extraction was performed at 55°C, the ultrasonic time was 60 min, and the ultrasonic power was set to 200 W;

[0031] After the extraction is completed, soak overnight to fully dissolve the active ingredients;

[0032] Concentrate the extract by rotary evaporation to 2 mL;

[0033] The extract was filtered through a 0.45 µm membrane filter to obtain the upper layer for subsequent liquid chromatography analysis.

[0034] 2. Liquid chromatography conditions

[0035] 2.1 Column selection

[0036] Agilent XDB-C18 column (250 mm × 4.6 mm, 5 μm) was selected as the separation column, which is suitable for the separation of flavonoids such as quercetin.

[0037] 2.2 Mobile phase configuration

[0038] 0.4% formic acid (A) and methanol (B) were used as the mobile phase in a ratio of 5:5 to improve the separation efficiency of quercetin.

[0039] 2.3 Testing conditions

[0040] Detection wavelength: 255 nm;

[0041] Flow rate: 1 mL / min;

[0042] Column temperature: 25℃.

[0043] The above conditions were optimized through multiple experiments to ensure that the quercetin content could be effectively separated and detected.

[0044] 3. HPLC analysis of quercetin content

[0045] The quercetin content of 30 safflower varieties was determined by HPLC. The results of repeated tests showed that the quercetin content in the M9 strain was the highest, ranging from 0.2994 to 0.4572 mg / g, and the quercetin content in the M28 strain was the lowest, ranging from 0.081 to 0.091 mg / g (see Figure 1 , 2 , 3).

[0046] Example 2 Cloning of the coding region sequence of the CtCYP81D2 gene

[0047] 1. RNA extraction from safflower petals

[0048] 1) Wrap the tweezers, mortar, pestle and medicine spoon with tin foil, dry-heat sterilize them in a 180℃ oven for 4 hours, and set aside;

[0049] 2) Treat 1.5mL centrifuge tubes and pipette tips with 0.1% DEPC water overnight, then sterilize them by high pressure sterilization at 120℃ for 20min, and place them in a 60℃ oven to dry for later use;

[0050] 3) Take about 100 mg of safflower petals, add liquid nitrogen and grind quickly into fine powder, divide into two 1.5 mL EP tubes, add 1 mL RNAiso Plus to each tube, mix well, and let stand at room temperature for 5 minutes;

[0051] 4) Centrifuge at 12000 rpm for 5 min at 4°C and transfer the supernatant to a new 1.5 mL centrifuge tube;

[0052] 5) Add chloroform in the amount of 1 / 5 of the volume of RNAiso Plus, shake, mix, and let stand at room temperature for 5 minutes;

[0053] 6) Centrifuge at 4°C, 12,000 rpm for 15 min, and transfer the supernatant to a new 1.5 mL centrifuge tube;

[0054] 7) Add isopropanol of equal volume to the supernatant, let stand at room temperature for 10 min, and centrifuge at 12,000 rpm for 10 min at 4°C;

[0055] 8) Discard the supernatant and take the precipitate. Add 1 mL of 75% ethanol to the precipitate to wash it. Centrifuge at 12,000 rpm for 5 min at 4°C. Repeat this step once.

[0056] 9) Discard the supernatant and keep the precipitate, and let it dry at room temperature;

[0057] 10) Dissolve RNA in RNA-Free water and store the extracted RNA at -80℃ until use.

[0058] 11) The concentration of safflower total RNA samples was measured using NanoDrop2000 ultra-micro spectrophotometer (purchased from Thermo).

[0059] 12) RNA purity was tested by 2% agarose gel electrophoresis. After electrophoresis, the gel was stained with nucleic acid dye and photographed on a UV gel imaging system. Figure 4 ,Depend on Figure 4 Two clear bands of 28S and 18S can be seen, and the brightness of the 28S band is about twice that of the 18S band. This indicates that the RNA extraction is complete and not degraded, and can meet the needs of subsequent experiments.

[0060] 2. Synthesis of the first-strand cDNA

[0061] The RNA stored at -80°C was taken and the concentration of RNA was detected by nanogrop. The concentration of extracted RNA was about 1000 ng / ul. The reverse transcription of cDNA was performed according to the operating instructions of the reverse transcription kit. The reverse transcription reaction system is shown in Tables 1 and 2. The reverse transcribed cDNA was stored in a -20°C refrigerator for later use.

