Application of OsEnS-110 gene in regulating salt tolerance in rice

Abstract

The present invention discloses the application of OsEnS-110 gene in regulating rice salt tolerance. It belongs to the technical field of plant genetic engineering. The present invention provides the application of OsEnS-110 gene in regulating rice salt tolerance, and proves for the first time the role of rice OsEnS-110 gene in rice salt tolerance. Through research, it is found that overexpression of OsEnS-110 gene can improve the salt tolerance of rice plants and improve their survival rate under salt stress, indicating that OsEnS-110 gene has the function of regulating plant salt tolerance, and solves the adverse effect of soil salinization on rice growth in practical applications. At the same time, the biological function verification of the gene is also of great reference significance for the study of the molecular mechanism of rice salt tolerance.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and more specifically to the application of OsEnS-110 gene in regulating the salt tolerance of rice. Background Art

[0002] Soil salinization is one of the major disasters that restricts the growth and production of crops worldwide. According to statistics, the area of ​​salinized land in the world is expanding year by year. Rice is one of the most important food crops in my country and the preferred food crop for the improvement of coastal tidal flats and saline-alkali soils. However, rice growth is sensitive to salt stress, and soil salinization can cause rice growth to be stunted and yield to decrease. High concentrations of salt can affect the absorption of water and nutrients by rice roots, affecting the growth, development and yield of rice. In addition, soil salinization requires more agricultural water flushing to reduce the salt content in the soil, which may increase irrigation costs and water resource consumption. Therefore, exploring rice salt-tolerant genes and analyzing the genetic and molecular mechanisms of rice salt tolerance can provide a good theoretical basis for breeding new salt-tolerant rice varieties. At the same time, it has far-reaching significance for global food security, sustainable agricultural development, sustainable use of land resources and improvement of the ecological environment.

[0003] At present, there are relatively few studies on rice salt tolerance genes. The inventor's research team has been engaged in the mining of rice abiotic stress-related functional genes, and obtained a gene with unknown function, OsEnS-110, through bioinformatics and other means. Therefore, how to explore the functions of many unknown genes, develop rice salt tolerance genes, and apply them in the breeding of rice salt-tolerant varieties is a technical problem that technicians in this field urgently need to solve. Summary of the invention

[0004] In view of this, the present invention provides an application of the OsEnS-110 gene in regulating the salt tolerance of rice. Through research, it is found that overexpressing the OsEnS-110 gene can improve the salt tolerance of rice plants and improve their survival rate under salt stress, indicating that the OsEnS-110 gene has the function of regulating plant salt tolerance and solves the adverse effect of soil salinization on rice growth in practical applications.

[0005] In order to achieve the above object, the present invention adopts the following technical solution:

[0006] Application of the OsEnS-110 gene, wherein the application is any one of the following:

[0007] (1) Application in regulating rice salt tolerance;

[0008] (2) As a biological indicator for salt tolerance testing;

[0009] (3) Application in breeding of salt-tolerant rice varieties;

[0010] The nucleotide sequence of the OsEnS-110 gene is shown in SEQ ID No.1.

[0011] Another object of the present invention is to provide: an application of the protein encoded by the OsEnS-110 gene, wherein the application is any one of the following:

[0012] (1) Application in regulating rice salt tolerance;

[0013] (2) As a biological indicator for salt tolerance testing;

[0014] (3) Application in the breeding of salt-tolerant rice varieties.

[0015] Preferably, the amino acid sequence of the protein encoded by the OsEnS-110 gene is shown as SEQ ID No.2.

[0016] Another object of the present invention is to provide: an overexpression vector

[0017] pCAMBIA1300-GFP-OsEnS-110 comprises the above-mentioned OsEnS-110 gene.

[0018] Another object of the present invention is to provide: a recombinant engineered bacterium comprising the above-mentioned overexpression vector pCAMBIA1300-GFP-OsEnS-110.

