Application of stylosanthes guianensis SgVSPs family gene in improving crude protein content of plant

Abstract

The invention discloses an application of SgVSPs family genes of stylosanthes guianensis in improving crude protein content of plants, and the crude protein content of the plants is remarkably improved through plant transgenic hairy roots which excessively express SgVSP1, SgVSP2, SgVSP3, SgVSP4, SgVSP5 and SgVSP6; the SgVSP1 gene, the SgVSP2 gene, the SgVSP3 gene, the SgVSP4 gene, the SgVSP5 gene and the SgVSP6 gene play an important role in improving the crude protein content of plants, can be used for improving the plants through a transgenic technology and improving the crude protein content of the plants, and have important guiding significance for subsequent cultivation of high-protein forage grass new varieties (lines) suitable for production.

Description

Technical Field

[0001] The invention relates to the technical field of plant breeding, and in particular to an application of a Stylosanthes SgVSPs family gene in improving the crude protein content of plants. Background Art

[0002] Forage crops, as the foundation of modern animal husbandry, are the core of my country's feed grain security and an important part of food security. With the increasing global demand for high-quality forage, how to improve the nutritional value of forage has become a major challenge facing agriculture and animal husbandry. The crude protein content of forage is one of the important traits to measure its nutritional quality. Forage with high protein content can not only meet the daily nutritional needs of livestock, but also improve feed conversion rate and reduce feeding costs, thereby improving the economic benefits of animal husbandry. Especially in intensive breeding mode, the protein content of forage plays a vital role in the health and production efficiency of livestock. Therefore, research and cultivation of high-protein forage has become an urgent need for the development of agriculture and animal husbandry.

[0003] In plants, protein content is closely related to nitrogen supply. Plant protein synthesis requires sufficient nitrogen as a raw material, and nitrogen is mainly provided in the soil in the form of nitrogen fertilizer. Excessive application of nitrogen fertilizer not only increases the cost of agricultural production, but may also cause a series of ecological and environmental problems. Therefore, how to maintain or even increase the protein content of plants while reducing the application of nitrogen fertilizer has become an important challenge facing agricultural production today.

[0004] Vegetative storage proteins (VSPs) belong to the halogenated acid dehalogenase (HAD) superfamily. They are a class of proteins that are widely present in plant vegetative tissues and are abundant in content. They were originally discovered as a temporary storage form of plant nitrogen sources. In existing studies, plant VSPs are mainly considered to be related to nitrogen storage and resistance to adverse stress. In dicotyledons, soybean VSP has the function of storing nitrogen and exhibits acid phosphatase activity; 10 VSP proteins have been identified in Arabidopsis, of which AtVSP1 and AtVSP2 are induced by methyl jasmonate, damage, sugar, light and low phosphorus stress, while AtVSP3 does not respond to low phosphorus stress. In addition, studies have found that AtVSP2 has insect resistance. However, there are no reports on the use of transgenic technology to enhance the expression level of VSP family genes and thus increase the crude protein content of plants.

[0005] Stylosanthes is an important tropical legume forage grass with excellent characteristics of aluminum toxicity resistance, drought resistance and nutrient deficiency resistance. In a low nitrogen environment, Stylosanthes can still maintain a high level of crude protein content.

[0006] Therefore, studying the function of Stylosanthes VSP in regulating crude protein accumulation has important significance and application value for breeding new high-protein forage varieties (lines). Summary of the invention

[0007] The present invention provides an application of a Stylosanthes SgVSPs family gene in improving the crude protein content of plants to solve the above problems.

[0008] In order to achieve the above object, the technical solution of the present invention is:

[0009] Application of a Stylosanthes SgVSPs family gene in increasing the crude protein content of plants.

[0010] Furthermore, the Stylosanthes SgVSPs gene family includes SgVSP1 gene, SgVSP2 gene, SgVSP3 gene, SgVSP4 gene, SgVSP5 gene and SgVSP6 gene; the CDS sequence of the SgVSP1 gene is shown in SEQ ID NO.1; the CDS sequence of the SgVSP2 gene is shown in SEQ ID NO.2; the CDS sequence of the SgVSP3 gene is shown in SEQ ID NO.3; the CDS sequence of the SgVSP4 gene is shown in SEQ ID NO.4; the CDS sequence of the SgVSP5 gene is shown in SEQ ID NO.5; the CDS sequence of the SgVSP6 gene is shown in SEQ ID NO.6.

