Taro genetic transformation method

Abstract

The invention discloses a taro genetic transformation method, and belongs to the technical field of biological breeding. The method comprises the following steps: carrying out propagation on embryogenic callus induced by a taro stem tip, infecting the embryogenic callus induced by the taro stem tip by using agrobacterium, and carrying out co-culture, resistant bud screening, test-tube taro induction and acclimatization and transplantation to obtain a taro genetic transformation seedling; wherein the agrobacterium tumefaciens is an agrobacterium tumefaciens strain GV3101 which is used for converting a pRI101-CeSUC3 recombinant plasmid. According to the method, screening and comparison are carried out through an infection mode in a taro genetic transformation process, culture conditions after infection, hormone coordination and concentration in a bud induction process and whether test-tube taro is induced or not, so that an efficient and stable taro genetic transformation system suitable for different genotype taro varieties is established, and the problems of difficulty in taro genetic transformation and the like are solved; and a foundation is laid for biological breeding of the taro.

Description

Technical Field

[0001] The invention belongs to the technical field of biological breeding, and in particular relates to a taro genetic transformation method. Background Art

[0002] taro( Colocasia esculenta (L). Schott) is a traditional edible and medicinal crop. Its bulbs are rich in many physiologically active substances, which can relieve various sub-health symptoms of the human body and are deeply favored by consumers. Due to its typical asexual reproduction characteristics and narrow genetic background, it is difficult to breed breakthrough new varieties. Genetic transformation technology is the basis of biological breeding and can be used for rapid and accurate improvement of crop varieties. However, there are currently no reports on genetic transformation technology of taro.

[0003] Agrobacterium-mediated genetic transformation plays an important role in plant transgenic breeding due to its advantages such as high efficiency, stability and simple operation. Transgenic breeding can provide a fast, efficient and accurate way to cultivate breakthrough new varieties of taro. Therefore, the development of taro genetic transformation technology can not only enrich taro breeding methods, but also support the transformation of taro from traditional breeding to biological breeding. Summary of the invention

[0004] The purpose of the present invention is to solve at least one of the technical problems existing in the prior art and to provide a taro genetic transformation method.

[0005] The technical solution of the present invention is as follows: In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is as follows: The present invention provides a method for genetic transformation of taro, which specifically comprises the following steps: S1. Taking embryonic callus induced from taro stem tip, multiplying and obtaining newly proliferated embryonic callus; infecting the newly proliferated embryonic callus with Agrobacterium, and then transferring the newly proliferated embryonic callus to co-culture medium for culture; S2. transferring the embryonic callus after co-cultivation to a differentiation screening medium to obtain resistant buds; S3. Select robust differentiated buds and transfer them to seedling medium to obtain resistant seedlings; S4. Select resistant seedlings with a height of 5 to 7 cm, transfer them to a test tube taro induction medium, and obtain resistant test tube taro; S5. Harden the resistant test tube taro and plant them in the greenhouse.

[0006] Wherein, the Agrobacterium is the Agrobacterium strain GV3101 transformed with the pRI101-CeSUC3 recombinant plasmid.

[0007] Optionally, the method for obtaining the Agrobacterium strain GV3101 transformed with the pRI101-CeSUC3 recombinant plasmid comprises the following steps: The amplification was performed using taro cDNA as a template. The system was as follows: 2 μL DNA template, 8 μL DNA polymerase, 0.5 μL upstream primer, 0.5 μL downstream primer, and ddH2O was added to 20 μL. The procedure was as follows: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 54°C annealing for 20 s, 72°C extension for 45 s, 36 cycles, 72°C final extension for 5 min, and storage at 4°C to obtain the CeSUC3 fragment with homologous recombination sequence. Among them, the upstream primer F (SEQ ID NO: 1): 5'-TCTTCACTGTTGATACATATGATGGACGCCATCTCGATCCG-3', the downstream primer R (SEQ ID NO: 2): 5'-AGAGTTGTTGATTCAGAATTCTTAGCCAAATCCATGAAGACCCG-3'; The overexpression vector pRI101-AN circular plasmid was digested with NdeⅠ and EcoRⅠ restriction endonucleases to obtain linearized pRI101-AN; Linearized pRI101-AN and CeSUC3 fragment with homologous recombination sequence were mixed at a molar ratio of 1:3 and incubated at 37°C for 30 min. The system was: 1 μL linearized pRI101-AN, 3 μL CeSUC3 fragment with homologous recombination sequence, 5 μL universal enzyme premix, and ddH2O was added to 10 μL. The recombinant mixed solution was transformed into Escherichia coli DH5α, plated, single clones were picked, shaken, colony PCR was performed, and the single clone with the target band was selected for sequencing. The single clone with the correct sequence was selected and shaken again to extract the recombinant plasmid pRI101-CeSUC3 and transformed into Agrobacterium GV3101 with heat shock at 37°C.

