Application of potato ubiquitin ligase Ubox51 in new variety breeding

Abstract

The invention provides an application of an StPUB51 gene in breeding of a new drought-resistant potato variety. Through overexpression of the StPUB51 gene, the drought resistance of potato plants is remarkably improved, and the enzyme activity of SOD, CAT and POD and the content of MDA are effectively adjusted; on the contrary, interference expression of the StPUB51 gene can cause a contrary result. It shows that the StPUB51 gene positively regulates the drought resistance of potato plants, and screening of varieties (or strains) with high expression of the StPUB51 gene will have higher drought resistance. According to the invention, interaction protein of the StPUB51 is screened by utilizing a yeast two-hybrid experiment, and interaction of StSKP2A and StGATA1 proteins with the StPUB51 is verified by adopting yeast rotation verification and BiFC, so that the drought resistance of the potatoes is jointly regulated and controlled.

Description

Technical Field

[0001] The invention belongs to the field of potato molecular breeding, and particularly relates to the application of StPUB51 gene in screening drought-resistant potato varieties. Background Art

[0002] Potato is the fourth largest food crop after rice, wheat and corn. It is widely used in many fields such as vegetables, food, feed and industrial processing raw materials. The annual planting area of ​​potatoes in my country reaches 5.33 million hectares, and the total output is as high as 100 million tons. The planting area and output are among the highest in the world. Potato tubers are rich in starch, protein, vitamins, dietary fiber and minerals. As a representative crop in temperate climates, potatoes are extremely sensitive to water deficiency due to their relatively shallow root system, especially during the tuber growth and swelling stage, which is easily affected by insufficient water, thus affecting yield and quality. With global climate change, extreme climate events occur frequently, which poses a severe challenge to my country's food security. Therefore, the identification of potato drought resistance genes and the study of their molecular mechanisms provide important theoretical support for potato drought resistance and high-yield breeding.

[0003] U-box ubiquitin ligases play an important role in multiple processes such as biological and abiotic stress responses and plant growth and development. In plants such as Arabidopsis and rice, multiple U-box ubiquitin ligases have been shown to respond to drought stress, but the response of potato U-box ubiquitin ligase to drought stress has not been reported by other research groups. The applicant's research group has previously systematically screened the potato U-box ubiquitin ligase gene family and clarified the function of StPUB27 in responding to drought stress (CN109439673B), and provided a method for screening ubiquitinated target proteins (CN109358145B). This application further provides the specific functions and uses of potato StPUB51 in regulating drought stress. Summary of the invention

[0004] The key technical problem to be solved by the present invention is to provide an application of the StPUB51 gene in enhancing drought resistance of potato plants. To solve the above technical problem, the present invention adopts the following technical solution:

[0005] 1. Potato StPUB51 gene, the transcript sequence of which is shown in the sequence listing SEQ No. 1, with a CDS length of 834 bp, encoding 277 amino acids, and the accession number in the potato database is Soltu.DM.06G033460.1.

[0006] 2. Application of overexpressing StPUB51 gene to enhance drought resistance of potato, the transcript sequence of StPUB51 gene is shown in sequence table SEQ No.1.

[0007] 3. Application of potato StPUB51 gene in breeding new drought-resistant varieties. The transcript sequence of the StPUB51 gene is shown in the sequence table SEQ No. 1. Varieties with high expression levels of the StPUB51 gene have stronger drought resistance.

[0008] 4. Application of interfering with potato StPUB51 gene expression to weaken potato drought resistance, the transcript sequence of the StPUB51 gene is shown in the sequence table SEQ No. 1.

[0009] 5. Application of overexpressing StPUB51 gene to improve potato SOD, POD, CAT enzyme activities and reduce MDA content, the transcript sequence of the StPUB51 gene is shown in the sequence table SEQ No.1.