[0011] Furthermore, the amino acid sequence encoded by the SgVSP1 gene is shown in SEQ ID NO.7; the amino acid sequence encoded by the SgVSP2 gene is shown in SEQ ID NO.8; the amino acid sequence encoded by the SgVSP3 gene is shown in SEQ ID NO.9; the amino acid sequence encoded by the SgVSP4 gene is shown in SEQ ID NO.10; the amino acid sequence encoded by the SgVSP5 gene is shown in SEQ ID NO.11, and the amino acid sequence encoded by the SgVSP6 gene is shown in SEQ ID NO.12.

[0012] Furthermore, the plant is Stenoptera.

[0013] Furthermore, the expression level of the SgVSP1 gene, the SgVSP2 gene, the SgVSP3 gene, the SgVSP4 gene, the SgVSP5 gene or the SgVSP6 gene is increased in the plant to increase the crude protein content of the plant.

[0014] Furthermore, the method for increasing the expression level of SgVSP1 gene, SgVSP2 gene, SgVSP3 gene, SgVSP4 gene, SgVSP5 gene or SgVSP6 gene in plants is: constructing a recombinant plant expression vector that overexpresses SgVSP1 gene, SgVSP2 gene, SgVSP3 gene, SgVSP4 gene, SgVSP5 gene or SgVSP6 gene through transgenic technology, and transferring the recombinant plant expression vector into the plant through Agrobacterium-mediated method.

[0015] The beneficial effects of the present invention are:

[0016] The invention discloses an application of a Stylosanthes SgVSPs family gene in improving the crude protein content of plants. The crude protein content of plants is significantly improved by overexpressing transgenic hairy roots of plants with SgVSP1, SgVSP2, SgVSP3, SgVSP4, SgVSP5 and SgVSP6. The SgVSP1, SgVSP2, SgVSP3, SgVSP4, SgVSP5 and SgVSP6 genes play an important role in improving the crude protein content of plants, can be used to improve crops through transgenic technology, improve the crude protein content of plants, and have important guiding significance for the subsequent cultivation of new high-protein forage varieties (lines) suitable for production. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0018] Figure 1 It is a phylogenetic tree and conservative motif analysis map of SgVSP1, SgVSP2, SgVSP3, SgVSP4, SgVSP5, SgVSP6 and 10 Arabidopsis VSP family members in the embodiments disclosed in the present invention;

[0019] Figure 2 This is an electrophoresis diagram of PCR identification of transgenic hairy roots of Slender-stemmed Stylosanthes that overexpress SgVSP1, SgVSP2, SgVSP3, SgVSP4, SgVSP5, and SgVSP6 in the embodiments disclosed in the present invention;

[0020] Figure 3 It is a phenotypic diagram of the positive transgenic hairy roots of SgVSP1, SgVSP2, SgVSP3, SgVSP4, SgVSP5, and SgVSP6 in the embodiments disclosed in the present invention;

[0021] Figure 4 It is a bar graph of the crude protein content of the transgenic hairy roots of SgVSP1, SgVSP2, SgVSP3, SgVSP4, SgVSP5, and SgVSP6 in the embodiments disclosed in the present invention. DETAILED DESCRIPTION

[0022] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] Example 1: Cloning of six Stylosanthes SgVSPs family genes (SgVSP1 gene, SgVSP2 gene, SgVSP3 gene, SgVSP4 gene, SgVSP5 gene, SgVSP6 gene)

[0024] 1. Total RNA extraction from Stylosanthes

[0025] The whole seedlings of Stylosanthes guiana were taken and ground into powder with liquid nitrogen as samples, and then the total RNA of Stylosanthes guiana was extracted using a plant total RNA extraction kit (DP432, TIANGEN), and its integrity was detected by 1% agarose gel electrophoresis. The operation was referred to the product manual;

[0026] Then, HiScript III RT SuperMix for qPCR reverse transcription kit (R323-01, Vazyme) was used for cDNA synthesis, and the operation was referred to the product manual.