[0008] Optionally, in the above method, the embryonic callus material induced by the shoot tip in step S1 comes from the shoot tip induction of taro varieties with different genotypes such as bent root taro, flower and fruit taro, Ganyu No. 1, and Ganyu No. 2; Optionally, in the above method, the proliferation medium in step S1 is MS+sucrose 30 g / L+TDZ 2 mg / L+NAA 0.1 mg / L+agar powder 6.5 g / L, with a pH of 5.8-6.0, and the conditions for the propagation are: culturing in the dark at a temperature of 24°C-26°C; Optionally, in the above method, the method of using Agrobacterium to infect newly propagated embryonic callus in step S1 specifically includes: Pre-treat Agrobacterium, then resuspend the bacteria in Agrobacterium infection solution. After resuspension, the concentration of the bacterial solution is adjusted to OD 600 = 0.6~0.8; The newly proliferated embryonic callus was collected in a sterile conical flask, and the bacterial solution was poured into the flask, which was sealed with a sterile sealing film. At room temperature, the flask was first infected on a shaking table at 100 rpm for 15 minutes, and then kept at a vacuum condition of -0.1 MPa for 15 minutes, with a total infection time of 30 minutes. The Agrobacterium infection solution includes the following ingredients: 1 / 2 MS + sucrose 30 g / L + acetosyringone 20µmol / L ~30µmol / L, pH 5.8~6.0, Optionally, in the above method, the method of pre-treating Agrobacterium includes: Place a single colony of Agrobacterium in 2 mL of YEB medium, add the corresponding antibiotics, and culture at 28°C with a shaker at 180 rpm for 12 h until the bacteria are fully revived; Take 500 μL of the revived bacterial solution and add it to 10 mL of YEB medium, add the corresponding antibiotics, and culture it in a shaking incubator at 180 rpm at 28°C for 12 h until the bacterial solution OD reaches 600 Reach 0.9~1.1; Centrifuge at 5000 rpm for 10 min, discard the supernatant, and collect the Agrobacterium cells.

[0009] Optionally, in the above method, the co-culture medium described in step S1 comprises the following components: MS + sucrose 30 g / L + acetosyringone 20 µmol / L ~30 µmol / L, pH 5.8~6.0, and the co-culture conditions are: 24°C~26°C dark culture for 3d~4d; Optionally, in the above method, the differentiation screening medium described in step S2 comprises the following components: MS + 6-BA 1.0 mg / L + NAA 0.5 mg / L + sucrose 30 g / L + acetosyringone 20 µmol / L~30 µmol / L + timentin 250 mg / L + kanamycin 50 mg / L, pH 5.8~6.0, and the conditions for differentiation culture are: 24°C~26°C, first culture in the dark for 7d~14d, and then culture under light conditions, the light intensity is 2000 Lx~3000 Lx, and the photoperiod is 16h light and 8h dark; Optionally, in the above method, the seedling culture medium described in step S3 comprises the following components: MS + 6-BA 1.0 mg / L + NAA 0.5 mg / L + sucrose 30 g / L + timentin 250 mg / L + kanamycin 50 mg / L, pH 5.8-6.0, and the conditions for seedling culture are: temperature 24°C-26°C, light intensity 2000 Lx-3000 Lx, and photoperiod of 16h light and 8h dark; Optionally, in the above method, the test tube taro induction medium described in step S4 comprises the following components: MS + sucrose 80 g / L + timentin 250 mg / L + kanamycin 50 mg / L, pH 5.8-6.0, and the conditions for test tube taro induction culture are: temperature 24°C-26°C, light intensity 2000 Lx-3000 Lx, and photoperiod of 16h light and 8h dark; Optionally, in the above method, the resistant test tube taro described in step S5 is moved to normal temperature conditions, hardened for 3d~5d, then the seedlings are taken out, the base culture medium is cleaned, and planted in a matrix, the matrix is ​​peat: vermiculite with a volume ratio of 2:1, bagged for moisture retention for 3d~5d, and grown in a greenhouse. The growth conditions are: temperature 20℃~30℃, light intensity 2000 Lx~4000 Lx, photoperiod of 12h~14h light and 10h~12h dark, to obtain surviving plants.