[0010] 6. Verification of the interaction between potato StPUB51 and StSKP2A and StGATA1 proteins, and ubiquitination and degradation of StSKP2A and StGATA1 proteins to enhance potato drought resistance.

[0011] 7. Application of down-regulating expression or ubiquitination degradation of StSKP2A gene to enhance drought resistance of potato, wherein the StSKP2A gene ID number is XM_015312788.1, and the CDS sequence is shown in SEQ No. 2 in the sequence table.

[0012] 8. Application of down-regulating expression or ubiquitination degradation of StGATA1 gene to enhance drought resistance of potato, the StGATA1 gene ID number is XM_006355679.2, and the CDS sequence is shown in SEQ No. 3 in the sequence table.

[0013] 9. A method for applying the potato StPUB51 gene to enhance drought and salt tolerance in potato plants, including: (1) genetic transformation of potato; (2) detection of transgenic positive lines; and (3) identification of drought resistance of transgenic potato plants.

[0014] Beneficial effects: This application constructs an overexpression vector PRI201-AN-StPUB51 and an interference expression vector pCPB121-amiR-StPUB51, and successfully obtains potato plants with overexpression and interference expression of StPUB51. Through plant phenotypic observation, it was found that after 14 days of water-cut-off drought treatment, the growth condition of the overexpression potato plants was significantly better than that of the wild type, while the leaves of the interference expression strains were obviously wilted. Overexpression of StPUB51 can significantly improve the drought resistance of potato plants, and effectively change the SOD, CAT and POD enzyme activities and MDA content, while the opposite results occurred in the interference expression plants, proving that StPUB51 can enhance the drought resistance of potato plants. Plants overexpressing StPUB51 have better drought resistance than wild-type plants, while the interference expression plants are the opposite, thus obtaining a positive regulatory effect of the StPUB51 gene on the drought function of potatoes. By screening multiple potential interacting proteins and constructing a yeast conversion verification vector and a bimolecular fluorescent complementation vector through homologous recombination for interaction verification, it was found that StPUB51 interacts with StGATA1 and StSKP2A proteins, laying the foundation for elucidating the regulatory mode and molecular action mechanism of StPUB51. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 : Agrobacterium-mediated potato transformation and rooting screening of transgenic plants. Figure 1 A. Transformed potato chips co-culture; Figure 1 B. potato chip callus differentiation and budding; Figure 1 C. Rooting and screening of transformed plants. In the figure: WT: non-transgenic plants; OE: overexpression plants; RNAi: interference expression plants.

[0016] Figure 2 : PCR detection and expression level detection of transgenic plants. Figure 2 A. PCR detection of transgenic plants; Figure 2 B. Detection of expression level of transgenic line StPUB51.

[0017] Figure 3 :Phenotypic analysis of potato StPUB51 transgenic plants before and after natural drought stress.

[0018] Figure 4 : Changes in SOD, CAT, POD enzyme activities and MDA content in potato StPUB51 transgenic plants after drought stress. Figure 4 A.SOD activity; Figure 4 B.POD activity; Figure 4 C.CAT activity; Figure 4D. MDA content. The bar graphs from left to right are WT, OE-1, OE-2, OE-3, RNAi-1, RNAi-2, and RNAi-3.

[0019] Figure 5 :Toxicity and autoactivation detection of potato StPUB51 protein. Figure 5 A. Toxicity testing; Figure 5 B. Self-activation detection.

[0020] Figure 6 :Verification of the interaction between potato StPUB51 and StGATA1 and StSKP2A proteins. Figure 6 A. Yeast two-hybrid transformation verification; Figure 6 B. Verification of bimolecular fluorescence complementation.