[0027] 2. Cloning of six Stylosanthes SgVSPs genes

[0028] Primers for amplifying 6 Stylosanthes SgVSPs genes were designed, and the primer sequences are shown in Table 1 below:

[0029] (SgVSP1-OE-F:

[0030] AGATCTTCCAATACTTATGGCTTTGACTGCGTC (SEQ ID NO: 13);

[0031] SgVSP1-OE-R:

[0032] TGGATCCCCAATACTTCAAGGAATATAATACATTGGGTTTG (SEQ ID NO: 14)); SgVSP2 gene primer (SgVSP2-OE-F:

[0033] AGATCTTCCAATACTTATGGCCACCATTTTAGGC (SEQ ID NO: 15);

[0034] SgVSP2-OE-R:

[0035] TGGATCCCCAATACTTTAAGCAATGTAGTAAATGGAATTTG (SEQ ID NO: 16)); SgVSP3 gene primer (SgVSP3-OE-F:

[0036] AGATCTTCCAATACTTATGTTGATGACGAATAAGGCG (SEQ ID NO: 17); SgVSP3-OE-R:

[0037] TGGATCCCCAATACTTTACCTCAAAATAAGACGTTCATAG (SEQ ID NO: 18)); SgVSP4 gene primer (SgVSP4-OE-F:

[0038] AGATCTTCCAATACTTATGTTCTCAACAAGGGCAA (SEQ ID NO: 19); SgVSP4-OE-R:

[0039] TGGATCCCCAATACTTTAGGGAACAAAATACATGGGA (SEQ ID NO: 20)); SgVSP5 gene primer (SgVSP5-OE-F:

[0040] AGATCTTCCAATACTTATGACCACAGAGATGAGGAG (SEQ ID NO:21); SgVSP5-OE-R:

[0041] TGGATCCCCAATACTCTATGATGGTTTTCTTTGTTGCT (SEQ ID NO: 22)); SgVSP6 gene primer (SgVSP6-OE-F:

[0042] AGATCTTCCAATACTTATGTCTACAAGGAATCTCTCAGAT (SEQ ID NO: 23); SgVSP6-OE-R:

[0043] TGGATCCCCAATACTCTAATGTAAATTGTGTGTGGTTTG (SEQ ID NO: 24));

[0044] Using the above synthesized cDNA as a template and the above primers, the full-length CDS sequences of the six SgVSPs genes carrying the pCXSN vector linker were amplified by PCR respectively;

[0045] The PCR reaction system was as follows: Phanta Flash Super-Fidelity DNA Polymerase (P521-d1, Vazyme) high-fidelity polymerase 20 μl, upstream and downstream primers 1 μl each, cDNA template 2 μl, ddH2O 16 μl; the PCR program was as follows: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 58°C annealing for 15 s, 72°C extension for 25 s, for a total of 35 cycles; then 72°C thorough extension for 5 min; stored at 4°C;

[0046] The PCR product was purified using a gel recovery / DNA purification kit FastPure Gel DNA Extraction Mini Kit (DC301-01, Vazyme), and the PCR product was sent to Sangon Biotech (Shanghai) Co., Ltd., and the above-mentioned amplification primers were used for Sanger sequencing to obtain the full-length CDS sequences of 6 Stylosanthes SgVSPs genes. The CDS sequence of the SgVSP1 gene is shown in SEQ ID NO.1; the CDS sequence of the SgVSP2 gene is shown in SEQ ID NO.2; the CDS sequence of the SgVSP3 gene is shown in SEQ ID NO.3; the CDS sequence of the SgVSP4 gene is shown in SEQ ID NO.4; the CDS sequence of the SgVSP5 gene is shown in SEQ ID NO.5; the CDS sequence of the SgVSP6 gene is shown in SEQ ID NO.6, and the amino acid sequence encoded by the SgVSP1 gene is shown in SEQ ID NO.7; the amino acid sequence encoded by the SgVSP2 gene is shown in SEQ ID NO.8; the amino acid sequence encoded by the SgVSP3 gene is shown in SEQ ID NO. NO.9; the amino acid sequence encoded by the SgVSP4 gene is shown in SEQ ID NO.10; the amino acid sequence encoded by the SgVSP5 gene is shown in SEQ ID NO.11, and the amino acid sequence encoded by the SgVSP6 gene is shown in SEQ ID NO.12.

[0047] Example 2: Phylogenetic analysis and identification of conserved motifs of the Stylosanthes SgVSPs gene family

[0048] The protein conserved domain analysis was performed on the 6 Stylosanthes VSPs proteins (SgVSP1, SgVSP2, SgVSP3, SgVSP4, SgVSP5, SgVSP6) and 10 Arabidopsis VSPs proteins in Example 1 using the NCBI CDD database; the results are shown in Table 2. The 6 Stylosanthes VSPs involved in the present invention have the same conserved domain (cl21460) as the Arabidopsis VSPs, and both belong to the HAD superfamily.