[0010] The present invention has at least one of the following beneficial effects: 1. A method for genetic transformation of taro is provided, which uses Agrobacterium to infect taro stem tips to induce embryonic callus tissue, conducts co-cultivation, resistant bud screening, induction of test tube taro, seedling hardening and transplanting, and obtains genetically transformed taro seedlings.

[0011] 2. The present invention screens and compares the infection mode, culture conditions, hormone combination and concentration, and whether the test tube taro is induced, and establishes an efficient and stable taro genetic transformation system suitable for taro varieties with different genotypes, thereby overcoming the difficulties in taro genetic transformation and other problems, and can be used for taro biological breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 It is a physical picture of taro embryonic callus in Example 1; Figure 2 This is a physical picture of the co-cultivation of embryonic callus and Agrobacterium in Example 1; Figure 3 This is a diagram of the transformation vector in Example 1; Figure 4 This is a physical picture of the resistant buds screened from the infected callus in Example 1; Figure 5 This is a physical picture of the seedlings grown from the resistant buds in Example 1; Figure 6 This is a physical picture of the test tube taro induced with resistant seedlings in Example 1; Figure 7 PCR electrophoresis detection of the pRI101-CeSUC3 strain in Example 1; Figure 8 PCR electrophoresis detection of pRI101-CeSUC3 strain in Comparative Example 2; Fig. 9 This is the PCR electrophoresis detection of the pRI101-CeSUC3 strain in Comparative Example 3. DETAILED DESCRIPTION

[0013] In order to make the technical problems, technical solutions and beneficial effects solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0014] Example 1: Agrobacterium-mediated genetic transformation of taro The specific steps include: (1) Propagation of stem tip embryonic callus a. In a clean bench, take the embryonic callus induced from the shoot tip of Ganyu No. 2 and inoculate it into the callus proliferation medium. The proliferation medium is MS + sucrose 30 g / L + thidiazuron (TDZ) 2 mg / L + naphthaleneacetic acid (NAA) 0.1 mg / L + agar powder 6.5 g / L, pH 5.8; b. Cultivate in dark conditions at 25°C; (2) Construction of overexpression vector a. Design specific primers based on the sequence of taro CeSUC3 gene (gene number EVM0005823.1), and add homologous recombination sequence (primer underlined part), upstream primer F (SEQ ID NO: 1): 5'- TCTTCACTGTTGATACATATG ATGGACGCCATCTCGATCCG-3', downstream primer R (SEQ ID NO: 2): 5'- AGAGTTGTTGATTCAGAATTC TTAGCCAAATCCATGAAGACCCG-3', taro cDNA was used as template for amplification, the system was as follows: 2 μL DNA template, 8 μL DNA polymerase (PrimeSTAR ® Max DNA Polymerase, R045A, Takara), 0.5 μL upstream primer, 0.5 μL downstream primer, ddH2O to 20 μL; the program is as follows: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 54℃ annealing for 20 s, 72℃ extension for 45 s, 36 cycles, 72℃ final extension for 5 min, 4℃ storage; b. Recover the CeSUC3 target fragment from gel, connect it to pMD19-T (Takara) for sequencing, and obtain a monoclonal vector with the correct sequence, that is, the CeSUC3 fragment with the homologous recombination sequence added; c. Use restriction endonucleases NdeⅠ and EcoRⅠ (New England Biolabs) at 25℃ for 1h to linearize the overexpression vector pRI101-AN. ​​The system is: pRI101-AN 1μg, NdeⅠ and EcoRⅠ 1μL each, buffer 1μL, ddH2O to make up to 20μL; The recovered linearized vector and the CeSUC3 fragment with homologous recombination sequence were mixed at a molar ratio of 1:3 and incubated at 37°C for 30 min. The system was: 1 μL linearized pRI101-AN, 3 μL CeSUC3 with homologous recombination sequence, 5 μL universal enzyme premix (2x Hieff Clone Universal Enzyme Premix, Yisheng Biotechnology (Shanghai) Co., Ltd.), and ddH2O was added to 10 μL. d. The recombinant mixture was transformed into Escherichia coli DH5α (Huayueyang Biotechnology Co., Ltd.), plated, single clones were picked, shaken, colony PCR was performed, and the single clone with the target band was selected for sequencing. The single clone with the correct sequence was selected and shaken again, and the recombinant plasmid pRI101-CeSUC3 was extracted and transformed into Agrobacterium GV3101 (Huayueyang Biotechnology Co., Ltd.) by heat shock at 37℃.

