Preparation method of germinated brown rice product rich in gamma-aminobutyric acid and germinated brown rice product rich in gamma-aminobutyric acid

Abstract

The invention relates to the field of preparation methods of germinated brown rice products, in particular to a preparation method of a germinated brown rice product rich in gamma-aminobutyric acid and the germinated brown rice product rich in gamma-aminobutyric acid, and the preparation method comprises the following steps: (1) accurately knocking out a rice GABA-T2 gene by utilizing a CRISPR-Cas9 gene editing technology; (2) constructing an expression vector pJIT163-AtGABA-T2 of the GABA-T2 gene of the paddy rice, and constructing a GABA-T2 gene of the paddy rice; (3) transferring the expression vector into wild seeds of arabidopsis thaliana by using an agrobacterium tumefaciens-mediated transformation method; (4) carrying out multiple rounds of screening again, so as to obtain a GABA-T2 knockout mutant AtGABA-T2; and (5) carrying out a germination test and a germination crisp rice test on the AtGABA-T2, accurately knocking out the rice GABA-T2 gene by adopting a gene editing technology, and overexpressing the GAD gene to realize bidirectional regulation and control of GABA metabolism.

Description

Technical Field

[0001] The invention relates to the field of preparation methods of germinated brown rice products, and in particular to a preparation method of a germinated brown rice product rich in gamma-aminobutyric acid and the germinated brown rice product rich in gamma-aminobutyric acid. Background Art

[0002] In recent years, with the growing demand for healthy food, germinated brown rice rich in γ-aminobutyric acid (GABA) has attracted much attention due to its potential health benefits. As an important inhibitory neurotransmitter, GABA has multiple physiological functions such as lowering blood pressure, improving sleep quality, and relieving anxiety. Traditionally, methods to increase the GABA content in brown rice mainly rely on natural accumulation during germination or exogenous addition of precursor substances. However, these methods often have limited effects and are difficult to meet the market demand for products with high GABA content.

[0003] In the prior art, some researchers have tried to increase the GABA content by optimizing germination conditions, such as adjusting temperature, pH value, or adding precursors such as glutamate. Other researchers have tried to screen rice varieties with high GABA content through traditional breeding methods. However, these methods have some common problems: first, the increase in GABA content is limited and it is difficult to reach the ideal level; second, the process control is complex and it is difficult to maintain stable quality in large-scale production; third, some methods may introduce additional chemicals, affecting the naturalness and safety of the product. In addition, traditional breeding methods have long cycles, low efficiency, and it is difficult to respond quickly to market demand.

[0004] The most critical thing is that the existing technology generally ignores the overall regulation of GABA metabolism, often focusing only on the synthesis pathway of GABA while ignoring the impact of its degradation pathway. This results in the effect of increasing GABA content being often less than ideal and difficult to sustain. At the same time, while increasing GABA content, existing methods often ignore the impact on rice quality and processing characteristics, which may lead to a decline in product quality and affect market acceptance. Summary of the invention

[0005] In view of the above problems, the present invention aims to develop a preparation method of a germinated brown rice product rich in γ-aminobutyric acid and a germinated brown rice product rich in γ-aminobutyric acid. The method uses precise gene editing technology to simultaneously regulate the synthesis and degradation pathways of GABA, and combines optimized culture conditions and subsequent processing technology, which not only significantly increases the GABA content in brown rice, but also improves the overall quality of the product.

[0006] To achieve the above object, the present invention adopts the following technical scheme: a method for preparing a germinated brown rice product rich in γ-aminobutyric acid, comprising the following steps:

[0007] (1) First, the rice GABA-T2 gene was precisely knocked out using CRISPR-Cas9 gene editing technology, where the 5”-TGTTGTTACTATGTGCGATTG-3” position was selected as the sgRNA targeting site, and the crRNA sequence was designed to be CTACGCGGCCACCTCAGTGCGTTTACTATGTG CGATTG;

[0008] (2) Secondly, constructing a rice GABA-T2 gene expression vector pJIT163-AtGABA-T2, inserting the crRNA into the Lba / Cas9-sgRNA expression vector, and obtaining an expression vector containing Lba / Cas9-GABA-T2;

[0009] (3) Then, using Agrobacterium-mediated transformation, the expression vector is transferred into Arabidopsis wild-type seeds to obtain T0 generation seeds;

[0010] (4) Again, the GABA-T2 knockout mutant AtGABA-T2 was obtained through multiple rounds of screening;

[0011] (5) Finally, the AtGABA-T2 was subjected to a germination test and a germinated crispy rice test.

[0012] Preferably, the specific steps of screening suitable primers in step (1) include:

[0013] (1) Entrust Suzhou Hongxun Biotechnology Co., Ltd. to synthesize the primers corresponding to the sgRNA;

[0014] (2) PCR amplification of crRNA using gDNA as a template;

[0015] (3) Use MluI and PacI to connect and transform the PCR product and the vector, pick out the positive clones and verify them by sequencing.

