Tomato leaf senescence regulation gene SlECT5 and application thereof

Abstract

The invention discloses a tomato leaf senescence regulation gene SlECT5 and application thereof, and belongs to the field of biotechnology engineering. The invention discloses a nucleotide sequence SEQ ID No.1 and an amino acid sequence SEQ ID No.2 of a tomato SlECT5 gene, a slect5 mutant is obtained by utilizing a CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated protein 9) technology, and nucleotide insertion or deletion sequences SEQ ID No.5 and SEQ ID No.6 of the slect5 mutant are disclosed. The invention also provides an application of the m6A RNA methylation recognition protein SlECT5 in the premature senility process of tomato leaves. The Slect5 mutant shows a leaf premature senility phenomenon which is comprehensively reflected in that the chlorophyll content is reduced, the photosynthetic rate is reduced, the ion permeability is increased, the senility starting time of the Slect5 mutant is about 30 days earlier than that of a wild type, and a premature senility strain can be created by utilizing the Slect5 mutant; on the other hand, leaf senescence can be delayed through up-regulated expression of the gene, a physiological basis is provided for increasing the tomato yield, and the gene has good application value.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and in particular relates to a tomato leaf senescence regulating gene SlECT5 and an application thereof. Background Art

[0002] As a specialized organ for photosynthesis, leaves play a key role in converting light energy into organic matter required for plant growth and are the basis for plant growth and reproduction. During leaf development, changes in the environment such as temperature inversion and shading often lead to premature leaf senescence and decreased photosynthetic ability, which in turn threatens plant yield and quality, causing huge economic losses (Lei et al., 2023). Therefore, studying leaf senescence is crucial for maximizing resource utilization and promoting phenotypic plasticity, so that plants can adapt to the external environment under specific conditions. Leaf senescence is a life history strategy of plants. As leaves age, chloroplasts begin to degenerate, accompanied by the degradation of biomacromolecules such as proteins and lipids, and the released nutrients are recycled to other tissues and organs for plant growth (Woo et al., 2019, Zhou and Yang, 2023). Therefore, leaf senescence is not a completely negative process. It plays an important role in the circulation and redistribution of nutrients throughout the plant. In recent years, a large number of studies have been devoted to exploring senescence-related genes and delaying leaf senescence through genetic engineering. However, little is known about the mechanism of premature leaf senescence. Therefore, discovering the key genes that regulate premature aging of plant leaves is of great significance for a deep understanding of the molecular mechanism of premature aging, finding new strategies for artificially controlling leaf aging, and thus improving agricultural production.

[0003] In recent years, epigenetics has played an important role in regulating gene expression and improving agronomic or horticultural traits. 6 -Methyladenosine modification (m 6 A) is considered to be the most abundant internal modification in mRNA. 6 The A modification system consists of methyltransferase (writer), demethyltransferase (eraser) and recognition protein (reader). Methyltransferase and demethyltransferase are responsible for m 6 A's "writing" and "erasing", recognition protein and m 6 A modified RNA binding regulates the fate of post-transcriptional RNA and thus affects biological function (Vandivier and Gregory, 2018). 6 A modification is highly sensitive to changes in the internal and external environment, which makes it possible to use m 6 A editing has become a promising strategy for improving crop quality (Paluch-Lubawa et al., 2021). Studies on methyltransferase, demethyltransferase, and recognition protein coding genes have revealed m 6A modification is involved in many plant growth and development and stress processes (Shen et al., 2023, Tang et al., 2023). 6 Is A recognition protein involved in the regulation of leaf senescence and m 6 There are no reports on the molecular mechanism of A modification regulating aging. Summary of the invention

[0004] Based on the deficiencies of the prior art, the present invention aims to provide a tomato leaf senescence regulatory gene SlECT5 and its application, so as to provide technical support for revealing the molecular mechanism of premature leaf senescence and regulating the plant growth cycle.

[0005] To achieve the above objectives, the present invention adopts the following technical scheme: As a first aspect, the present invention provides an application of a tomato SlECT5 gene in regulating tomato leaf senescence, and the nucleotide sequence of the SlECT5 gene is shown in SEQ ID NO.1.

[0006] Furthermore, the amino acid sequence of the protein encoded by the SlECT5 gene is shown in SEQ ID NO.2.

[0007] Furthermore, the present invention provides a gRNA for editing the SlECT5 gene, the sequence of which is shown in SEQ ID No.3 and SEQ ID No.4.

[0008] Furthermore, the application is specifically: using CRISPR / Cas9 gene editing technology to knock out the SlECT5 gene, obtain a knockout mutant of SlECT5, and obtain a transgenic tomato plant with premature leaf senescence. Its chlorophyll content, maximum photochemical efficiency, and net photosynthetic rate are significantly lower than those of the wild type, and its transpiration and ion permeability are significantly higher than those of the wild type, and the proportion of yellowed leaves increases.