[0021] Figure 7 : The gene structure diagram of potato StPUB51. The underlined parts are the start codon and the stop codon, and the CDS region is between them. Specific implementation methods

[0023] The methods and devices used in the following embodiments of the present invention are conventional methods and devices unless otherwise specified; the equipment and reagents used are conventional equipment and reagents purchased by the reagent company. In order to make the purpose, technical scheme and advantages of the present invention clearer, the specific implementation methods of the present invention are described in detail in conjunction with specific embodiments. Examples of these preferred implementations are illustrated in the specific embodiments. It should also be noted that in order to avoid obscuring the technical scheme of the present invention due to unnecessary details, only the technical schemes and / or processing steps closely related to the scheme of the present invention are shown in the embodiments, and other details that are not very relevant are omitted.

[0024] Example 1

[0025] This embodiment provides a potato StPUB51 gene, which has the following characteristics:

[0026] Potato StPUB51 (Soltu.DM.06G033460.1) is located on chromosome 6. The total length of the gene is 1399 bp, the CDS region is 834 bp long, and the sequence is shown in the sequence table SEQ ID No.1, which contains 8 exons. The protein encoded by StPUB51 consists of 277 amino acids, with a relative molecular weight of 31.82 KDa and a theoretical isoelectric point of 5.59. The protein contains a total of 43 negatively charged residues (Asp+Glu) and 35 positively charged residues (Arg+Lys), and the molecular formula is C 1414 H 2216 N 390 O 424 S11 The total number of atoms is 4455, the instability coefficient of the protein is 39.38, the fat coefficient is 85.99, and the total average hydrophilicity is -0.509. The transmembrane structure region of the protein was analyzed by the online software TMHMM, and it was found that the StPUB51 protein does not contain a transmembrane domain and is a non-transmembrane protein.

[0027] Example 2

[0028] This embodiment provides a method for constructing a potato StPUB51 gene plant overexpression and interference vector, comprising:

[0029] 1. Construction of StPUB51 gene overexpression vector

[0030] The inventors amplified the StPUB51 sequence from the cDNA of the potato cultivar "Desiree" leaves. The PCR primers used were: forward primer: 5'-tcttcactgttgatacatatgATGGCATCAATCGTGGGTTC-3', reverse primer: 5'-tcttcactgttgatacatatgATGGCATCAATCGTGGGTTC-3'; the PCR reaction system was: Max DNA Polymerase 10.0μL, cDNA template (100ng) 1.0μL, forward / reverse primer (10μM) 1.0μL, ddH2O7.0μL; PCR reaction conditions are 98℃10sec, 60℃5sec, 72℃40sec for 30 cycles. Using homologous recombination method, the target gene amplified by PCR was recovered from gel and connected to the linearized vector of pRI201-AN digested with Nde I and Sal I, heat-shocked and transformed into Escherichia coli DH5α, and sequenced for verification. The positive clone pRI201-AN-StPUB51 plasmid with correct sequencing was transformed into Agrobacterium GV3101, and the clones with positive PCR detection were saved for further genetic transformation.

[0031] 2. Construction of StPUB51 gene interference expression vector

[0032] 2.1 Design and construction of primers for artificial miRNA precursor fragments

[0033] The coding region sequence of StPUB51 gene was submitted to the WMD3 online website (http: / / wmd3.weigelworld.org / cgi-bin / webapp.cgi), and the amiRNA interference sequence of the target gene (5'-TCATTCCGTTTCCGATCACAT-3') was obtained. The PCR amplification primers were automatically retrieved using the Oligo of the website, and the best primer sequence was selected for download and primer synthesis. The specific primer information is shown in Table 1.

