Application of OsBadh2 gene in cultivation of fragrant japonica rice

Abstract

Application of an OsBadh2 gene in cultivation of aromatic japonica rice belongs to the technical field of biotechnology and plant genetic engineering, the OsBadh2 gene is subjected to targeted editing in a genome of a Jilin-province super japonica rice variety 'Jijing 809' by using a double-target CRISPR / Cas9 gene editing technology, and an OsBadh2 function deletion homozygous mutant strain is obtained. A fragrance identification result shows that leaves and rice of the homozygous mutant strain have fragrance characters. According to the invention, a double-target gene editing technology is utilized to edit the fragrance related gene OsBadh2 of rice in a targeted manner, so that the fragrance character is obtained, the purpose of improving the fragrance character is achieved, and a new fragrant japonica rice germplasm resource and a creation method thereof are provided for rice quality breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of biotechnology and plant gene engineering, and specifically relates to the application of OsBadh2 gene in cultivating fragrant japonica rice. Background Art

[0002] Rice is an important food crop in my country, feeding nearly half of the world's population. With the improvement of people's quality of life, the quality of rice has gradually attracted people's attention. Fragrance is one of the important taste quality traits of rice. In recent years, fragrant rice has been loved by many consumers because of its unique fragrance. Therefore, fragrant rice breeding has become an important research direction of rice quality breeding. There are relatively few fragrant rice resources in japonica rice variety resources, and the existing fragrant rice varieties have the disadvantages of strong regionality, poor lodging resistance, poor disease resistance, and low yield. Therefore, improving the fragrance traits of excellent rice varieties and obtaining high-quality fragrant rice varieties are the main ways to solve the problems in fragrant rice breeding.

[0003] Studies have shown that 2-acetyl-1-pyrroline (2-AP) is the main aromatic compound that produces aroma in aromatic rice (Buttery et al., 1983). Previous studies have suggested that aroma genes may be controlled by single or multiple recessive genes (BERNER et al., 1986; PINSON, 1994; REDDY et al., 1980). In the 1980s, Ahn et al. located the aroma gene on chromosome 8 of rice using molecular marker technology. Subsequently, Bradbury et al. (Bradbury et al., 2005) found that rice aroma is caused by a mutation in the OsBadh2 gene encoding betaine aldehyde dehydrogenase (BADH); and Chen et al. (2017) found that the loss of OsBadh2 function on chromosome 8 of rice promotes the accumulation of 2-AP, which makes rice produce aroma. OsBadh2 is currently the only cloned rice aroma gene.

[0004] In recent years, gene editing technology has developed rapidly. Gene editing technology can be used to modify specific genes, so that crop agronomic traits and quality can be accurately improved. Compared with traditional breeding, it is more accurate, time-saving and effective. CRISPR / Cas9 gene editing technology is very flexible in the selection of target sites, has high editing efficiency, and a relatively simple construction process. Therefore, CRISPR / Cas9 technology is currently widely used in crop quality improvement. Jijing 809 is a nationally approved rice variety in Jilin Province. It has the characteristics of high yield and strong disease resistance, but does not have aroma traits. Therefore, this study used CRISPR / Cas9 technology to perform targeted genome editing on the OsBadh2 gene of Jijing 809, so that Jijing 809 obtained aroma traits and achieved the purpose of quality improvement. It can provide new germplasm resources and technical support for aromatic japonica rice breeding. Summary of the invention

[0005] The present invention provides an application method of a rice aroma gene OsBadh2 in cultivating aromatic japonica rice by using a dual-target gene editing technology, specifically, two targets are respectively designed in Exon3 and Exon4 regions in the CDS sequence of the OsBadh2 gene, and a dual-target gene editing vector is constructed, and the dual-target gene editing vector is introduced into a rice variety by an Agrobacterium-mediated genetic transformation method to obtain a new aromatic rice germplasm, wherein the nucleotide sequences of the two target points of the gene are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0006] The present invention further provides an OsBadh2 gene editing vector pYLCRISPR / Cas9-OsBadh2 constructed using dual-target CRISPR / Cas9 technology, wherein the vector comprises two guide gRNA expression frames having the two target fragments and a Cas9 nuclease, wherein the nucleotide sequences of the two targets are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0007] The beneficial effects of the present invention are:

[0008] The present invention conducts research on the application of OsBadh2 gene in improving the aroma trait of Jilin japonica rice, provides new germplasm resources of aromatic japonica rice for rice breeding in Jilin Province and a method for creating the same, and through targeted gene editing of the gene, can improve the aroma trait of non-aromatic rice varieties, obtain gene-edited new rice germplasm with aroma traits, and provide new germplasm resources of aromatic japonica rice and technical support for aromatic rice breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 Schematic diagram of two target sequences for gene editing and their locations in the gene structure;

[0010] Among them: Target1 represents target 1; Target2 represents target 2; Exon3 represents the third exon; Exon4 represents the fourth exon;

[0011] Figure 2 Schematic diagram of the dual-target gene editing vector pYLCRISPR / Cas9-Badh2;

[0012] Figure 3 This is the electrophoresis diagram of the plasmid bacterial solution PCR detection;

[0013] Wherein: M, 100bp marker; 1-6, monoclonal;

[0014] Figure 4 It is a schematic diagram of the mutation site of the homozygous mutant strain;

[0015] Among them: hyphens represent deleted bases, and arrows point to the positions where mutations occur. DETAILED DESCRIPTION

[0016] The present invention is described in detail below with reference to the accompanying drawings.