[0015] (3) Preparation for Agrobacterium infection a. Pick a single colony of Agrobacterium tumefaciens GV3101 containing the pRI101-CeSUC3 plasmid and place it in 2 mL YEB medium. Add kanamycin and rifampicin to a final concentration of 50 mg / L and 25 mg / L. Incubate at 28°C with a shaker at 180 rpm for 12 hours until the bacteria are fully revived. b. Take 500 μL of the revived bacterial solution and add it to 10 mL of YEB medium. Add kanamycin and rifampicin to a final concentration of 50 mg / L and 25 mg / L respectively. Incubate at 28°C with a shaker at 180 rpm for 12 h until the bacterial solution OD reaches 0. 600 Reach about 1.0; c. Centrifuge at 5000 rpm for 10 min, collect the cells, discard the supernatant, and resuspend the cells in infection solution. The infection solution includes the following components: 1 / 2 MS + sucrose 30 g / L + acetosyringone 25 µmol / L, pH 5.8; after resuspension, the concentration of the bacterial solution is adjusted to OD 600 = 0.8; (4) Agrobacterium infection of embryonic callus a. Collect the embryonic callus cultured in dark conditions in step (1) into a 50 mL sterile conical flask, pour the bacterial solution in step (3), seal with a sterile sealing film, and infect for 15 min. During this process, place the flask in a shaking incubator at 100 rpm and shake continuously. b. Place the tube back in the vacuum device and keep it under -0.1MPa vacuum for 15 minutes to ensure that the callus tissue is in full contact with the bacterial solution; c. Discard the bacterial solution in the clean bench, use sterile absorbent paper to absorb the bacterial solution on the surface of the callus tissue, and evenly place it on the co-culture medium for culture. The co-culture medium includes the following components: MS + sucrose 30 g / L + acetosyringone 25 µmol / L, pH 5.8; culture in the dark at 25℃ for 4 days; (5) Screening of resistant buds a. Place the callus tissue co-cultured for 4 days in step (4) evenly on a differentiation screening medium, which includes the following components: MS + 6-benzylaminoadenine (6-BA) 1.0 mg / L + naphthaleneacetic acid (NAA) 0.5 mg / L + sucrose 30 g / L + acetosyringone 25 µmol / L + timentin 250 mg / L + kanamycin 50 mg / L, pH 5.8; b. The culture conditions are 25°C, first cultured in the dark for 14 days, then cultured under light conditions, with a light intensity of 3000 Lx and a photoperiod of 16 hours of light and 8 hours of darkness; c. Transfer once every 15 days until the callus differentiates into resistant buds; d. Transfer the resistant buds to the seedling medium and grow them to 5cm~7cm. The seedling medium includes the following ingredients: MS + 6-benzylaminoadenine (6-BA) 1.0 mg / L + naphthaleneacetic acid (NAA) 0.5 mg / L + sucrose 30 g / L + timentin 250mg / L + kanamycin 50 mg / L, pH 5.8; the conditions for seedling culture are: temperature 25℃, light intensity 3000 Lx, photoperiod of 16h light and 8h dark.

[0016] (6) Induction of taro in vitro a. Transfer the healthy seedlings of 5 cm to 7 cm in height to the induction medium for taro culture. The induction medium for taro culture includes the following ingredients: MS + sucrose 80 g / L + timentin 250 mg / L + kanamycin 50 mg / L, pH 5.8; b. The conditions for induction culture of test tube taro are: temperature 25℃, light intensity 3000 Lx, photoperiod 16h light and 8h dark; c. After 6 to 8 weeks, the test tube taro will swell; (7) Transgenic plant cultivation a. Transfer the test tube taro to room temperature for 3 days, then take out the seedlings, clean the base culture medium, and plant them in a completely moistened substrate (peat: vermiculite volume ratio = 2:1), and compact them; b. Bag the plants to keep them moist for 3 days, then place them in a greenhouse for growth under the following growth conditions: temperature 25°C, light intensity 4000 Lx, photoperiod of 12 hours of light and 12 hours of darkness, to obtain surviving plants.