[0062] Table 1 The first round of reverse transcription reaction system

[0063]

[0064] Carry out the following reaction on a PCR instrument: 65°C, 5 min, and quickly cool on ice.

[0065] Table 2 Second round reverse transcription reaction system

[0066]

[0067] Reverse transcription reaction conditions

[0068] 42℃ 55min

[0069] 70℃ 10min

[0070] The cDNA was cooled on ice and used for subsequent reactions and then stored at -20°C for future use.

[0071] 3. Cloning of the coding region sequence of CtCYP81D2 gene

[0072] Our research group previously sequenced the whole genome of safflower and annotated the safflower CtCYP81D gene. Using the petal cDNA of safflower as a template, we designed specific primers for RT-PCR amplification based on the coding region sequence annotated in the genome. The designed cloning primers are as follows:

[0073] CtCYP81D2f: ATGTCCCTTCGCTTTGGCTCT

[0074] CtCYP81D2r:TTATAGCTCCTTAAGAAGATGACT

[0075] The cDNA obtained by reverse transcription of RNA from the petals of Jihong No. 1 safflower during its blooming period was used as a template for amplification. The amplified product was connected to the pEASY-T1 cloning vector (Beijing Quanshijin Biotechnology Co., Ltd.) and transformed into DH5α Escherichia coli competent cells. The culture medium PCR ( Figure 5 )) After verification, the sequencing was carried out and the sequencing result was correct. The full-length sequence of the coding region was obtained, 1323 bp, named CtCYP81D2, the base sequence of which is shown in the sequence list SEQ ID NO.1, and the amino acid sequence of which is shown in the sequence list SEQ ID NO.2.

[0076] Example 3 Expression analysis of CtCYP81D2 gene in two strains (M9 and M28)

[0077] Total RNA from petals of two safflower lines, M9 and M28, was extracted and reverse transcribed to synthesize the first-strand cDNA template. The fluorescent quantitative PCR primers of CtCYP81D2 gene were designed using the primer design online website (http: / / www.primer3plus.com / cgi-bin / dev / primer3plus.cgi), and the fluorescent quantitative PCR reaction was performed using the TB Green®) kit Premix Ex Taq™ (TaKaRa). The reaction system is shown in Table 3. The machine used for fluorescent quantitative analysis was Agilent Mx3000P, and the relative expression level was 2 -△△CtThe calculation was performed by the method of , and each sample was repeated 3 times. The results showed that the expression level of CtCYP81D2 gene in M9 strain was significantly higher than that in M28 strain (see Figure 6 ).

[0078] Table 3 qRT-PCR reaction system

[0079] Tab.3 qRT-PCR reaction system

[0080] Reagents Usage TB Green Premix Ex Taq (2×) 10 μL PCR Forward Primer (10 μM) 0.4 μL PCR Reverse Primer (10 μM) 0.4 μL ROX Reference Dye II (50X) 0.4 μL cDNA 1 μL <![CDATA[RNase Free dH2O]]> Up to 20 μL

[0081] The reaction procedure adopts Normal 2 step, as follows:

[0082] .

[0083] Example 4 Construction of Plant Expression Vector of Carthamus tinctorius CtCYP81D2 Gene

[0084] The CtCYP81D2 coding region fragments containing homology arms of Xho I and Hind III restriction sites were amplified by TransStart® FastPfu Fly DNA Polymerase (Beijing Quanshijin Biotechnology Co., Ltd.), and the pTRV2 and pGreenIISK vectors were digested with FlashcutTM Xho I and FlashcutTM Hind III (Mona (Wuhan) Biotechnology Co., Ltd.) and purified with a DNA purification kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). The target fragment was connected to the linearized vector using a single fragment seamless cloning kit (Mona (Wuhan) Biotechnology Co., Ltd.), and the connection product was transformed into Escherichia coli DH5α competent cells. Transformants were screened on a resistance plate containing kanamycin (50 mg / L), and the bacterial solution was identified by PCR after the single clone was selected and shaken ( Figure 7 ), both had the target bands, indicating that the expression vectors were successfully constructed and named pTRV2-CtCYP81D2 and pGreenIISK-CtCYP81D2.