[0049] Table 2 Analysis of protein conservative domains of 6 Stylosanthes VSPs proteins (SgVSP1, SgVSP2, SgVSP3, SgVSP4, SgVSP5, SgVSP6) and 10 Arabidopsis thaliana VSPs proteins in the present invention

[0050]

[0051] Furthermore, MEGA software was used to align the full-length protein sequences of 6 Stylosanthes VSPs and 10 Arabidopsis VSPs family members, and the default parameters were set for the alignment. Then, the maximum likelihood phylogenetic tree was constructed using the JTT model. MEME was used to predict the conserved motifs of the proteins used to construct the phylogenetic tree. The specific analysis parameters were to select the 0-order background model, limit the width of a single motif to between 6 and 50, and set the number of motifs to 15. The results are shown in Figure 2. Figure 1 As shown, Stylosanthes VSPs have high homology with Arabidopsis VSPs, and the six SgVSPs are clustered with different Arabidopsis VSPs in the evolutionary tree, and the clustering relationship is highly consistent with the conserved motifs. This shows that the constructed phylogenetic tree is reliable, and the six Stylosanthes SgVSP1-SgVSP6 involved in the present invention belong to the VSP protein in the HAD superfamily.

[0052] Example 3: Overexpression of Stylosanthes SgVSPs Family Genes in Slender-stemmed Stylosanthes

[0053] 1. Construction of plant overexpression vector

[0054] The pCXSN vector was digested with restriction endonuclease Xcm I, and the digestion system (50 μl) was as follows: 10 μl (5 μg) of pCXSN vector plasmid, 2.5 μl of Xcm I, 5 μl of endonuclease buffer, 30 μl of ddH2O, and incubated in a water bath at 37°C for 2 h; the purified PCR product and the digested vector were connected, and the pCXSN vector was connected with the six gene fragments cloned in Example 1 respectively using the homologous recombinase ClonExpress IIOne Step Cloning Kit (C112-01, Vazyme), and the connection products were transformed into Escherichia coli DH5α (DL1001, Weidi Biotechnology) by heat shock method and sequenced. After sequencing was correct, the plasmid DNA was extracted using the plasmid DNA extraction kit FastPure Plasmid Mini Kit (DC201-01, Vazyme) was used to extract the recombinant plasmids to obtain the recombinant vector plasmids pCXSN-SgVSP1, pCXSN-SgVSP2, pCXSN-SgVSP3, pCXSN-SgVSP4, pCXSN-SgVSP5, and pCXSN-SgVSP6;

[0055] The above 6 recombinant vector plasmids and pCXSN empty plasmid (blank control) were transformed into Ar1193 Agrobacterium rhizogenes, and the transformed Ar1193 Agrobacterium rhizogenes was stored at -80°C for later use.

[0056] 2. Transformation of in vitro hairy roots of Stylophora slender

[0057] The specific steps for transformation of in vitro hairy roots of S. stylosanthes are as follows:

[0058] The Ar1193 Agrobacterium rhizogenes culture (glycerol stock, OD600 = 1.0) after transformation stored at -80°C was spread on a plate containing 50 mg L -1 Kan (Kanamycin, Kan) and 50mg L -1 Streptomycin (Stre) was placed on an LB plate and inverted at 28°C for 2 days. After the colonies grew, a single clone was picked and placed in 5 mL containing 50 mg L -1 Kan and 50mg L - 1 Stre LB liquid medium, 28 ℃, 200rpm overnight culture activation. Take 60μl activated bacterial solution to 10mL containing 50mg L -1 Kan and 50mg L -1 Stre in LB liquid medium and culture to OD 600 =1.0, centrifuge at 5000 rpm for 10 min, discard the supernatant, and resuspend the cells in LB liquid medium without antibiotics to OD600 =0.6, the infection solution was prepared;