[0034] Table 1 PCR amplification primers for amiR-StPUB51

[0035] Primer name Primer sequence (5'-3') A CTGCAAGGCGATTAAGTTGGGTAAC B GCGGATAACAATTTCACACAGGAAACAG Ⅰ gaTCATTCCGTTTCCGATCACATtctctcttttgtattcc Ⅱ gaATGTGATCGGAAACGGAATGAtcaaagagaatcaatga Ⅲ gaATATGATCGGAAAGGGAATGTtcacaggtcgtgatatg Ⅳ gaACATTCCCTTTCCGATCATATtctacatatattattcct

[0036] 2.2 Cloning of artificial miRNA precursor fragments

[0037] The pRS300 plasmid was used as a template to amplify the precursor fragments a, b, and c, respectively. The specific amplification principle was that the a fragment obtained by primers A and IV replaced the 5' arm on pRS300 mi3191a, the b fragment obtained by primers III and II replaced the central loop on mi3191a, and the c fragment obtained by primers I and B replaced the 3' arm on mi3191a. The amplification system is shown in Table 2.

[0038] Table 2 PCR system of amiRNA precursor fragments

[0039] PCR reaction Forward Primer Reverse primer template Product length (bp) a A IV pRS300 272 b III II pRS300 171 c I B pRS300 298 d A B a+b+c 701

[0040] The PCR reaction system is: Max DNA Polymerase 10.0 μL, cDNA template (100 ng) 1.0 μL, forward / reverse primers (10 μM) 1.0 μL, ddH2O 7.0 μL; PCR reaction conditions were 98°C 10 sec, 60°C 5 sec, 72°C 40 sec for a total of 30 cycles.

[0041] 2.3 Construction of cloning vector pMD18-amiR-StPUB5

[0042] The d fragment obtained by the above amplification was connected to the pMD18-T vector. The connection system was: pMD18-T 1.0μL, d fragment 4.0μL, Solution I 5.0μL. After adding the sample, mix thoroughly and centrifuge briefly, and then connect in a PCR instrument at 16℃ for 30min. The connected pT18-d was introduced into the competent E. coli DH5α by heat shock and sequenced. The positive clone with correct sequencing was named pMD18-amiR-StPUB51.

[0043] 2.4 Construction of pCPB121-StPUB51 interference expression vector

[0044] The pCPB121 empty plasmid and the pMD18-amiR-StPUB51 recombinant vector were digested with restriction endonucleases KpnⅠ and SacⅠ, and the linearized vector large fragment and the target precursor small fragment with sticky ends were recovered by gel. The gel recovery products were stored at -20℃ for future use. The precursor small fragment and the linearized vector large fragment were connected by homologous recombination method using T4 ligase. The reaction system was: 10×ligation buffer 2.0μL, T18-StPUB51 small fragment 10.0μL, linearized pCPB121 vector 4.0μL, T4 ligase 1.0μL, ddH2O 3.0μL, and the samples were added on ice and centrifuged briefly to mix. The mixture was placed in a PCR instrument at 16℃ for 1.5h. The connected products were introduced into E. coli DH5α using the heat shock method and sequenced for verification. The correct positive clone pCPB121-StPUB51 was sequenced and transformed into Agrobacterium GV3101, and the clones positive by PCR were preserved for further genetic transformation.

[0045] Example 3

[0046] This embodiment provides a verification method for the application of potato StPUB51 gene in regulating potato drought resistance, including:

[0047] 1. Genetic transformation of potato

[0048] Agrobacterium GV3101 containing pRI201-AN-StPUB1 and pCPB121-StPUB51 was inoculated into LB medium containing 50 mg / L Kan and 50 mg / L Rif and cultured at 28 °C and 220 r / min on a shaker until OD 600 The pellet was centrifuged at 4000r / min for 6 minutes, and the precipitate was resuspended in 3% MS liquid medium. Cut the "Desiree" test tube potatoes, which were grown for 12-16 weeks and had a diameter of about 0.5cm, into 1-2mm thick slices, and immersed in the above Agrobacterium liquid for 7-8 minutes, shaking continuously during the period. After the immersion, take out the potato slices and dry the surface liquid with sterile filter paper. Transfer to co-culture medium S1: 3% MS + 1mg / LIAA + 0.2mg / LGA3 + 0.5mg / L 6-BA + 2mg / L ZT culture dish ( Figure 1 A), after culturing in the dark at 28°C for 2 days, transfer to S2 medium: S1+75mg / L Kan+400mg / L Cef, and culture under the conditions of light intensity of 2000Lx, photoperiod of 16h / d, and temperature of 23°C until resistant buds regenerate ( Figure 1B). When the resistant buds are 1-1.5 cm long, they are cut and transferred to rooting medium S3 ( Figure 1 C): 3% MS + 75 mg / L Kan + 400 mg / L Cef. Those that can normally take root after 7 days will be considered as transformed seedlings.