[0009] Furthermore, the nucleotide sequence of the knockout mutant of slect5 (i.e., the mutant nucleotide sequence in which one or more nucleotides are inserted or deleted in the nucleotide sequence of the gene SEQ ID No.1) is shown as SEQ ID NO.5 or SEQ ID NO.6, and the amino acid sequence is shown as SEQ ID NO.7 or SEQ ID NO.8.

[0010] As a second aspect, the present invention also provides a biological material expression cassette, a vector and an engineered bacterium containing the above gene.

[0011] As a third aspect, the present invention also provides a tomato m 6 Application of RNA methylation recognition protein SlECT5 in regulating tomato leaf senescence, the tomato m 6A The amino acid sequence of RNA methylation recognition protein SlECT5 is shown in SEQ ID NO.2.

[0012] As a fourth aspect, the present invention further provides an application of a tomato SlECT5 gene in creating a tomato strain with an early leaf senescence phenotype, wherein the nucleotide sequence of the SlECT5 gene is shown in SEQ ID NO.1.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] The present invention found that SlECT5 protein is closely related to premature senescence of tomato leaves, that is, SlECT5 negatively regulates the senescence of tomato leaves. The invention provides gene resources and application value for in-depth understanding of the molecular mechanism of tomato leaf senescence and finding new strategies for artificially controllable leaf senescence. By using CRISPR / Cas9 technology, the target site of the nucleotide sequence shown in SEQ ID No.1 can be edited to obtain premature senescence strains of tomato leaves, thereby achieving the goal of artificially regulating leaf senescence. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The nucleotide sequence of the SlECT5 gene and the schematic diagram of gene editing.

[0016] Figure 2 The leaf senescence phenotypes of the wild type, slect5-1 and slect5-2 grown for about 8 weeks; A is the observation of leaf senescence phenotype and the detection of maximum photochemical efficiency, B is the determination of chlorophyll content and maximum photochemical efficiency of senescent leaves, C is the determination of photosynthesis indicators, and D is the determination of ion permeability of senescent leaves.

[0017] Figure 3 The leaf senescence phenotypes of the wild type, slect5-1 and slect5-2 grown for about 12 weeks; A is the observation of leaf senescence phenotype, and B is the proportion of senescent leaves to the total number of leaves.

[0018] Figure 4 The leaf senescence phenotypes of the wild type, slect5-1, and slect5-2 grown for about 18 weeks. DETAILED DESCRIPTION

[0019] The following is a detailed description of exemplary embodiments of the present invention. The description of the exemplary embodiments is only for illustrative purposes and is in no way intended to limit the present invention and its application or usage.

[0020] Example 1: CRISPR / Cas9 system-mediated SlECT5 gene knockout

[0021] 1. gRNA target selection

[0022] Log in to the plant genome database (https: / / phytozome-next.jgi.doe.gov / ) to search for the SlECT5 gene sequence. The nucleotide sequence is shown in SEQ ID No. 1, and the amino acid sequence is shown in SEQ ID No. 2. Use the gRNA online design website (http: / / crispr.hzau.edu.cn / CRISPR2 / ) to select the gRNA sequence of SlECT5, as shown in Figure 1 As shown, the gRNAs with sequences as described in SEQ ID No. 3 and SEQ ID No. 4 are located in the fourth exon of SlECT5.

[0023] 2. Construction of pCAMBIA1301-SlECT5-KO knockout vector

[0024] The gRNA with the added target linker was used as a primer to synthesize the sense strand (SEQ ID No.3) and the complementary strand (SEQID No.4). The sense and antisense gRNA strands were annealed into double strands at a concentration of 100 μM. The system and procedure were 1 μL of each sense strand and antisense strand, 8 μL of water, 37°C for 30 min, 95°C for 5 min, and then cooled to room temperature at a rate of 5°C / min. The obtained double-stranded sgRNA was diluted 100-200 times and connected to the pAtU6-sgRNA-pAtUBQ-Cas9-pMD18T linearized vector digested with BpiⅠ by T4 ligase to obtain the recombinant vector pMD18T-gSlECT5. The pMD18T-gSlECT5 vector and the pCAMBIA1301 vector were double-digested with HindⅢ and KpnⅠ, and the pMD18T-gSlECT5 was cloned into the pCAMBIA1301 vector by T4 ligation to obtain the knockout vector pCAMBIA1301-SlECT5-KO.

[0025] 3. Transformation of pCAMBIA1301-SlECT5-KO plasmid into Agrobacterium GV3101

[0026] The recombinant vector pCAMBIA1301-SlECT5-KO in step 2 was introduced into Agrobacterium GV3101 by heat shock method and named GV3101-SlECT5-KO.

[0027] 4. Tomato Genetic Transformation

[0028] Tomato variety 'Ailsa Craig' was sown in MS medium in advance, and the recombinant Agrobacterium GV3101-SlECT5-KO was used to infect tomato cotyledons by leaf disc method. Differentiation and regeneration were carried out in a medium containing hygromycin, and the transgenic plants were named slect5.