[0017] Comparative Example 1: Effects of different differentiation media on budding of taro embryonic callus The genetic transformation of taro was basically the same as in Example 1, except that in step (5), different concentrations of 6-BA (1.0, 2.0 mg / L) and TDZ (1.0, 2.0 mg / L) were selected in sequence and combined with NAA (0.1, 0.3, 0.5 mg / L) to induce buds, and the effects of different concentration ratios on the budding rate of taro were compared.

[0018] As shown in Table 1, there are obvious differences in the differentiation of taro embryonic callus under different hormone combinations and concentrations. When the cytokinin is TDZ, the budding rate of callus is relatively stable, ranging from 32.2% to 55.6%. When the cytokinin is 6-BA, the budding rate of callus varies greatly, with the lowest being only 15.6%. When the NAA content is 0.5 mg / L and the 6-BA content is 1.0 mg / L, the differentiation effect is the best, and the budding rate can reach more than 70%.

[0019] Comparative Example 2: Effect of vacuum treatment on genetic transformation rate of taro The genetic transformation of taro was basically the same as that in Example 1, except that in step (4), the embryonic callus was not infected with Agrobacterium under a vacuum of -0.1 MPa for 15 min. The effects of the two treatments on the positive transformation rate were compared.

[0020] Comparative Example 3: Effect of Dark Treatment on Genetic Transformation Rate of Taro after Callus Infection The genetic transformation of taro was basically the same as in Example 1, except that in step (5), the resistant buds were screened and transferred to the differentiation screening medium without first being cultured in the dark for 14 days. The effects of the two treatments on the positive transformation rate were compared.

[0021] Table 2 is a comparison of the positive transformation rates of Example 1 and Comparative Examples 2-3. The DNA of the leaves of the regenerated plants after transplantation was extracted, and the untransformed Ganyu No. 2 plant was used as a negative control, and the pRI101-SUC3 plasmid was used as a positive control. PCR detection was performed, and the detection fragment size was 398 bp. The detection primers F (SEQ ID NO: 3): 5'-CACGGGGGACTCTAGATACA-3', R (SEQ ID NO: 4): 5'-GGCATGTTCAATTCCGAGTGT-3'; the reaction system for PCR detection: 2 μL DNA template, 8 μL universal enzyme premix (2x Hieff Clone Universal Enzyme Premix, Yisheng Biotechnology (Shanghai) Co., Ltd.), 0.5 μL upstream primer, 0.5 μL downstream primer, ddH2O was added to 20 μL; PCR amplification program: 94℃ pre-denaturation for 4min; 98℃ denaturation for 10s, 54℃ annealing for 30s, 72℃ extension for 30s, 36 cycles; 72℃ final extension for 5min, 4℃ storage; PCR products were detected by 1.0% agarose gel electrophoresis ( Figure 7 ).

[0022] Figure 7 The PCR electrophoresis detection diagram of the pRI101-CeSUC3 strain in Example 1, a total of 23 regenerated plants were obtained, wherein M is a marker (Maker), + is a positive control group, - is a negative control group, 1 to 23 are pRI101-CeSUC3 regenerated plants, 100bp, 250bp, and 500bp represent the size of the marker bands, respectively, and the plants with the same size fragment as the positive control group are positive plants, and the plants without bands are negative plants. That is, among the 23 regenerated plants obtained in Example 1, 15 are positive plants and 8 are negative plants.

[0023] Figure 8 The PCR electrophoresis detection diagram of the pRI101-CeSUC3 strain in Comparative Example 2, a total of 29 regenerated plants were obtained, where M is a marker (Maker), + is a positive control group, - is a negative control group, 1 to 29 are pRI101-CeSUC3 regenerated plants, 100bp, 250bp, and 500bp represent the size of the marker bands, respectively. The plants with the same size fragment as the positive control group are positive plants, and the plants without bands are negative plants. That is, among the 29 regenerated plants obtained in Comparative Example 2, 2 are positive plants and 27 are negative plants.