[0059] Select seeds of slender-stemmed stylophora with full grains, place them in a 2mL centrifuge tube, add an appropriate amount of sterile water, heat shock at 80℃ for 3min, aspirate the sterile water in the clean bench, add an equal volume of 75% ethanol solution for disinfection for 3min, rinse with sterile water 3 times, disinfect with 0.1% mercuric chloride solution for 10min, and rinse with sterile water 6 times. Spread the disinfected seeds on sterilized filter paper soaked with sterile water, seal in a sterile culture dish, and germinate for 2d in the dark at 25℃;

[0060] Use tweezers to take out the 2-day-old stylosanthes seeds from the culture dish, use a scalpel to remove the hypocotyl about 3 mm below the cotyledon node, cut the two cotyledons in half along the cotyledon node, and make a wound on the cotyledon to obtain the cotyledon explants required for infection. Soak the cotyledon explants in the infection solution for 15 minutes, filter out the explants with sterile gauze, and place the infected explants on sterile filter paper to absorb the excess bacterial solution. Transfer the infected explants to the co-culture medium (MS + 2% sucrose + 3.5 g L -1 Plant gel) in the dark for 3 days; 200 mg L -1 The explants were washed with Timentin solution, and finally the excess water was sucked out and the explants were inserted into the induction medium (1 / 2MS + 8mg L -1 Hygromycin + 200mg L -1 Timentin + 2% sucrose + 3.5g L -1 The culture medium was replaced every 7 days in a light culture medium (25±1°C, 2000Lx, 16h light / 8h dark) until the hairy roots of the slender-stemmed stylosanthes grew out.

[0061] 3. Identification of positive hairy roots

[0062] 0.5 g of the fresh hairy root strains cultured above were taken and placed in a mortar, and then quickly ground into powder after adding liquid nitrogen. The hairy root DNA was extracted using the SteadyPure Plant Genomic DNA Extraction Kit (AG21026, Aikerui Biotech), and PCR identification was performed using this as a template. At the same time, PCR identification was performed using Agrobacterium transformed with pCXSN-SgVSP1 to pCXSN-SgVSP6 plasmids for comparison;

[0063] Oligo 7 software was used to design gene-specific primers. The primers used for PCR detection of SgVSP1-SgVSP6 positive transgenic hairy roots were as follows: the forward primers all used the pCXSN vector universal primer pCXSN-F: GAACAAAAGTTGATTTCTGAAGAAGA (SEQ ID NO: 25), and the rear primers corresponded to genes SgVSP1, SgVSP2, SgVSP3, SgVSP4, SgVSP5, and SgVSP6, using SgVSP1-OE-R:

[0064] TGGATCCCCAATACTTCAAGGAATATAATACATTGGGTTTG (SEQ ID NO: 14);

[0065] SgVSP2-OE-R:

[0066] TGGATCCCCAATACTTTAAGCAATGTAGTAAATGGAATTTG (SEQ ID NO: 16);

[0067] SgVSP3-OE-R:

[0068] TGGATCCCCAATACTTTACCTCAAAATAAGACGTTCATAG (SEQ ID NO: 18);

[0069] SgVSP4-OE-R:

[0070] TGGATCCCCAATACTTTAGGGAACAAAATACATGGGA (SEQ ID NO: 20);

[0071] SgVSP5-OE-R:

[0072] TGGATCCCCAATACTCTATGATGGTTTTCTTTGTTGCT (SEQ ID NO: 22);

[0073] SgVSP6-OE-R:

[0074] TGGATCCCCAATACTCTAATGTAAATTGTGTGTGGTTTG (SEQ ID NO: 24);

[0075] The detection primers of the housekeeping gene PTB2 of Stylosanthes (front primer PTB2-RT-F: TGGGAAGCGATTAGAAGTCA (SEQ ID NO: 26), rear primer PTB2-RT-R: AATGGTTCCATGCTCCTCCA (SEQ ID NO: 27)); the EST detection primers of the rolB gene of the Ri plasmid of Agrobacterium rhizogenes (front primer rolB-EST-F:

[0076] GCTCTTGCAGTGCTAGATTT (SEQ ID NO: 28), rear primer rolB-EST-R: GAAGGTGCAAGCTACCTCTC (SEQ ID NO: 29)); Hyg gene EST detection primers on pCXSN plasmid (front primer Hyg-EST-F: AGGGTGTCACGTTGCAAG (SEQ ID NO: 30), rear primer Hyg-EST-R: AAGACCAATGCGGAGCATATAC (SEQ ID NO: 31)); the above primers were synthesized by Qingke Biotechnology Co., Ltd.;

[0077] The PCR reaction system was 10 μl of 2× Rapid Taq Master Mix (P222-01, Vazyme), 0.5 μl of upstream and downstream primers, 2 μl of template, and 7 μl of ddH2O. The PCR reaction program was 95°C pre-denaturation for 3 minutes; 94°C denaturation for 15 seconds, 56°C annealing for 15 seconds, and 72°C extension for 15 seconds, for a total of 33 cycles; then 72°C thorough extension for 5 minutes; and storage at 4°C.