[0049] 2. Detection of transgenic positive strains

[0050] Cut 1-2 leaves of the seedling to be tested and put them in a 2ml centrifuge tube. Extract DNA using the CTAB method. After DNA extraction, use it as a template for PCR transgenic strain detection, use vector primer NPT II-F: 5'-GCTATGACTGGGCACAACAG-3', reverse primer NPT II-R: 5'-ATACCGTAAAGCACGAGGAA-3', amplify by PCR, and obtain multiple transgenic plants by electrophoresis detection ( Figure 2 A). The total RNA of transgenic plants and control plants was extracted using the Plant RNA Rapid Extraction Kit (Tiangen), and reverse transcription was performed using the Reverse Transcription Kit (Sevier) to produce cDNA. Using cDNA as a template, the expression level of the target gene StPUB51 was detected using quantitative primers. The results showed that the expression level of StPUB51 in multiple positive transgenic lines was significantly upregulated / inhibited ( Figure 2 B).

[0051] 3. Identification of drought resistance in transgenic potatoes

[0052] 3.1 Effects of drought stress on the phenotype of transgenic potato plants

[0053] The stem segments of potato test tube seedlings were transferred to 3% MS solid medium and placed in a culture room at (22±1)°C with a photoperiod of 16h light / 8h dark for 4 weeks. The 4-week-old potato tissue culture seedlings were transferred to plastic flower pots (10×10 cm) with a soil: vermiculite ratio of 3:1, and the culture conditions were set to (22±1)°C, 16h light / 8h dark, and watered every 5 days. Drought stress treatment was started after 4 weeks of growth. Under normal growth conditions, the growth of 8-week-old WT, OE and RNAi strains was basically the same, and there was no significant difference in phenotype. After 14 days of water control, WT, overexpression lines OE-1, OE-2, OE-3 and interference expression lines RNAi-1, RNAi-2, RNAi-3 all showed obvious wilting, but the degree of wilting in RNAi lines was significantly more serious than that in WT, accompanied by a small number of withered leaves; on the contrary, the degree of wilting in OE lines was significantly lighter than that in WT and RNAi lines, and there were fewer dead leaves ( Figure 3 ).

[0054] 3.2 Effects of drought stress on physiological and biochemical parameters of transgenic plants

[0055] The activities of superoxide dismutase (SOD), peroxidase (POD) and catalase (CAT) and the changes in malondialdehyde (MDA) content in transgenic potatoes under drought stress were determined. The results of SOD, POD and CAT activity determination showed that there was no significant difference in SOD, POD and CAT activities among WT, OE and RNAi plants under normal growth conditions; however, after drought stress treatment, the activities of SOD, POD and CAT in all tested plants increased significantly, and the activities of SOD, POD and CAT in RNAi plants were significantly lower than those in WT and OE, and significantly higher than those in OE plants ( Figure 4 A; B; C). This shows that the antioxidant scavenging capacity of RNAi plants is lower than that of WT and OE plants, while that of OE plants is higher than that of WT. There was no significant difference in the content of MDA among the strains before treatment. After treatment, the content of MDA in OE-n strain was significantly reduced compared with that in wild type, while that in RNAi-n strain was significantly increased compared with that in wild type ( Figure 4 D) The results showed that plants overexpressing the StPUB51 gene had better drought resistance than wild-type plants, while the opposite was true for plants with disrupted expression.