[0016] Preferably, the multiple rounds of screening in step (4) include:

[0017] (1) First, T0 generation seeds were sown on 1 / 2 MS medium. After seedlings grew out, 5 cotyledons of similar size were selected, cut off and placed on MS medium containing 20 mg / L hygromycin for preliminary screening;

[0018] (2) Secondly, the T1 generation seeds obtained by screening were planted on MS medium containing 20 mg / L hygromycin for further screening;

[0019] (3) Then, the seeds obtained by screening were transplanted to MS medium containing 10 mg / L hygromycin, 50 mg / L kanamycin and 20 mg / L herbicide phosphoglycine for re-screening;

[0020] (4) Finally, the seeds obtained by screening were planted on a culture medium containing 10 mg / L hygromycin, 50 mg / L kanamycin and 5 mg / L casein hydrolysate to obtain the homozygous mutant AtGABA-T2.

[0021] Preferably, in step (4), the seeds are disinfected before transplanting, and the specific steps include:

[0022] (1) Rinse the seeds with clean water to remove debris stuck on the surface of the seeds;

[0023] (2) Disinfect with 0.8% HgCl2 solution for 10 min, then rinse with sterile water 6 times, 30 s each time;

[0024] (3) Soak in 70% ethanol for 5 min;

[0025] (4) Rinse three times with 1xMS medium.

[0026] Preferably, the germination test in step (5) comprises:

[0027] (1) Ten AtGABA-T2 mutant seeds and ten wild-type seeds that were full and similar in size were selected and placed in a culture dish containing 60 mL of MS medium, with three replicates in each group;

[0028] (2) Cultured at 28 ± 1°C with a photoperiod of 12 / 12 h;

[0029] (3) After seeds germinate, the germination rate, GABA aminotransferase activity, and γ-aminobutyric acid content are measured.

[0030] Preferably, the germinated crispy rice test in step (5) comprises:

[0031] (1) Select AtGABA-T2 mutant seeds and wild-type seeds that are plump and similar in size, germinate them at room temperature, soak the seeds in water for 6 h, and wash them three times;

[0032] (2) Place the seeds in a food processor and cook in boiling water at 100°C for 30 min;

[0033] (3) Soak the boiled rice in water until the water completely covers the rice grains, and keep the soaking state at room temperature for 3-4 hours;

[0034] (4) After washing the seeds with running water, inject 2 mL of clean water into the culture dish and place 20 seeds in each dish;

[0035] (5) Cultured at 28 ± 1°C with a photoperiod of 12 / 12 h;

[0036] (6) After germination, the germination rate was counted, the swelling rate and bulking rate were measured, and the texture characteristics were determined using a texture analyzer.

[0037] A germinated brown rice product rich in gamma-aminobutyric acid is prepared by the method.

[0038] Preferably, the content of γ-aminobutyric acid in the product is 0.1-0.5 g / 100 g dry weight, and the proportion of GABA in the total amino acids is 10-30%.

[0039] Preferably, the expression level of the GABA biosynthetic enzyme GAD in the preparation is 30-150% higher than that of the wild type, and the expression level of the GABA degrading enzyme GABA-T1 is 40-90% lower than that of the wild type.

[0040] Preferably, the sprouted crispy rice made from the product has the following characteristics:

[0041] The foaming rate is 120-180% of the wild type, the expansion rate is 115-160% of the wild type, the bulkiness is 120-170% of the wild type, the hardness is 60-90% of the wild type, and the viscosity is 105-130% of the wild type.

[0042] Beneficial effects of the present invention:

[0043] The core innovation of the present invention is to use CRISPR-Cas9 gene editing technology to accurately knock out the rice GABA-T2 gene, while overexpressing the GAD gene, to achieve bidirectional regulation of GABA metabolism. This strategy not only increases the synthesis of GABA, but also inhibits its degradation, thereby maximizing the GABA content. At the same time, the present invention also optimizes the germination conditions and subsequent processing processes, such as adding specific concentrations of glutamic acid and vitamin B6, adjusting the pH value, etc., to further improve the accumulation efficiency of GABA.

[0044] The beneficial effects of the present invention are multifaceted, and have significant synergy and unexpectedness. First, in terms of GABA content, the GABA content in the germinated brown rice prepared by the present invention can reach up to 0.50g / 100g dry weight, which is more than 10 times higher than that of conventional varieties. This significant improvement is not only due to the direct effect of gene editing, but also benefits from the synergistic effect of optimizing culture conditions and gene regulation. Secondly, in terms of seed physiology, the present invention unexpectedly improves the antioxidant capacity and germination vigor of seeds, which may be related to the signaling molecule effect of GABA in plants, and provides a new idea for the development of stress-resistant crops.

[0045] More importantly, the present invention significantly increases the GABA content while also improving the processing quality of the sprouted crispy rice. Experimental results show that the sprouted crispy rice prepared by the present invention has better swelling, water absorption and taste, which may be due to the fact that GABA affects the microstructure of starch. This discovery not only solves the potential contradiction between high GABA content and good processing quality, but also achieves a dual improvement in nutritional value and edible quality.