[0085] Example 5 Transformation of Agrobacterium competent cells

[0086] The target gene was transformed into Agrobacterium using the freeze-thaw method. The process is as follows:

[0087] 1) Add 1µl of pTRV2-CtCYP81D2 and pGreenIISK-CtCYP81D2 plasmid DNA into 100µl of Agrobacterium EHA105 competent cells and refrigerate in liquid nitrogen for 5 minutes;

[0088] 2) Quickly place it in a 37°C water bath and heat shock for 5 minutes;

[0089] 3) Add 1 ml of fresh YEP culture medium to the centrifuge tube and shake the bacteria on a shaker at 28°C for 2-4 hours;

[0090] 4) Take 50μl-100μl of the transformed bacterial solution and apply it on a solid LB plate containing 50μg / ml kan + 100μg / ml Rif, culture it in a 28℃ incubator for 2-3 days, and screen the transformants;

[0091] 5) Pick a single clone of bacteria and inoculate it into Agrobacterium liquid culture medium, culture it at 28°C until OD600≈0.8, and take 1 μl of the bacterial solution for PCR detection, using the same method as above;

[0092] 6) The remaining bacterial solution was mixed thoroughly with glycerol at a ratio of 4:1 (V:V), quickly frozen in liquid nitrogen, and then stored at -80°C for later use.

[0093] Example 6 Silencing of Carthamus tinctorius CtCYP81D2 gene and determination of quercetin content

[0094] TRV1 and TRV2 are transformed from two strands of the originally complementary double-stranded RNA. Among them, TRV1 can enhance the replication and propagation of TRV2 and play an auxiliary role. When TRV1 and TRV2 are mixed, the partially complementary strands can form double-stranded RNA, which is more stable. The mixed double-stranded RNA can better replicate and propagate in plant cells, thereby achieving gene interference. Therefore, in the experiment, we usually use pTRV1+ pTRV2 as the control group and pTRV1+ pTRV2-target gene as the experimental group.

[0095] Agrobacterium containing pTRV1, pTRV2, and pTRV2-CtCYP81D2 plasmids were cultured to OD600 = 0.8-1.0, and the cells were collected by centrifugation at 5000 rpm, and the cells were resuspended in buffer (10 mM MgCl2, 10 mM MES, 200 μM AS; pH 5.6) to OD600 = 0.8. pTRV1 was mixed with pTRV2 and pTRV2-CtCYP81D2 Agrobacterium suspensions in a ratio of 1:1, and activated in the dark at 28°C for 3 h. The leaves near the flower buds were injected with a syringe. The safflower plants were grown in the dark for 1 day and then moved to an artificial climate chamber for 10 days. 0.1 g of petals from the injection sites of the control group and the experimental group were extracted three times with 10 times ethanol, the supernatants were combined and concentrated under reduced pressure, and the volume was fixed with 1 ml ethanol. The leaves were filtered through a 0.22 μm membrane to detect the quercetin content. It was found that after transient silencing, the quercetin content decreased significantly ( Figure 8 ).

[0096] Example 7 Overexpression of Carthamus tinctorius CtCYP81D2 gene and determination of quercetin content

[0097] The Agrobacterium liquid containing pGreenIISK and pGreenIISK-CtCYP81D2 plasmids was cultured to OD600=0.8-1.0, and the cells were collected by centrifugation at 5000 rpm. The cells were resuspended in buffer (10 mM MgCl2, 10 mM MES, 200 μM AS; pH5.6) to OD600=0.8, and activated in the dark at 28°C for 3 hours. The pGreenIISK and pGreenIISK-CtGRF5 Agrobacterium suspensions were injected into the safflower buds and nearby leaves using a syringe. The safflower plants were grown in the dark for 1 day and then moved to an artificial climate chamber for 8 days. Quercetin was extracted from the injection site. It was found that the quercetin content was significantly increased after transient overexpression ( Fig. 9 ).

Claims

1. CtCYP81D2 gene, the base sequence of which is shown in the sequence listing SEQ ID NO.

1.

2. A plant expression vector pGreenIISK-CtCYP81D2, which is obtained by inserting the CtCYP81D2 gene described in claim 1 into pGreenIISK.

3. Use of the CtCYP81D2 gene according to claim 1 in increasing the quercetin content in safflower varieties.

Images