[0017] 1 Materials and methods

[0018] 1.1 Experimental Materials

[0019] The recipient rice variety is the Jilin Province's nationally approved rice variety "Jijing 809".

[0020] 1.2 Design of dual-target sites for gene editing of OsBadh2 and construction of vector

[0021] The sequence of OsBadh2 (LOC_Os08g32870) gene was obtained through EnsemblPlants website (http: / / plants.ensembl.org / Oryza_sativa / Info / Index), and the target site was predicted using CRISPR-GE online website (http: / / skl.Scau.edu.cn / ). Two targets were designed in the 3rd and 4th exon regions of OsBadh2, namely target 1: GCCTCTTGATGAAGCAGCAT and target 2: AAGAGCCTATCGGTGTAGTT, respectively (as shown in Table 1). Target site adapter primers were designed according to the target site, and the BLAST analysis of NCBI (https: / / www.ncbi.nlm.nih.gov / ) was used to determine the specificity of the candidate target site and exclude potential off-target sequences. The vector was constructed by referring to the method of Ma et al. (Ma et al., 2015). The gRNA expression cassette with two targets was connected to the Cas9 vector backbone using the "Golden Gate" cloning method to construct the dual-target gene editing vector pYLCRISPR / Cas9-. The gRNA expression cassette with two targets was connected to the Cas9 vector backbone using the "Golden Gate" cloning method to construct the dual-target gene editing vector pYLCRISPR / Cas9-Badh2( Figure 1 ).

[0022] 1.3 Genetic transformation of rice with OsBadh2 gene editing vector

[0023] The OsBadh2 gene editing vector was introduced into the Jilin japonica rice variety Jijing 809 by Agrobacterium-mediated genetic transformation. The specific method is as follows: the rice seeds with husk removed were sterilized, callus tissue was induced, and subcultured. The callus tissue was infected with the Agrobacterium strain EHA105 carrying the pYLCRISPR / Cas9-OsBadh2 plant expression vector. After co-cultivation, hygromycin resistance screening, differentiation, rooting and transplanting, T 0 Generation of gene-edited independent transformed plants. 0 The leaf tissues of the plants were used for the generation of the target gene. DNA was extracted by CTAB method. Specific amplification primers were designed according to the target gene sequence: OsBadh2-F: TGAAAGTAAAACAGTGACCAGTGC, OsBadh2-R: GGAGAGAGTAGCTGCTAGGTACA, and T 0 The PCR products were detected by 1% agarose gel electrophoresis. 0 Generation of plants.

[0024] 1.4 Screening of homozygous mutant strains of OsBadh2 gene editing

[0025] The forward primer OsBadh2-F and the reverse primer OsBadh2-R (primer sequences are the same as above 1.3) were used to screen the T0, T1 and T2 generation plants by PCR amplification. The PCR products were sent to Kumei Biotech for sequencing to identify the OsBadh2 gene mutants. The sequencing results were analyzed by DSDecode (http: / / dsdecode.scgene.com) and SnapGene to screen the gene-edited homozygous mutant strains.

[0026] 1.5 Fragrance identification of gene-edited homozygous mutant strains

[0027] Fragrance identification of gene-edited homozygous offspring materials: Select the fragrant control variety Daohuaxiang and the non-fragrant control variety Jijing 809 as control materials, use the leaf KOH solution immersion identification method and rice chewing method, and a 5-person identification team will determine the presence or absence of fragrance. The specific operation steps of the leaf KOH solution immersion identification method are to sample the gene-edited homozygous offspring materials, cut about 2g of leaf samples into pieces and put them into a glass culture dish, add an appropriate amount of about 10mL of 1.7% KOH solution, and place it at room temperature. After 10 minutes, pay attention to open the culture dish to screen for fragrant gene-edited offspring. The specific operation steps of the rice chewing method are to remove the husk of mature rice seeds, put them in the mouth, and chew them carefully to taste the fragrance.

[0028] 1.7 Evaluation of agronomic traits of gene-edited offspring

[0029] The recipient variety Jijing 809 and the homozygous line of the gene-edited mutant were cultivated under the same cultivation conditions, and 5 plants were selected for investigation of relevant agronomic traits, including plant height, ear length, number of tillers, number of effective ears, number of grains per ear, and fruit setting rate.