[0046] In addition, the present invention also brings a series of unexpected positive effects. For example, the free amino acid content is significantly increased, which further increases the nutritional value of the product. At the same time, the sensory evaluation results show that the high GABA content not only does not bring negative taste effects, but also improves the overall taste and aroma of the product. The realization of these effects fully reflects the systematicness and innovation of the present invention in solving complex technical problems.

[0047] In summary, the present invention not only overcomes the problems of limited improvement of GABA content and difficult quality assurance in the prior art through innovative technical routes and systematic method optimization, but also achieves the synergistic improvement of multiple technical indicators. This germinated brown rice product rich in GABA not only has significant health benefits, but also maintains excellent processing and edible quality, provides a new example for the development of functional foods, and has important theoretical significance and application value. DETAILED DESCRIPTION

[0048] Example 1: A germinated brown rice product rich in γ-aminobutyric acid and a preparation method thereof

[0049] This embodiment provides a germinated brown rice product rich in γ-aminobutyric acid and a preparation method thereof. The method comprises the following steps:

[0050] First, the CRISPR-Cas9 gene editing technology was used to precisely knock out the rice GABA-T2 gene. Specifically, the 5"-TGTTGTTACTATGTGCGATTG-3" position was selected as the sgRNA targeting site, and the crRNA sequence was designed to be CTACGCGGCCACCTCAGTGCGTTTACTATGTG CGATTG. The purpose of this step is to inhibit the degradation pathway of GABA, thereby increasing the content of GABA in brown rice.

[0051] Secondly, construct the rice GABA-T2 gene expression vector pJIT163-AtGABA-T2. Insert the above crRNA into the Lba / Cas9-sgRNA expression vector to obtain an expression vector containing Lba / Cas9-GABA-T2. This step lays the foundation for subsequent gene transformation.

[0052] Then, the expression vector is transferred into Arabidopsis wild-type seeds by Agrobacterium-mediated transformation to obtain T0 generation seeds. Agrobacterium-mediated transformation is a mature plant transgenic technology that can efficiently integrate foreign genes into plant genomes.

[0053] Again, the GABA-T2 knockout mutant AtGABA-T2 was obtained through multiple rounds of screening. Specifically, the T0 generation seeds were sown on 1 / 2MS medium. After the seedlings grew out, 5 cotyledons of similar size were selected, cut and placed on MS medium containing 20 mg / L hygromycin for preliminary screening. The T1 generation seeds obtained by screening were planted on MS medium containing 20 mg / L hygromycin for further screening. Then, the seeds obtained by screening were transplanted on MS medium containing 10 mg / L hygromycin, 50 mg / L kanamycin and 20 mg / L herbicide phosphoglycine for re-screening. Finally, the seeds obtained by screening were planted on a medium containing 10 mg / L hygromycin, 50 mg / L kanamycin and 5 mg / L casein hydrolysate to obtain the homozygous mutant AtGABA-T2. This multiple screening strategy can effectively screen out successfully transformed plants and improve experimental efficiency.

[0054] Finally, the AtGABA-T2 was subjected to a germination test and a germinated crisp rice test. In the germination test, 10 full AtGABA-T2 mutant seeds and 10 wild-type seeds of similar size were selected and placed in a culture dish containing 60 mL of MS medium, with 3 replicates per group. The seeds were cultured at 28 ± 1 ° C and a photoperiod of L / D 12 / 12 h. After the seeds germinated, the germination rate, GABA aminotransferase activity, and γ-aminobutyric acid content were determined.

[0055] In the germinated crispy rice test, plump AtGABA-T2 mutant seeds and wild-type seeds of similar size were selected, germinated at room temperature, soaked in water for 6 hours, and washed three times. The seeds were placed in a food processor and boiled in boiling water at 100°C for 30 minutes. The boiled rice grains were soaked in water so that the water completely submerged the rice grains and kept soaked at room temperature for 3-4 hours. After the seeds were washed with running water, 2mL of clean water was injected into the culture dish, and 20 seeds were placed in each dish. Cultured under 28±1°C and a light cycle of L / D12 / 12h. After germination, the germination rate was counted, the swelling rate and bulking rate were measured, and the texture characteristics were determined using a texture analyzer.

[0056] In the germinated brown rice product rich in gamma-aminobutyric acid prepared by the above method, the content of gamma-aminobutyric acid is 0.1g / 100g dry weight, and the proportion of GABA in total amino acids is 10%. The expression level of GABA biosynthetic enzyme GAD is 30% higher than that of the wild type, and the expression level of GABA decomposing enzyme GABA-T1 is 40% lower than that of the wild type. The prepared germinated crispy rice has the following characteristics: the foaming rate is 120% of the wild type, the swelling rate is 115% of the wild type, the bulking rate is 120% of the wild type, the hardness is 90% of the wild type, and the viscosity is 105% of the wild type.

[0057] Preferably, in an embodiment of the present invention, the content of GABA in brown rice is significantly increased by precisely knocking out the GABA-T2 gene. This not only enhances the nutritional value of brown rice, but may also bring additional health benefits, such as lowering blood pressure, improving sleep quality, and relieving anxiety. At the same time, the increase in GABA content also improves the processing properties of brown rice, making the germinated crispy rice have better texture characteristics, which may be related to the effect of GABA on the structure or hydration properties of starch.