[0019] Another object of the present invention is to provide the above-mentioned overexpression vector

[0020] Application of pCAMBIA1300-GFP-OsEnS-110 or the above-mentioned engineering bacteria in improving the salt tolerance of rice or in breeding salt-tolerant rice varieties.

[0021] Another object of the present invention is to provide: a method for improving the salt tolerance of rice, by overexpressing the OsEnS-110 gene to improve the tolerance of rice to salt stress.

[0022] It can be seen from the above technical solution that compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention discloses the application of the OsEnS-110 gene in regulating the salt tolerance of rice, discloses for the first time the gene OsEnS-110 in rice that has the function of regulating salt tolerance, and promotes the annotation of its gene function. The tolerance of rice to salt stress can be improved by overexpressing the OsEnS-110 gene, indicating that the gene positively regulates the high salt stress of rice. The adverse effects of salinized soil on rice growth in practical applications are solved, and the invention has social benefits and economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0025] Figure 1 : Linearized pCAMBIA1300-GFP vector map;

[0026] Figure 2 The following are: the expression levels of OsEnS-110 protein in three homozygous transgenic lines OE-2, OE-3, OE-4 and wild-type plants;

[0027] Figure 3 A: Identification of salt tolerance of OsEnS-110 overexpressing plants; A: Growth status of plants after 150mM NaCl treatment; B: Statistical results of rice seedling survival rate after 10 days of recovery;

[0028] Among them, Nip represents the wild-type Nipponbare, OE-2, OE-3, and OE4 represent plants overexpressing OsEnS-110; one star indicates a significant difference compared with the control, and two stars indicate a very significant difference compared with the control. DETAILED DESCRIPTION

[0029] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] The nucleotide sequence of the OsEnS-110 gene is shown in SEQ ID No. 1:

[0031] ATGGCCTCCGCCGTCGTAGCCAAGCCACCGGCCGCCGCTCCGGCGAGCCGCCGCCGATGCTTCGTCTTCGTAGAGCGCGCCGCCGCCGCCGCCGTCGGCGTCAACGCGGCGATCGCTGCCGTCGATGACCACCGCCCAGTTCCGGCCGCGGCCGCCGCCGCCATGGACGACGTCGTCGGCCGCGTCGCGCGGCCTGCGCGCCCCAGCGCGCGCGCCATCATGGAGGGGACGCACAAGCAGATCAGCTCCGGCGGCGCCTCGGGCGGCTACTGCACCGTGCCGTGGTGCAGCATCTGCACCGGGAATAACCCGTTCGCCATTGCCGAGTTCTTGCTGTGCTGCAACCTCTGCGGCGTCCCTCTCGCCGGCCGCCCCAGCTTCATCTACATTGGAGAGAAGGCGTTCTGCAAGGAGGAGTGCAGGTCGAGGTACGTGGTGGAGGAGGCGCTGCGCGAGGCGAGGGAGGAGAAGCGCCGCGCCGCCGCCGCCGCCGCCGCGTCGCCGGAGAAGAAGAAGGAGGCGGCGGCGGCGAGGAAGGGCGGGGAGGAGTGCAGGGAGGGGAGCATCTTCTTCATCTGCGCCGACGACCTGTGA, SEQ ID No.1.

[0032] The amino acid sequence encoded by the OsEnS-110 gene is shown in SEQ ID No.2 as follows:

[0033] MASAVVAKPPAAAPASRRRCFVFVERAAAAAVGVNAAIAAVDDHRPVPAAAAAAMDDVVGRVARPARPSARAIMEGTHKQISSGGASGGYCTVPWCSICTGNNPFAIAEFLLCCNLCGVPLAGRPSFIYIGEKAFCKEECRSRYVVEEALREAREEKRRAAAAAAASPEKKKEAAAARKGGEECREGSIFFICADDL, SEQ ID No.2.