[0056] Example 4

[0057] This embodiment provides a method for screening StPUB51 interacting proteins, including:

[0058] 1. Construction of the bait vector pGBKT7-StPUB51

[0059] The inventors used the constructed pRI201-AN-StPUB51 as a template to amplify the StPUB51 sequence. The PCR primers used were: forward primer: 5'-tcagaggaggacctgcatatgATGGCATCAATCGTGGGTTC-3', reverse primer: 5'-atgcggccgctgcaggtcgacTTACTGTATCCTGTATGCCCAGCC-3'; the PCR reaction system was: Max DNA Polymerase 10.0μL, cDNA template (100ng) 1.0μL, forward / reverse primer (10μM) 1.0μL, ddH2O 7.0μL; PCR reaction conditions are 98℃10sec, 60℃5sec, 72℃40sec for 30 cycles. Using homologous recombination method, the target gene amplified by PCR was recovered from gel and connected to the linearized vector of pGBKT7 digested by Nde I and Sal I, heat-shocked and transformed into Escherichia coli DH5α, and sequenced for verification. The plasmid suitable for sequencing was named pGBKT7-StPUB51.

[0060] 2. Toxicity test of bait vector pGBKT7-StPUB51 and self-activation test

[0061] The bait vector pGBKT7-StPUB51 plasmid and pGBKT7 empty vector were introduced into AH109 competent cells by PEG / LiAc method, and then spread on single-deficient solid medium (SD / -Trp) and double-deficient solid medium (DDO / -Trp / -Leu), and cultured inverted in a 30°C incubator for 72-96 hours. The results showed that the bait vector and the empty vector grew colonies of roughly the same size on the SD / -Trp plate, and no colonies grew on the DDO / -Leu / -Trp medium ( Figure 5 A), indicating that the protein encoded by the bait vector pGBKT7-StPUB51 is not toxic to yeast cells.

[0062] The bait vector pGBKT7-StPUB51 plasmid and the blank control vector pGADT7 plasmid were co-transfected into AH109 competent cells by the PEG / LiAc method. The pGADT7-RecT and pGBKT7-53 plasmids were selected as positive controls, and the pGADT7-RecT and pGBKT7-Lam plasmids were selected as negative controls. The transformed yeast solution was spread on two-deficiency solid medium (DDO / -Trp / -Leu), four-deficiency solid medium (QDO / -Leu / -Trp / -His / -Ade) and four-deficiency solid medium (QDO / -Leu / -Trp / -His / -Ade / X-α-gal), respectively, and inverted cultured at 30°C for 72-96h. The results showed that colonies grew in the positive, negative and experimental groups on the DDO / -Trp / -His medium, only the positive control grew colonies on the QDO / -Leu / -Trp / -His / -Ade medium, and the positive colonies turned blue on the QDO / -Leu / -Trp / -His / -Ade / X-α-gal medium, and no colonies grew in the negative control and experimental groups ( Figure 5 B). This indicates that the pGBKT7-StPUB51 bait vector does not have self-activation activity and can be used for library screening experiments.

[0063] 3. Screening of proteins interacting with StPUB51 by co-transfection

[0064] The pGBKT7-StPUB51 bait vector and the potato cDNA library were co-transfected into AH109 competent cells, and proteins interacting with StPUB51 were screened by co-transfection. The positive clone colonies were transferred to 0.9% NaCl solution by screening on the four-deficient medium QDO / -Leu / -Trp / -His / -Ade, and 4 μL was aspirated and spotted on QDO / -Leu / -Trp / -His / -Ade / X-α-gal. The positive clone bacterial solution grew and turned blue, and the colonies were verified by PCR. The electrophoresis results showed that PCR amplified multiple bands of varying sizes. The results showed that multiple proteins interacting with StPUB51 in the library had been successfully screened out, and the electrophoresis bands of 500-2000bp were sent to the company for sequencing.