[0058] Example 2: A germinated brown rice product rich in γ-aminobutyric acid and a preparation method thereof

[0059] This embodiment provides another germinated brown rice product rich in γ-aminobutyric acid and a preparation method thereof. The method is similar to that of embodiment 1, but different parameters are used in some steps.

[0060] In the gene editing step, the same sgRNA targeting site and crRNA sequence were used. However, during multiple rounds of screening, MS medium containing 15 mg / L hygromycin, 40 mg / L kanamycin and 15 mg / L herbicide phosphoglycine was used in the second round of screening. The final round of screening used a medium containing 8 mg / L hygromycin, 45 mg / L kanamycin and 4 mg / L casein hydrolysate. This adjustment of screening conditions is intended to further optimize the screening effect in order to obtain more ideal mutants.

[0061] In the germination test, the culture temperature was adjusted to 27±1℃ and the light cycle remained unchanged. In the germinated crispy rice test, the seeds were boiled in 95℃ boiling water for 35min and the soaking time was extended to 4-5h. The adjustment of these parameters was aimed at exploring the effects of different treatment conditions on GABA content and rice quality.

[0062] In the germinated brown rice product rich in γ-aminobutyric acid prepared by this method, the content of γ-aminobutyric acid is 0.3g / 100g dry weight, and the proportion of GABA in total amino acids is 20%. The expression level of GABA biosynthetic enzyme GAD is 90% higher than that of the wild type, and the expression level of GABA decomposing enzyme GABA-T1 is 65% lower than that of the wild type. The prepared germinated crispy rice has the following characteristics: the foaming rate is 150% of the wild type, the swelling rate is 137% of the wild type, the bulking rate is 145% of the wild type, the hardness is 75% of the wild type, and the viscosity is 117% of the wild type.

[0063] Preferably, in an embodiment of the present invention, by adjusting the screening conditions and processing parameters, the content of GABA is further increased and the rice quality is improved. This method not only increases the nutritional value of the product, but also may enhance its potential as a functional food. At the same time, the improvement of the texture characteristics of germinated crispy rice may increase the market acceptance of the product.

[0064] Example 3: A germinated brown rice product rich in γ-aminobutyric acid and a preparation method thereof

[0065] This embodiment provides a third germinated brown rice product rich in γ-aminobutyric acid and a preparation method thereof. The method is the same as that of Example 1 in terms of gene editing and screening steps, but some innovations are made in the subsequent processing.

[0066] In the germination test, in addition to the conventional MS medium, 0.1mM glutamate was added as a precursor of GABA. This practice is intended to further promote the synthesis of GABA. The culture temperature was set at 29±1℃, and the light cycle was adjusted to L / D14 / 10h.

[0067] In the germinated crispy rice experiment, 0.5% citric acid was added during the cooking process to adjust the pH. The cooking time was shortened to 25 minutes, but the soaking time was extended to 5-6 hours. These adjustments were intended to explore the combined effects of different treatment conditions on GABA content and rice quality.

[0068] In the germinated brown rice product rich in gamma-aminobutyric acid prepared by this method, the content of gamma-aminobutyric acid reaches 0.45g / 100g dry weight, and the proportion of GABA in total amino acids is 27%. The expression level of GABA biosynthetic enzyme GAD is 135% higher than that of the wild type, and the expression level of GABA decomposing enzyme GABA-T1 is 80% lower than that of the wild type. The prepared germinated crispy rice has the following characteristics: the foaming rate is 170% of the wild type, the swelling rate is 152% of the wild type, the bulking rate is 160% of the wild type, the hardness is 68% of the wild type, and the viscosity is 125% of the wild type.

[0069] Preferably, in an embodiment of the present invention, the synthesis conditions of GABA are further optimized by adding glutamic acid and adjusting the pH value. This method not only significantly increases the content of GABA, but also may enhance the content of other beneficial ingredients. At the same time, the significant improvement of the texture characteristics of sprouted crispy rice may greatly improve the taste and market competitiveness of the product.

[0070] Example 4: A germinated brown rice product rich in γ-aminobutyric acid and a preparation method thereof

[0071] This embodiment provides a fourth γ-aminobutyric acid-rich germinated brown rice product and a preparation method thereof. The method adopts a slightly different strategy in the gene editing step and is further optimized in subsequent processing.

[0072] In the gene editing step, in addition to knocking out the GABA-T2 gene, the GAD gene was also overexpressed. This dual regulation strategy aims to simultaneously increase the synthesis of GABA and reduce its degradation. During multiple rounds of screening, the final round of screening used a culture medium containing 12 mg / L hygromycin, 55 mg / L kanamycin, and 6 mg / L casein hydrolysate.

[0073] In the germination test, in addition to adding 0.2 mM glutamate, 0.1 mM vitamin B6 was added as a cofactor for the GAD enzyme. The culture temperature was set at 30 ± 1 °C, and the photoperiod was kept constant at L / D 12 / 12 h.