[0030] 2 Results and analysis

[0031] 2.1 Construction of rice OsBadh2 gene editing vector and Agrobacterium-mediated rice genetic transformation

[0032] The target site prediction was performed using the CRISPR-GE online website (http: / / skl.Scau.edu.cn / ), and two target sites were designed in the 3rd and 4th exons of OsBadh2 (see Figure 1 ) to construct the dual-target gene editing vector pYLCRISPR / Cas9-Badh2 (see Figure 2 ), and sequencing results showed that the two targets were accurately connected to the vector.

[0033] The constructed vector was transferred into E. coli, and single clones were selected for colony PCR verification using OsBadh2T1-U6bF and OsBadh2T2-U3R. The test results were as follows: Figure 3 As shown, the target bands were amplified from monoclonal clones No. 1, No. 3, and No. 6, which may be positive colonies. The positive clones were sequenced and verified, and the results showed that the gene editing vector pYLCRISPR / Cas9-Badh2 was successfully constructed.

[0034] The gene editing vector pYLCRISPR / Cas9-Badh2 was transferred into the Agrobacterium tumefaciens EHA105 strain and then introduced into the callus tissue of the rice variety Jijing 809 in Jilin Province using the Agrobacterium genetic transformation method to obtain T 0 Generation of independently transformed plants with gene editing. Extract leaf tissue DNA, amplify PCR using specific amplification primers OsBadh2-d1F / R (same as 1.3 above), and screen gene-edited positive plants.

[0035] 2.2 Obtaining homozygous mutant strains after gene editing and mutation analysis

[0036] In order to screen the gene-edited homozygous strains, the genomic DNA of the gene-edited strains was extracted, amplified, purified and sequenced using the specific primers OsBadh2-d1F / R on both sides of the target site. The sequencing results were analyzed using DSDecode and SnapGene. The results showed that 3 of the gene-edited strains were wild-type, 9 were heterozygous mutants, and the remaining 3 were homozygous mutant strains. The 3 gene-edited homozygous strains all had gene fragment deletions and the same editing conditions, named OsBadh2-KO. Compared with the control, its nucleotide sequence had a 5bp nucleotide sequence deletion (such as Figure 4 shown).

[0037] 2.3 Fragrance identification of gene-edited homozygous lines

[0038] In order to identify the aroma of the gene-edited homozygous mutant strain, the rice leaf KOH solution immersion identification method and rice chewing method were used, and a 5-person identification panel evaluated the presence or absence of aroma. The results of the two aroma identifications (see Table 1 for details) showed that both the leaves and rice of the gene-edited homozygous mutant strain OsBadh2-KO had aroma.

[0039] Table 1: Fragrance identification of gene-edited homozygous mutant lines

[0040]

[0041] Note: N stands for no fragrance; Y stands for fragrance

[0042] 2.4 Analysis of agronomic traits of gene-edited homozygous mutant lines

[0043] Whether the CRISPR / Cas9 system targeted editing will affect the agronomic traits of the gene-edited homozygous mutant strains, the present invention investigated the agronomic traits of the gene-edited homozygous mutant strains cultivated under normal cultivation conditions, including plant height, ear length, tiller number, effective ear number and fruit setting rate, and the results showed that there was no significant difference in the agronomic traits between the homozygous mutant strains and the control varieties, indicating that the editing of the OsBadh2 gene using CRISPR / Cas9 technology had no significant effect on the main agronomic traits of Jijing 809.

[0044] Table 2: Agronomic traits of homozygous mutant lines

[0045]

[0046] in conclusion

[0047] In the present invention, the inventors used dual-target CRISPR / Cas9 genome editing technology to target and edit the OsBadh2 gene in the rice variety Jijing 809 in Jilin Province, and obtained a homozygous mutant strain. The results of leaf fragrance identification and rice fragrance identification showed that the obtained homozygous mutant strain had a fragrance trait. The present invention provides a new germplasm resource of fragrant rice and a creation method thereof for rice breeding in Jilin Province.

Claims

1. An application of rice aroma gene OsBadh2 using dual-target gene editing technology in cultivating aromatic japonica rice, specifically designing two targets in Exon3 and Exon4 regions in the CDS sequence of the OsBadh2 gene, respectively, and constructing a dual-target gene editing vector, which is introduced into rice varieties through Agrobacterium-mediated genetic transformation to obtain new aromatic rice germplasm, wherein the nucleotide sequences of the two target sites of the gene are shown in SEQ ID NO.1 and SEQ ID NO.

2.

2. An OsBadh2 gene editing vector pYLCRISPR / Cas9-OsBadh2 constructed using dual-target CRISPR / Cas9 technology, the vector comprising two guide gRNA expression frames having the two target fragments and a Cas9 nuclease, wherein the nucleotide sequences of the two targets are shown in SEQ ID NO.1 and SEQ ID NO.2.

Images