[0065] 4. Sequence alignment of candidate positive clones

[0066] The sequencing results were compared and analyzed by NCBI and potato database PGSC. The results are shown in Table 3. StSKP2A (Soltu.DM.04G025280.1) and StGATA1 (Soltu.DM.05G023550.1) proteins were selected from the sequencing results for verification.

[0067] Table 3 Analysis of StPUB51 interacting proteins

[0068]

[0069]

[0070] Example 5

[0071] This implementation provides a StPUB51 interacting protein verification method, including:

[0072] 1. Yeast transformation to verify vector construction

[0073] The inventors amplified the sequences of StSKP2A and StGATA1 from the cDNA of the leaves of the potato cultivar "Desiree". The PCR primers used are shown in Table 4; the PCR reaction system and reaction conditions are the same as those in 4.1. Using the homologous recombination method, the target gene bands amplified by the above PCR were recovered from the gel and ligated into the linearized vector of pGADT7 digested with Nde I and BamH I, heat-shocked and transformed into Escherichia coli DH5α, and sequenced for verification. The plasmids suitable for sequencing were named pGADT7-StSKP2A and pGADT7-StGATA1.

[0074] Table 4 Primer sequences for constructing vectors

[0075] Primer name Primer sequence (5'-3') Restriction site AD-StGATA1-F gtaccagattacgctcatatgATGAAAATGGAAGCTATGTACTCAAAA N AD-StGATA1-R cagctcgagctcgatggatccTTAAATCCTCTGCTTTCTCATCTCC BamH AD-StSKP2A-F gtaccagattacgctcatatgATGTTAGGGGTAGAAGATTTGAGCT N AD-StSKP2A-R cagctcgagctcgatggatccTCAGTGAGCTGGATGGAGAACA BamH

[0076] 2. Yeast two-hybrid validation experiment

[0077] Using pGADT7-Rect+pGBKT7-53 as a positive control and pGADT7-Rect+pGBKT7-Lam as a negative control, the pGBKT7-StPUB51 vector was co-transformed with the pGADT7-StGATA1 and pGADT7-StSKP2A vectors into yeast AH109 competent cells, spread on a two-deficient medium (SD / -Trp / -Leu), and inverted at 30°C for 3-4 days. Then, a positive single colony was picked and diluted in 20 μL 0.9% NaCl solution, and 4 μL was aspirated and spotted on a four-deficient medium (SD / -Leu / -Trp / -His / -Ade / X-α-gal) medium. After incubation at 30°C for 3-4 days, the colony turned blue, indicating that StPUB51 interacted with StGATA1 and StSKP2A proteins. The blue colony was picked and placed in 0.9% NaCl for 10 0 , 10 -1 , 10 -2 , 10 -3 Serial dilutions were performed and the samples were spotted on two-deficient medium (SD / -Trp / -Leu), four-deficient medium (SD / -Leu / -Trp / -His / -Ade) and four-deficient medium (SD / -Leu / -Trp / -His / -Ade / X-α-gal). The growth of colonies was analyzed ( Figure 6 A).

[0078] 3. Construction of bimolecular fluorescence complementation vector

[0079] The inventors used the above-mentioned pGADT7-StSKP2A and pGADT7-StGATA1 recombinant plasmids as templates to amplify the StSKP2A and StGATA1 sequences. The PCR primers used are shown in Table 5; the PCR reaction system and reaction conditions are the same as 4.1. Using the homologous recombination method, the target gene band amplified by the above PCR was recovered from the gel and ligated into the linearized vector of pSPYCE-35S and pSPYNE-35S digested with Kpn I and Xba I, heat-shocked and transformed into Escherichia coli DH5α, and sequenced for verification. The plasmids suitable for sequencing were named pSPYCE-StPUB51, pSPYNE-StGATA1 and pSPYNE-StSKP2A, transformed into Agrobacterium GV3101, and clones positive for PCR detection were preserved.