[0024] Fig. 9The PCR electrophoresis detection diagram of the pRI101-CeSUC3 strain in Comparative Example 3, a total of 8 regenerated plants were obtained, where M is a marker (Maker), + is a positive control group, - is a negative control group, 1 to 8 are pRI101-CeSUC3 regenerated plants, 100bp, 250bp, and 500bp represent the size of the marker bands, respectively. The plants with the same size fragment as the positive control group are positive plants, and the plants without bands are negative plants. That is, among the 8 regenerated plants obtained in Comparative Example 3, 3 are positive plants and 5 are negative plants.

[0025] Figure 1 It is a physical picture of taro embryonic callus in Example 1; Figure 2 This is a physical picture of the co-cultivation of embryonic callus and Agrobacterium in Example 1; Figure 3 is a plasmid map of the genetic expression vector used in Example 1, showing the characteristics of plasmid pRI101-AN; Figure 4 This is a physical picture of the resistant buds screened from the infected callus in Example 1; Figure 5 This is a physical picture of the seedlings grown from the resistant buds in Example 1; Figure 6 is a physical picture of the test tube taro induced with resistant seedlings in Example 1; Figure 1 to Figure 7 It can be seen that the method of Example 1 can obtain transgenic plants, which can be used for biological breeding of taro.

[0026] By comparing Example 1 with Comparative Example 2, it can be concluded that vacuum treatment can improve the positive transformation rate; by comparing Example 1 with Comparative Example 3, it can be concluded that after Agrobacterium infects embryonic callus, dark culture for 14 days can improve the positive transformation rate.

[0027] Comparative Example 4: Effect of induction of test tube taro on the survival rate of resistant seedlings The genetic transformation of taro is basically the same as that of Example 1, except that in step (6), the healthy and strong strains with a height of 5 to 7 cm are transferred to a rooting medium for culture. The rooting medium contains the following ingredients: MS + 6-BA 1.0 mg / L + NAA 1.0 mg / L + sucrose 30 g / L + timentin 250 mg / L + kanamycin 50 mg / L, pH 5.8; the rooting culture conditions are: temperature 25°C, light intensity 3000 Lx, photoperiod 16 h light, 8 h dark, until rooting. The resistant plants obtained in Example 1 and Comparative Example 4 were transplanted, and the survival rate and plant growth were counted and recorded after 30 days.

[0028] As shown in Table 3, the survival rate of the taro was higher and the growth of the seedlings was better after induction and transplantation.

[0029] Example 2: Comparison of positive plant rates in taro varieties with different genotypes using the constructed genetic transformation system The genetic transformation of taro is basically the same as that in Example 1, except that the embryonic callus induced from the stem tips of multiple taro varieties with different genotypes, such as bent root taro, flower and fruit taro, and Ganyu No. 1, is used in sequence to carry out genetic transformation experiments according to the steps of Example 1, and the positive plant rates of taro varieties with different genotypes are compared.

[0030] As shown in Table 4, the developed taro genetic transformation technology can be used in taro varieties with different genotypes. The positive plant rate of multiple varieties is 48.0%~80.0%, and the positive transformation rate is 2.7%~5.0%.

[0031] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A method for genetic transformation of taro, characterized in that: The steps include: S1. Taking the embryonic callus induced from the taro stem tip and multiplying it to obtain newly proliferated embryonic callus; using Agrobacterium to infect the newly proliferated embryonic callus, and then transferring it to a co-culture medium for culture; S2. transferring the embryonic callus after co-cultivation to a differentiation screening medium to obtain resistant buds; S3. Select the robust resistant buds and transfer them to the seedling medium to obtain resistant seedlings; S4. Select the resistant seedlings with a height of 5 to 7 cm, transfer them to the test tube taro induction medium, and obtain resistant test tube taro; S5. Hardening the resistant test tube taro and planting it in a greenhouse; Wherein, the Agrobacterium is Agrobacterium strain GV3101 transformed with pRI101-CeSUC3 recombinant plasmid.