[0034] Example 1

[0035] 1) Obtaining total RNA

[0036] Total RNA was extracted from the ears of japonica rice variety Nipponbare (stored at the Rice Research Institute of Guangdong Academy of Agricultural Sciences) using a plant RNA extraction kit (Magen), and the purity and concentration of RNA were detected using NANODROP 2000C (Thermo SCIENTIFIC).

[0037] 2) Acquisition of total cDNA

[0038] 1 μg of high-quality RNA was reverse transcribed to obtain cDNA, and the reverse transcriptase was PrimeScript (TAKARA).

[0039] 3) Obtaining the full-length cDNA of the target gene

[0040] According to the target gene, specific amplification primers were designed, and the target gene was amplified using cDNA as a template and KOD FX polymerase (ToYoBo). The specific amplification primer sequences are as follows:

[0041] F: 5'-CTGATTAACAGGGATCCCCCATGGCCTCCGCCGTCGTA-3', SEQ ID No. 3;

[0042] R: 5'-TCGAGACTAGTGGTACCCCCCAGGTCGTCGGCGCAGAT-3', SEQ ID No. 4;

[0043] The amplification system is: cDNA 0.5μL (cDNA content 200ng), F primer (10pmol / L) 0.5μL, R primer (10pmol / L) 0.5μL, 2mM dNTP 2μL, 2*Buffer 15μL, KOD enzyme (1.0U / μL) 0.5μL, add water to 30μL. The reaction program is: 98℃5min; 98℃30sec, 62℃30sec, 68℃30sec, 35 cycles; 68℃10min.

[0044] 4) Construction of overexpression vector

[0045] The pCAMBIA1300-GFP vector was linearized with restriction endonuclease SmaⅠ (TAKARA). (The pCAMBIA1300-GFP vector was transformed from the pCAMBIA1300 vector and contains the maize Ubiquitin promoter and GFP tag. It was preserved by the Rice Research Institute of Guangdong Academy of Agricultural Sciences. The vector map is shown in Figure 1As shown). After the vector enzyme digestion product and PCR product were purified and recovered, they were recombined using a recombination kit (Novozyme). The recombination system was: target fragment: [0.04×insert fragment base pair number] ng, vector fragment: [0.02×cloning vector base pair number] ng, 5X buffer 2μL, ExnaseII 1μL, add water to 10μL. Recombination at 37℃ for 30min. All ligation products were taken and transformed into Escherichia coli DH5α with CaCl2. The transformation products were spread on LB solid culture medium (containing kanamycin resistance, the concentration of kanamycin was 50mg / L). After incubation at 37℃ overnight, 10 single clones were selected for plasmid extraction and colony PCR identification. Two positive clones were selected for sequencing. Finally, the overexpression vector pCAMBIA1300-GFP-OsEnS-110 containing the target gene of OsEnS-110 was obtained.

[0046] Example 2

[0047] 1) Obtaining OsEnS-110 overexpressing plants

[0048] The overexpression vector pCAMBIA1300-GFP-OsEnS-110 constructed above was transformed into the japonica rice variety Nipponbare by using the genetic transformation method mediated by Agrobacterium EHA105. T0 generation transgenic seedlings were obtained through selection culture, differentiation, rooting and seedling hardening (the acquisition of genetic transformation materials was entrusted to Wuhan Boyuan Biotechnology Co., Ltd.).

[0049] The DNA of the obtained transgenic seedlings was extracted using a plant DNA extraction kit (Magen), and PCR identification was performed to amplify the GFP fragment. The specific amplification primer sequences are as follows:

[0050] F: 5'-CAAGCTGACCCTGAAGTTCA-3', SEQ ID No. 5;

[0051] R: 5'-ATGTGATCGCGCTTTCCGTT-3', SEQ ID No. 6;

[0052] The amplification system is: DNA 1μL (about 200ng), F primer (10pmol / L) 0.5μL, R primer (10pmol / L) 0.5μL, 2*Taq Mix 10μL, add water to 20μL. The reaction program is: 95℃3min; 95℃30sec, 52℃25sec, 72℃30sec, 30 cycles; 72℃10min.