[0078] PCR identification results Figure 2 As shown, Figure 2 A. Figure 2 B. Figure 2 C. Figure 2 D. Figure 2 E. Figure 2 F are the electrophoresis results of PCR products of SgVSP1~SgVSP6 transgenic hairy roots, (in the figure, M: DL2000 Marker; N: negative control, ddH2O as template; P: positive control, Agrobacterium transferred into pCXSN-SgVSP1~pCXSN-SgVSP6 plasmids as template; CK: DNA of transgenic hairy root samples without pCXSN as template; OE1~OE3 (transgenic hairy root lines): DNA extracted from transgenic hairy roots overexpressing pCXSN-SgVSP1~pCXSN-SgVSP6 as template), from Figure 2It can be seen that compared with the CK control group (pCXSN empty transgenic strain), specific bands can be amplified in the transgenic hairy root strains OE1 to OE3 of Slender-stemmed Stylosanthes that overexpress SgVSP1 to SgVSP6, indicating that these strains all carry the SgVSP1 to SgVSP6 gene fragments; the specific fragment of the Stylosanthes housekeeping gene PTB2 was amplified in CK and the transgenic lines that overexpress SgVSP1 to SgVSP6, while the corresponding gene was not detected in P (Agrobacterium transferred into pCXSN-SgVSP1 to pCXSN-SgVSP6 plasmids), indicating that the sample is reliable; in addition, the specific fragments of the rolB gene and the Hyg gene can be amplified in CK and the transgenic lines OE1 to OE3 that overexpress SgVSP1 to SgVSP6, indicating that these genes have been integrated into the genome of the hairy roots of Slender-stemmed Stylosanthes, and the obtained hairy roots are all transgenic materials. Figure 3 As shown (line 1, line 2, and line 3 represent lines 1 to 3, respectively), the transgenic hairy roots grew in the culture medium for 28 days with good growth status and no phenotypic differences.

[0079] Example 4: Effect of overexpression of SgVSP1 to SgVSP6 genes on crude protein content in transgenic hairy roots of Slender-stemmed Stylosanthes

[0080] Take the above 6 transgenic hairy root samples and place them in a 65℃ oven for 6h; weigh 0.1g of the dried samples and put them into the bottom of a 50ml digestion tube, add 5ml of concentrated sulfuric acid, shake well and leave overnight; heat on a low fire in a far-infrared furnace, and then raise the temperature to 260℃ and heat for 1h after the sulfuric acid emits white smoke; remove the solution when it is uniformly brown-black, add 3ml of H2O2 after cooling slightly, and heat to a slight boil (380℃) and digest for about 30 minutes, add H2O2 again after cooling slightly and digest again, repeat this several times, and the amount of H2O2 added each time should be reduced gradually; after digestion until the solution is colorless or clear, heat it for about 10min to remove the remaining H2O2; cool to room temperature, add ddH2O to make the volume 50ml, and use it as a sample solution for determining the nitrogen content of plants after it is clarified; draw 10ml of the sample solution onto the machine and use KjeltecTM The nitrogen content (%) was determined using a 8400 fully automatic Kjeldahl nitrogen analyzer (FOSS, Denmark). The operating steps were referred to the product (instrument) instructions. Finally, the crude protein content was calculated using formula (1).