[0080] Table 5 Primer sequences for constructing vectors

[0081] Primer name Primer sequence (5'-3') Restriction site CE-StPUB51-F gagaacacgggggactctagaATGGCATCAATCGTGGGTTC XB CE-StPUB51-R gtacatcccgggagcggtaccCTGTATCCTGTATGCCCAGCCA KpN NE-StGATA1-F gagaacacgggggactctagaATGAAAATGGAAGCTATGTACTCAAAA XB NE-StGATA1-R ctccatcccgggagcggtaccAATCCCTCTGCTTTCTCATCTCCAA KpN NE-StSKP2A-F gagaacacgggggactctagaATGTTAGGGGTAGAAGATTTGAGCTT XB NE-StSKP2A-R ctccatcccgggagcggtaccGTGAGCTGGATGGAGAACACG Kpn I

[0082] 4. Observation of Bimolecular Fluorescence Complementation Fluorescence Signal

[0083] With pSPYCE-StPUB51+pSPYNE-35S as blank control, pSPYCE-StPUB51 was mixed with pSPYNE-StSKP2A and pSPYNE-StGATA1 Agrobacterium in a ratio of 1:1 and then injected into tobacco leaf cells for transient expression test. The yellow fluorescent protein signal in tobacco cells was observed under an excitation wavelength of 514nm using a laser confocal microscope. Yellow fluorescence could be observed in tobacco leaf cells in the experimental groups co-expressing pSPYCE-StPUB51+pSPYNE-StSKP2A and pSPYCE-StPUB51+pSPYNE-StGATA1, while no yellow fluorescence could be observed in the control group pSPYCE-StPUB51+pSPYNE-35S ( Figure 6 B), indicating that StPUB51 interacts with StSKP2A and StGATA1.

Claims

1. Potato StPUB51 gene, characterized in that The transcript sequence of the StPUB51 gene is shown in the sequence table SEQ No. 1, and the accession number of the gene in the potato database is Soltu.DM.06G033460.

1.

2. Application of overexpressing StPUB51 gene to enhance drought resistance of potato, characterized in that The StPUB51 gene transcript sequence is shown in the sequence table SEQ No.

1.

3. Application of potato StPUB51 gene in breeding new drought-resistant varieties, characterized in that The transcript sequence of the StPUB51 gene is shown in the sequence table SEQ No. 1, and varieties with high expression levels of the StPUB51 gene have stronger drought resistance.

4. The use of the StPUB51 gene as described in any one of claims 2 and 3, characterized in that Overexpression of the StPUB51 gene increased the activities of SOD, POD, and CAT enzymes in potatoes and reduced the MDA content.

5. The use of the StPUB51 gene as described in any one of claims 2 and 3, characterized in that Potato StPUB51 interacts with StSKP2A and StGATA1 proteins, and ubiquitin-degrades StSKP2A and StGATA1 proteins to enhance potato drought resistance.

6. Application of StSKP2A gene down-regulation or ubiquitination degradation to enhance drought resistance of potato, characterized in that The CDS sequence of the StSKP2A gene is shown in the sequence table SEQ No. 2, and the gene ID number is XM_015312788.

1.

7. Application of StGATA1 gene down-regulation or ubiquitination degradation to enhance drought resistance of potato, characterized in that The CDS sequence of the StGATA1 gene is shown in the sequence table SEQ No. 3, and the gene ID number is XM_006355679.

2.

8. Application of interfering with the expression of potato StPUB51 gene to weaken potato drought resistance, characterized in that The StPUB51 gene transcript sequence is shown in the sequence table SEQ No.

1.

9. A method for verifying the function of potato StPUB51 gene in enhancing drought resistance of potato plants, characterized in that The method comprises: (1) genetic transformation of potatoes; (2) detection of transgenic positive lines; and (3) identification of drought resistance of transgenic potato plants.

Images