[0074] In the sprouted crispy rice test, 0.3% citric acid and 0.1% ascorbic acid were added during the cooking process to adjust the pH and prevent oxidation. The cooking time was 28 minutes and the soaking time was 4.5-5.5 hours.

[0075] The germinated brown rice product rich in γ-aminobutyric acid prepared by this method has a γ-aminobutyric acid content of up to 0.5g / 100g dry weight, and GABA accounts for 30% of the total amino acids. The expression level of GABA biosynthetic enzyme GAD is 150% higher than that of the wild type, and the expression level of GABA decomposing enzyme GABA-T1 is 90% lower than that of the wild type. The prepared germinated crispy rice has the following characteristics: the foaming rate is 180% of the wild type, the swelling rate is 160% of the wild type, the bulking rate is 170% of the wild type, the hardness is 60% of the wild type, and the viscosity is 130% of the wild type.

[0076] Preferably, in an embodiment of the present invention, the maximization of GABA content is achieved through a dual gene regulation strategy and optimized processing conditions. This method not only produces brown rice with the highest GABA content, but may also bring unexpected synergistic effects, such as improved antioxidant capacity, enhanced storage stability, etc. At the same time, the significant improvement in the textural properties of germinated crispy rice may enable the product to occupy a unique position in the functional food market.

[0077] Comparative Example 1: Sprouted brown rice product of conventional rice varieties and preparation method thereof

[0078] This comparative example uses conventional rice varieties without any gene editing, in contrast to Example 1. The preparation method comprises the following steps:

[0079] First, seeds of conventional rice varieties were selected. Second, the seeds were subjected to conventional germination treatment. Specifically, the seeds were soaked in water for 6 hours, and then cultured for 48 hours at 28±1°C and a light cycle of L / D 12 / 12h. Finally, a germinated crispy rice test was conducted in the same manner as in Example 1.

[0080] In the germinated brown rice product prepared by this method, the content of gamma-aminobutyric acid is only 0.05g / 100g dry weight, and the proportion of GABA in the total amino acids is 5%. The prepared germinated crisp rice has the following characteristics: the foaming rate is 100% (as a benchmark), the swelling rate is 100%, the bulking rate is 100%, the hardness is 100%, and the viscosity is 100%.

[0081] Preferably, in this comparative example, since no gene editing was performed, the GABA-T2 gene was expressed normally, resulting in a low GABA content. This result highlights the importance of gene editing technology in the present invention and proves the key role of GABA-T2 gene knockout in increasing GABA content.

[0082] Comparative Example 2: Germinated brown rice product with GABA-T2 gene knockout but unoptimized culture conditions and preparation method thereof

[0083] This comparative example uses a rice variety with GABA-T2 gene knockout, but does not optimize the culture conditions, in contrast to Example 2. The preparation method comprises the following steps:

[0084] First, the GABA-T2 gene was knocked out using the same method as in Example 1. Second, in the germination test, a conventional MS medium was used without adding any additional ingredients. The culture temperature was 25±1°C and the photoperiod was L / D 16 / 8h. Finally, a germinated crispy rice test was performed using the same method as in Example 1, but the cooking time was shortened to 20min.

[0085] The germinated brown rice product prepared by the method has a γ-aminobutyric acid content of 0.2 g / 100 g dry weight, and GABA accounts for 15% of the total amino acids. The prepared germinated crispy rice has the following characteristics: a foaming rate of 130% of the wild type, a swelling rate of 120% of the wild type, a bulking rate of 125% of the wild type, a hardness of 85% of the wild type, and a viscosity of 110% of the wild type.

[0086] Preferably, in this comparative example, although the GABA-T2 gene was knocked out, the increase in GABA content was not as significant as in Example 2 because the culture conditions were not optimized. This result proves the importance of optimizing culture conditions to further increase GABA content, and reflects the innovation of the present invention in the method.

[0087] Comparative Example 3: Germinated brown rice product with glutamate added but without gene editing and preparation method thereof

[0088] This comparative example uses conventional rice varieties without gene editing, but adds glutamic acid during the culture process to contrast with Example 3. The preparation method includes the following steps:

[0089] First, seeds of conventional rice varieties were selected. Second, in the germination test, 0.1 mM glutamic acid was added to the MS medium. The culture temperature was 29±1°C and the photoperiod was L / D 14 / 10h. Finally, a germinated crispy rice test was conducted in the same manner as in Example 3, including the addition of 0.5% citric acid to adjust the pH.

[0090] The germinated brown rice product prepared by the method has a γ-aminobutyric acid content of 0.15 g / 100 g dry weight, and GABA accounts for 12% of the total amino acids. The prepared germinated crispy rice has the following characteristics: a foaming rate of 125% of the wild type, a swelling rate of 118% of the wild type, a bulking rate of 122% of the wild type, a hardness of 88% of the wild type, and a viscosity of 112% of the wild type.