[0053] The 20 positive transgenic seedlings were propagated to obtain T1 and T2 generations. If the T2 generation plants sampled and tested were all transgenic plants, it was proved that the strain was homozygous. Three homozygous transgenic strains (OE-2, OE-3, OE4) were selected for Western Blot detection (with Nipponbare as the control), and T3 generation plants were obtained by continued planting, and subsequent experimental analysis was performed on T3 generation plants.

[0054] 2) Detection of OsEnS-110 overexpression effect

[0055] The process of Western Blot identification of the overexpression effect of OsEnS-110 gene in transgenic plants is as follows:

[0056] A: Extract total protein from rice leaves at the four-leaf stage. The extract composition is as follows: 0.1MTris-HCl (pH=8.0), 10% glycerol, 3.3% SDS, 0.05% β-mercaptoethanol. The extracted total protein is stored at -80℃;

[0057] B: 20 ​​μL of protein sample was separated by SDS-PAGE gel electrophoresis, incubated with GFP antibody (Trans Company) and then detected by Western Blot.

[0058] Results: The expression levels of OsEnS-110 protein in the three homozygous transgenic lines and wild-type Nipponbare rice plants were as follows: Figure 2 As shown, all three strains accumulated OsEnS-110-GFP fusion protein, while the wild-type plants did not show the target band. This result indicated that all three strains achieved the effect of overexpression of OsEnS-110.

[0059] Example 3

[0060] Identification of salt tolerance phenotype of OsEnS-110 overexpressing plants

[0061] Take the three homozygous T3 generation strains (OE-2, OE-3, OE4) and wild-type Nipponbare rice seeds in Example 2 to break dormancy at 49°C, soak the seeds, and germinate at 30°C. After 2 days, move the young sprouts to 96-well seeding plates, sow 16 seeds for each strain and wild type, and one seeding plate contains 3 transgenic strains and wild-type strains. When the seedlings grow to the 3-leaf stage under natural conditions, the seedlings are transferred to a solution containing 150mM NaCl and cultured for 10 days, and then recovered under normal conditions for 10 days. Take pictures and count the survival rate, and perform 3 biological replicates for each material.

[0062] Result analysis: The results before and after treatment are shown in Figure 3 In Figure A, after treatment with 150 mM NaCl, the growth status of the overexpression plants was significantly better than that of the control group Nipponbare.

[0063] The survival results are shown in Figure 3 In middle B, after treatment with 150 mM NaCl, the average survival rates were: Nip: 4.2%; OE-2: 56.3%; OE-3: 16.7%; OE-4: 56.3%.

[0064] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0065] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. The application of OsEnS-110 gene is characterized by: The application is any of the following: (1) Application in regulating rice salt tolerance; (2) Application in the breeding of salt-tolerant rice varieties; The nucleotide sequence of the OsEnS-110 gene is shown in SEQ ID No.

1.

2. The use of the protein encoded by the OsEnS-110 gene, characterized in that: The application is any of the following: (1) Application in regulating rice salt tolerance; (2) Application in the breeding of salt-tolerant rice varieties; The nucleotide sequence of the OsEnS-110 gene is shown in SEQ ID No. 1; The amino acid sequence of the protein encoded by the OsEnS-110 gene is shown in SEQ ID No.

2.

3. Use of an overexpression vector pCAMBIA1300-GFP-OsEnS-110 comprising the OsEnS-110 gene or an engineered bacterium comprising the overexpression vector pCAMBIA1300-GFP-OsEnS-110 in improving the salt tolerance of rice or breeding salt-tolerant rice varieties; the nucleotide sequence of the OsEnS-110 gene is shown in SEQ ID No.

1.

4. A method for improving salt tolerance of rice, characterized in that: The tolerance of rice to salt stress is improved by overexpressing the OsEnS-110 gene; the nucleotide sequence of the OsEnS-110 gene is shown in SEQ ID No.1.

Images