[0081] Crude protein content (%) = nitrogen content (%) × 6.25 (1)

[0082] The results are as follows Figure 4As shown (CK: transgenic hairy root line expressing pCXSN empty vector; SgVSP1-OE, SgVSP2-OE, SgVSP3-OE, SgVSP4-OE, SgVSP5-OE, SgVSP6-OE: transgenic hairy root lines overexpressing SgVSP1, SgVSP2, SgVSP3, SgVSP4, SgVSP5, SgVSP6, respectively; asterisks indicate significant differences between CK and SgVSP1-OE~SgVSP6-OE (Student's t-test), *: P<0.05; **: P<0.01; ***: P<0.001. Each bar graph contains the crude protein content of 3 independent transgenic lines (line 1, line 2, line 3) of one gene, i.e., 3 replicates). Figure 4 It can be seen that the crude protein content of transgenic hairy roots overexpressing SgVSP1 to SgVSP6 was significantly higher than that of CK (control). Specifically, the average crude protein content of transgenic hairy roots of CK was 15.54%, and the average crude protein content of transgenic hairy roots of SgVSP1-OE was 22.34%, which was 6.80% higher than that of CK group; the average crude protein content of transgenic hairy roots of SgVSP2-OE was 20.64%, which was 5.10% higher than that of CK group; the average crude protein content of transgenic hairy roots of SgVSP3-OE was 20.55%, which was 5.01% higher than that of CK group; and the average crude protein content of transgenic hairy roots of SgVSP4-OE was 21.8%, which was 5.2% higher than that of CK group. The average crude protein content of the transgenic hairy roots of the slender-stem stylosanthes of OE was 23.36%, which was 6.82% higher than that of the CK group; the average crude protein content of the transgenic hairy roots of the slender-stem stylosanthes of SgVSP5-OE was 21.83%, which was 6.29% higher than that of the CK group; the average crude protein content of the transgenic hairy roots of the slender-stem stylosanthes of SgVSP6-OE was 21.33%, which was 5.79% higher than that of the CK group; therefore, it was shown that overexpression of SgVSP1~SgVSP6 can significantly increase the crude protein content of the transgenic hairy roots of the slender-stem stylosanthes.

[0083] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of a Stylosanthes SgVSPs family gene in increasing the crude protein content of plants.

2. The use of the Stylosanthes SgVSPs family gene in increasing the crude protein content of plants according to claim 1, characterized in that: The Stylosanthes SgVSPs gene family includes SgVSP1 gene, SgVSP2 gene, SgVSP3 gene, SgVSP4 gene, SgVSP5 gene and SgVSP6 gene; the CDS sequence of the SgVSP1 gene is shown in SEQ ID NO.1; the CDS sequence of the SgVSP2 gene is shown in SEQ ID NO.2; the CDS sequence of the SgVSP3 gene is shown in SEQ ID NO.3; the CDS sequence of the SgVSP4 gene is shown in SEQ ID NO.4; the CDS sequence of the SgVSP5 gene is shown in SEQ IDNO.5; the CDS sequence of the SgVSP6 gene is shown in SEQ ID NO.

6.

3. The use of the Stylosanthes SgVSPs family gene in increasing the crude protein content of plants according to claim 1, characterized in that: The amino acid sequence encoded by the SgVSP1 gene is shown in SEQ ID NO.7; the amino acid sequence encoded by the SgVSP2 gene is shown in SEQ ID NO.8; the amino acid sequence encoded by the SgVSP3 gene is shown in SEQ ID NO.9; the amino acid sequence encoded by the SgVSP4 gene is shown in SEQ ID NO.10; the amino acid sequence encoded by the SgVSP5 gene is shown in SEQ ID NO.11, and the amino acid sequence encoded by the SgVSP6 gene is shown in SEQ ID NO.

12.

4. The use of the Stylosanthes SgVSPs family gene in increasing the crude protein content of plants according to claim 1, characterized in that: The plant is Stiletto.

5. The use of the Stylosanthes SgVSPs family gene in increasing the crude protein content of plants according to claim 1, characterized in that: The expression level of the SgVSP1 gene, the SgVSP2 gene, the SgVSP3 gene, the SgVSP4 gene, the SgVSP5 gene or the SgVSP6 gene is increased in the plant to increase the crude protein content of the plant.

6. The use of the Stylosanthes SgVSPs family gene in increasing the crude protein content of plants according to claim 5, characterized in that: The method for increasing the expression level of SgVSP1 gene, SgVSP2 gene, SgVSP3 gene, SgVSP4 gene, SgVSP5 gene or SgVSP6 gene in plants is as follows: constructing a recombinant plant expression vector that overexpresses SgVSP1 gene, SgVSP2 gene, SgVSP3 gene, SgVSP4 gene, SgVSP5 gene or SgVSP6 gene through transgenic technology, and transferring the recombinant plant expression vector into the plant through Agrobacterium-mediated method.

Images