[0029] 5. Identification of transgenic positive seedlings and detection of mutation types

[0030] DNA of T0 transgenic plants was extracted, and the target fragment was amplified by PCR using T-DNA insertion detection primers M13-F and gSlECT5-R to screen transgenic positive plants. According to the SlECT5 gene sequence, mutation detection primers SlECT5-F and SlECT5-R were designed, and the mutation type of the target site was determined by sequencing the PCR amplification products.

[0031] The primer sequences are as follows:

[0032] M13-F(SEQ ID NO.9):GTAAAACGACGGCCAGT

[0033] gSlECT5-R(SEQ ID NO.10):AAACTCCGGATTCGTATATCGTGC

[0034] SlECT5-F(SEQ ID NO.11):AGATGGGGCAAACGGTC

[0035] SlECT5-R(SEQ ID NO.12):AGAGGGCTGGAAATACGGATAG

[0036] The PCR amplification system is shown in Table 1:

[0037] Table 1 PCR amplification system

[0038] Components volume 2×Taq Master Mix 12.5μL Forward primer (10 μM) 1μL Reverse primer (10 μM) 1μL Template DNA 1μL ddH2O 9.5μL

[0039] The PCR reaction conditions are shown in Table 2:

[0040] Table 2 PCR reaction conditions

[0041]

[0042] Through the above steps, the mutant plants slect5-1 and slect5-2 of SlECT5 were detected and obtained. Figure 1 ), the nucleotide sequences after mutation are shown in SEQ ID No. 5 and SEQ ID NO. 6, and the amino acid sequences are shown in SEQ ID No. 7 and SEQ ID NO. 8. The insertion or deletion of bases causes the protein translation to shift frame and terminate prematurely.

[0043] Example 2: Detection and application of leaf senescence of SlECT5 knockout mutant

[0044] Four-week-old wild-type and slect5 mutant plants were transplanted to the field, and when the plants grew to eight weeks old, the third true leaf above the cotyledon was taken for statistical analysis of senescence traits. Figure 2 As shown, the leaves of the wild type are emerald green, while the leaves of slect5-1 and slect5-2 show yellow-brown spots, and the senescence phenomenon is particularly obvious ( Figure 2 A). The chlorophyll content of the third true leaf was measured using a handheld chlorophyll meter SPAD. The results showed that the chlorophyll content of the wild-type leaves was 45SPAD, indicating that no senescence occurred, while the chlorophyll content of the slect5-1 and slect5-2 mutants was 35SPAD, which was significantly lower than that of the wild type ( Figure 2 B), the maximum photochemical efficiency of slect5-1 and slect5-2 was also significantly lower than that of the wild type ( Figure 2 B). Further photosynthetic rate statistics showed that the net photosynthetic rate of slect5-1 and slect5-2 was reduced to 1.6 times that of the wild type, the transpiration rate increased to 1.7 times that of the wild type, and the stomatal conductance and CO2 concentration remained unchanged ( Figure 2 C). In addition, the ion permeability of the third true leaves of slect5-1 and slect5-2 was significantly higher than that of the wild type ( Figure 2 D). These indicators showed that at the 8th week of plant growth, the leaves of the wild-type plants showed no signs of senescence, while the leaves of the slect5-1 and slect5-2 mutants showed signs of senescence. Further observations revealed that at the 12th week of plant growth, about half of the leaves of the slect5-1 and slect5-2 mutants turned yellow or wilted, while only 28% of the leaves of the wild-type plants turned yellow ( Figure 3 When the plants grew to the 18th week, the leaf senescence of slect5-1 and slect5-2 mutants became more obvious ( Figure 4 ). It can be seen that the leaf senescence caused by SlECT5 knockout is about 1 month earlier than that of the wild type. Therefore, SlECT5 is an important factor in regulating tomato leaf senescence, and the acquisition of SlECT5 knockout mutants can be used to cultivate tomato strains with premature leaf senescence.

[0045] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Application of tomato SlECT5 gene in regulating tomato leaf senescence, characterized in that: The nucleotide sequence of the SlECT5 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The amino acid sequence of the protein encoded by the SlECT5 gene is shown in SEQ ID NO.

2.

3. The use according to claim 1, characterized in that: The application is specifically: using CRISPR / Cas9 gene editing technology to knock out the SlECT5 gene, obtaining a knockout mutant of SlECT5, and obtaining a transgenic tomato plant with premature leaf senescence.

4. The use according to claim 3, characterized in that: The nucleotide sequence of the knockout mutant of slect5 is shown in SEQ ID NO.5 or SEQ ID NO.6, and the amino acid sequence is shown in SEQ ID NO.7 or SEQ ID NO.

8.

5. A biological material expression cassette, vector and engineered bacteria containing the gene according to claim 4.

6. Tomato 6 Application of RNA methylation recognition protein SlECT5 in regulating tomato leaf senescence, characterized in that: The tomato m 6 A The amino acid sequence of RNA methylation recognition protein SlECT5 is shown in SEQ ID NO.

2.

7. Use of the tomato SlECT5 gene in creating a tomato line with an early leaf senescence phenotype, characterized in that: The nucleotide sequence of the SlECT5 gene is shown in SEQ ID NO.1.

Images