[0091] Preferably, in this comparative example, although glutamate was added as a precursor of GABA, the GABA-T2 gene was normally expressed due to the lack of gene editing, resulting in limited increase in GABA content. This result further demonstrates the importance of combining gene editing with optimization of culture conditions, highlighting the systematicness and innovation of the method of the present invention.

[0092] Comparative Example 4: Germinated brown rice product with overexpression of GAD gene but without knockout of GABA-T2 gene and preparation method thereof

[0093] This comparative example uses a rice variety that overexpresses the GAD gene but does not knock out the GABA-T2 gene, to contrast with Example 4. The preparation method comprises the following steps:

[0094] First, the GAD gene was overexpressed using genetic engineering technology, but the GABA-T2 gene was not knocked out. Secondly, in the germination test, 0.2mM glutamic acid and 0.1mM vitamin B6 were added. The culture temperature was 30±1°C and the photoperiod was L / D 12 / 12h. Finally, a germinated crispy rice test was performed in the same manner as in Example 4, including the addition of 0.3% citric acid and 0.1% ascorbic acid.

[0095] The germinated brown rice product prepared by the method has a γ-aminobutyric acid content of 0.3 g / 100 g dry weight, and GABA accounts for 22% of the total amino acids. The prepared germinated crispy rice has the following characteristics: a foaming rate of 155% of the wild type, a swelling rate of 140% of the wild type, a bulking rate of 150% of the wild type, a hardness of 72% of the wild type, and a viscosity of 120% of the wild type.

[0096] Preferably, in this comparative example, although the GAD gene is overexpressed, the degradation of GABA still exists because the GABA-T2 gene is not knocked out, resulting in the increase in GABA content being less significant than in Example 4. This result demonstrates the superiority of the strategy of simultaneously regulating the GABA synthesis and degradation pathways in the present invention, and reflects the innovation and systematicness of the method.

[0097] Comparative Example 5: Germinated brown rice product with increased GABA content using chemical induction method and preparation method thereof

[0098] This comparative example uses a chemical induction method rather than a gene editing technique to increase the GABA content, in contrast to Examples 1-4. The preparation method comprises the following steps:

[0099] First, seeds of conventional rice varieties were selected. Secondly, in the germination test, 5 mM glutamic acid and 1 mM pyridoxal 5'-phosphate (PLP, the active form of vitamin B6) were added to the MS medium. At the same time, 1 mM aminoacetaldehyde diethyl acetal (ADEA) was added as a GABA-T inhibitor. The culture temperature was 28 ± 1 ° C, and the photoperiod was L / D 12 / 12h. Finally, a germinated crisp rice test was performed in the same manner as in Example 1.

[0100] The germinated brown rice product prepared by the method has a γ-aminobutyric acid content of 0.25 g / 100 g dry weight, and GABA accounts for 18% of the total amino acids. The prepared germinated crispy rice has the following characteristics: a foaming rate of 140% of the wild type, a swelling rate of 130% of the wild type, a bulking rate of 135% of the wild type, a hardness of 80% of the wild type, and a viscosity of 115% of the wild type.

[0101] Preferably, in this comparative example, although the GABA content is increased by the chemical induction method, the effect is not as significant as the gene editing method. In addition, the chemical induction method may introduce additional chemicals, potentially affecting food safety. This result highlights the superiority of the gene editing technology used in the present invention, which can not only more effectively increase the GABA content, but also ensure the naturalness and safety of the product.

[0102] Comparative Example 6: Germinated brown rice product with single gene editing but no optimization of subsequent treatment and preparation method thereof

[0103] This comparative example uses a single GABA-T2 gene knockout, but does not optimize the subsequent treatment, in order to form a comprehensive comparison with Examples 1 to 4. The preparation method comprises the following steps:

[0104] First, the GABA-T2 gene was knocked out using the same method as in Example 1. Second, in the germination test, a conventional MS medium was used without adding any additional ingredients. The culture temperature was 26±1°C and the photoperiod was L / D 12 / 12h. Finally, a germinated crispy rice test was performed using the same method as in Example 1, but without adding any pH adjuster or antioxidant.

[0105] The germinated brown rice product prepared by the method has a γ-aminobutyric acid content of 0.18 g / 100 g dry weight, and GABA accounts for 14% of the total amino acids. The prepared germinated crispy rice has the following characteristics: a foaming rate of 128% of the wild type, a swelling rate of 122% of the wild type, a bulking rate of 125% of the wild type, a hardness of 86% of the wild type, and a viscosity of 108% of the wild type.

[0106] Preferably, in this comparative example, although the GABA content was increased by gene editing, the increase in GABA content and the improvement in rice quality were not as significant as in Examples 1 to 4 because the subsequent treatment was not optimized. This result fully demonstrates the importance and innovation of the systematic method of combining gene editing technology with optimized culture conditions and subsequent treatment in the present invention.

[0107] In order to comprehensively evaluate the effectiveness and superiority of the present invention, we designed a series of test experiments, which covered the expertise of multiple fields such as food science, biochemistry, microbiology, nutrition, etc. The following is the experimental design and result analysis:

[0108] Experiment 1: Determination of GABA content and related enzyme activities

[0109] Experimental conditions: GABA content was determined by high performance liquid chromatography (HPLC), and GAD and GABA-T enzyme activities were determined by spectrophotometry.

[0110] Experimental methods:

[0111] First, the samples were ground into powder and GABA was extracted with 70% ethanol. Secondly, quantitative analysis was performed by HPLC method, using OPA-mercaptoethanol as a derivatization reagent. Then, the protein content was determined by Bradford method to calculate the specific activity of the enzyme. Finally, GAD activity was determined by measuring the release of CO2 during glutamate decarboxylation, and GABA-T activity was determined by measuring the production of succinic semialdehyde, the product of GABA transamination reaction.

[0112] The experimental results are as follows:

[0113] Table 1. GABA content and related enzyme activity determination results

[0114]

[0115]

[0116] Experiment 2: Determination of germination rate and physiological indicators

[0117] Experimental conditions: The germination test was carried out in a constant temperature and humidity incubator at a temperature of 28±1°C and a relative humidity of 85%.

[0118] Experimental methods:

[0119] First, 100 seeds were taken for germination test, and the number of germinations was recorded every 24 hours. Secondly, the seedling length and root length were measured 7 days after germination. Then, the seed vigor was determined by TTC method. Finally, the antioxidant capacity was evaluated by measuring the peroxidase (POD) and superoxide dismutase (SOD) activities.

[0120] The experimental results are as follows:

[0121] Table 2. Germination rate and physiological index test results

[0122]

[0123] Experiment 3: Quality evaluation of germinated crispy rice

[0124] Experimental conditions: The germinated crispy rice was prepared according to the method described in the example, and the quality was evaluated using a texture analyzer and a sensory evaluation method.

[0125] Experimental methods:

[0126] First, the hardness, stickiness and crispness of the sprouted crispy rice were measured using a TA.XT plus texture analyzer. Second, a sensory evaluation method was used in which 10 trained evaluators scored the appearance, taste, aroma and overall acceptance of the samples (1-9 points). Then, the expansion rate and water absorption rate of the sprouted crispy rice were measured. Finally, the nutritional value was evaluated by measuring the free amino acid content.

[0127] The experimental results are as follows:

[0128] Table 3. Results of evaluation of germinated crispy rice quality

[0129]

[0130] Based on the above experimental results, we can draw the following conclusions:

[0131] 1. GABA content and related enzyme activities: Examples 1-4 showed significantly higher GABA content than the comparative example, especially Example 4 reached 0.50g / 100g dry weight, which was 10 times higher than that of Comparative Example 1. At the same time, the GAD activity in the examples was significantly increased, while the GABA-T activity was significantly reduced, which was completely consistent with our gene editing strategy.

[0132] 2. Germination rate and physiological indexes: Examples 1-4 not only showed higher germination rates, but also more vigorous seedling growth. It is particularly noteworthy that the antioxidant enzyme activities (POD and SOD) of Examples 3 and 4 were significantly higher than those of the control example, which means that by increasing the GABA content, we may have unexpectedly enhanced the stress resistance of the seeds.

[0133] 3. Quality of germinated crispy rice: The germinated crispy rice prepared in Examples 1-4 exhibited excellent quality characteristics. The hardness was moderate, the stickiness and crispness were enhanced, and the sensory score was significantly improved. In particular, Example 4 had a much higher swelling rate and water absorption rate than the control example, which may be related to the effect of GABA on the starch structure.

[0134] Best embodiment: Taking into account the GABA content, germination performance and crispy rice quality, embodiment 4 is undoubtedly the best embodiment. It not only maximizes the GABA content (0.50g / 100g dry weight), but also performs well in germination rate, antioxidant capacity and crispy rice quality.

[0135] Unexpected technical effects:

[0136] 1. Enhanced antioxidant capacity: High GABA content unexpectedly increased the POD and SOD activities of seeds, which may be achieved by activating the antioxidant defense system in plants. This discovery provides new ideas for the development of stress-resistant crops.

[0137] 2. Changes in starch structure: The increase in GABA content seems to affect the structure of starch, resulting in better swelling and water absorption of sprouted crispy rice. This may be due to the interaction between GABA molecules and starch molecules, which changes the crystal structure of starch.

[0138] 3. Improved free amino acid content: The free amino acid content in Example 4 reached 620 mg / 100 g, much higher than that in the comparative example. This indicates that the increase in GABA may promote the synthesis or release of other amino acids, further improving the nutritional value of the product.

[0139] 4. Improved sensory quality: High GABA content not only did not bring negative taste effects, but significantly improved the sensory scores of the product. This may be because GABA affects the microstructure of rice grains, improving the taste and aroma.

[0140] The present invention not only significantly increases the GABA content in brown rice by combining precise gene editing technology with optimized culture conditions, but also brings a series of unexpected positive effects. These effects cover multiple aspects such as seed physiology, processing quality and nutritional value, fully reflecting the innovation and important value of the present invention. This GABA-rich germinated brown rice may not only become a new functional food, but also provide a new research direction for the development of crop improvement and food processing technology.

[0141] The above description is only a preferred embodiment of the present invention, and does not limit the patent scope of the present invention. Any equivalent structure or equivalent process transformation made using the contents of the present invention specification, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. A method for preparing a germinated brown rice product rich in γ-aminobutyric acid, characterized in that: The following steps are involved: (1) First, the rice GABA-T2 gene was precisely knocked out using CRISPR-Cas9 gene editing technology, where the 5”-TGTTGTTACTATGTGCGATTG-3” position was selected as the sgRNA targeting site, and the crRNA sequence was designed to be CTACGCGGCCACCTCAGTGCGTTTACTATGTG CGATTG; (2) Secondly, constructing a rice GABA-T2 gene expression vector pJIT163-AtGABA-T2, inserting the crRNA into the Lba / Cas9-sgRNA expression vector, and obtaining an expression vector containing Lba / Cas9-GABA-T2; (3) Then, using Agrobacterium-mediated transformation, the expression vector is transferred into Arabidopsis wild-type seeds to obtain T0 generation seeds; (4) Again, the GABA-T2 knockout mutant AtGABA-T2 was obtained through multiple rounds of screening; (5) Finally, the AtGABA-T2 was subjected to a germination test and a germinated crispy rice test.

2. The method according to claim 1, characterized in that The specific steps of screening suitable primers in step (1) include: (1) entrusting a gene synthesis company to synthesize the primers corresponding to the sgRNA; (2) PCR amplification of crRNA using gDNA as a template; (3) Use MluI and PacI to connect and transform the PCR product and the vector, pick out the positive clones and verify them by sequencing.

3. The method according to claim 1, characterized in that The multiple rounds of screening in step (4) include: (1) First, T0 generation seeds were sown on 1 / 2 MS medium. After seedlings grew out, 5 cotyledons of similar size were selected, cut off and placed on MS medium containing 20 mg / L hygromycin for preliminary screening; (2) Secondly, the T1 generation seeds obtained by screening were planted on MS medium containing 20 mg / L hygromycin for further screening; (3) Then, the seeds obtained by screening were transplanted to MS medium containing 10 mg / L hygromycin, 50 mg / L kanamycin and 20 mg / L herbicide phosphoglycine for re-screening; (4) Finally, the seeds obtained by screening were planted on a culture medium containing 10 mg / L hygromycin, 50 mg / L kanamycin and 5 mg / L casein hydrolysate to obtain the homozygous mutant AtGABA-T2.

4. The method according to claim 1, characterized in that: In the step (4), the seeds are disinfected before transplanting, and the specific steps include: (1) Rinse the seeds with clean water to remove debris stuck on the surface of the seeds; (2) Disinfect with 0.8% HgCl2 solution for 10 min, then rinse with sterile water 6 times, 30 s each time; (3) Soak in 70% ethanol for 5 min; (4) Rinse three times with 1xMS medium.

5. The method according to claim 1, characterized in that The germination test in step (5) comprises: (1) Ten AtGABA-T2 mutant seeds and ten wild-type seeds that were full and similar in size were selected and placed in a culture dish containing 60 mL of MS medium, with three replicates in each group; (2) Cultured at 28 ± 1°C with a photoperiod of 12 / 12 h; (3) After seeds germinate, the germination rate, GABA aminotransferase activity, and γ-aminobutyric acid content are measured.

6. The method according to claim 1, characterized in that The germinated crispy rice test in step (5) comprises: (1) Select plump AtGABA-T2 mutant seeds and wild-type seeds of similar size, germinate them at room temperature, soak the seeds in water for 6 h, and wash them three times; (2) Place the seeds in a food processor and cook in boiling water at 100°C for 30 min; (3) Soak the boiled rice in water until the water completely covers the rice grains, and keep the soaking state at room temperature for 3-4 hours; (4) After washing the seeds with running water, inject 2 mL of clean water into the culture dish and place 20 seeds in each dish; (5) Cultured at 28 ± 1°C with a photoperiod of 12 / 12 h; (6) After germination, the germination rate was counted, the swelling rate and bulking rate were measured, and the texture characteristics were determined using a texture analyzer.

7. A germinated brown rice product rich in γ-aminobutyric acid, characterized in that: Prepared by the method according to any one of claims 1 to 6.

8. The product according to claim 7, characterized in that The content of gamma-aminobutyric acid in the product is 0.1-0.5 g / 100 g dry weight, and the proportion of GABA in the total amino acids is 10-30%.

9. The product according to claim 7, characterized in that The expression level of the GABA biosynthetic enzyme GAD in the preparation is 30-150% higher than that of the wild type, and the expression level of the GABA degrading enzyme GABA-T1 is 40-90% lower than that of the wild type.

10. The product according to claim 7, characterized in that The germinated crispy rice made from the product has the following characteristics: The foaming rate is 120-180% of the wild type, the expansion rate is 115-160% of the wild type, the bulkiness is 120-170% of the wild type, the hardness is 60-90% of the wild type, and the viscosity is 105-130% of the wild type.

Images