2. The method according to claim 1, characterized in that The method for obtaining the Agrobacterium strain GV3101 transformed with the pRI101-CeSUC3 recombinant plasmid comprises the following steps: The amplification was performed using taro cDNA as a template. The system was as follows: 2 μL DNA template, 8 μL DNA polymerase, 0.5 μL upstream primer, 0.5 μL downstream primer, and ddH2O was added to 20 μL. The procedure was as follows: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 54°C annealing for 20 s, 72°C extension for 45 s, 36 cycles, 72°C final extension for 5 min, and storage at 4°C to obtain the CeSUC3 fragment with homologous recombination sequence. Among them, the upstream primer F: 5'-TCTTCACTGTTGATACATATGATGGACGCCATCTCGATCCG-3', the downstream primer R: 5'-AGAGTTGTTGATTCAGAATTCTTAGCCAAATCCATGAAGACCCG-3'; The overexpression vector pRI101-AN circular plasmid was digested with NdeⅠ and EcoRⅠ restriction endonucleases to obtain linearized pRI101-AN; The linearized pRI101-AN and the CeSUC3 fragment with homologous recombination sequence were mixed at a molar ratio of 1:3, and incubated at 37°C for 30 min. The system was: 1 μL linearized pRI101-AN, 3 μL CeSUC3 fragment with homologous recombination sequence, 5 μL universal enzyme premix, and ddH2O was added to 10 μL. The recombinant mixed solution was transformed into Escherichia coli DH5α, plated, single clones were picked, shaken, colony PCR was performed, and the single clone with the target band was selected for sequencing. The single clone with the correct sequence was selected and shaken again to extract the recombinant plasmid pRI101-CeSUC3 and transformed into Agrobacterium GV3101 with heat shock at 37°C.

3. The method according to claim 1, characterized in that The embryonic callus tissue induced by the taro stem tip in step S1 is selected from the stem tip induction of any variety of taro, taro with fruit, Ganyu No. 1 and Ganyu No. 2, and the proliferation medium used for the expansion is MS + sucrose 30g / L + TDZ 2 mg / L + NAA 0.1 mg / L + agar powder 6.5 g / L, pH 5.8-6.0, and the propagation conditions are: culture in the dark at a temperature of 24°C-26°C.

4. The method according to claim 1, characterized in that The method of using Agrobacterium to infect newly propagated embryonic callus in step S1 specifically comprises: Pre-treat Agrobacterium to obtain Agrobacterium cells; then resuspend the Agrobacterium cells in Agrobacterium infection solution. After resuspension, the concentration of the bacterial solution is adjusted to OD 600 = 0.6~0.8; The newly proliferated embryonic callus was collected in a sterile conical flask, and the bacterial solution was poured into the flask, which was sealed with a sterile sealing film. At room temperature, the flask was first infected on a shaking table at 100 rpm for 15 minutes, and then kept at a vacuum condition of -0.1 MPa for 15 minutes, with a total infection time of 30 minutes. The Agrobacterium infection solution includes the following components: 1 / 2 MS + sucrose 30 g / L + acetosyringone 20 µmol / L~30 µmol / L, and the pH is 5.8~6.

0.

5. The method according to claim 4, characterized in that Methods for pre-treatment of Agrobacterium include: Place a single colony of Agrobacterium in 2 mL of YEB medium, add the corresponding antibiotics, and culture at 28°C with a shaker at 180 rpm for 12 h until the bacteria are fully revived; Take 500 μL of the revived bacterial solution and add it to 10 mL of YEB medium, add the corresponding antibiotics, and culture it in a shaking incubator at 180 rpm at 28°C for 12 h until the bacterial solution OD reaches 600 Reach 0.9~1.1; Centrifuge at 5000 rpm for 10 min, discard the supernatant, and collect the Agrobacterium cells.

6. The method according to claim 1, characterized in that The co-culture medium in step S1 includes the following components: MS + sucrose 30 g / L + acetosyringone 20 µmol / L~30 µmol / L, pH 5.8~6.0, and culture conditions: 24°C~26°C in the dark for 3 d~4 d.

7. The method according to claim 1, characterized in that The differentiation screening medium described in step S2 includes the following components: MS + 6-BA 1.0 mg / L + NAA 0.5 mg / L + sucrose 30 g / L + acetosyringone 20 µmol / L~30 µmol / L + timentin 250 mg / L + kanamycin 50 mg / L, pH 5.8~6.0, and the conditions for differentiation culture are: 24°C~26°C, first culture in the dark for 7d~14d, and then culture under light conditions, the light intensity is 2000 Lx~3000 Lx, and the photoperiod is 16h light and 8h dark.

8. The method according to claim 1, characterized in that The seedling culture medium in step S3 includes the following components: MS +6-BA 1.0 mg / L + NAA 0.5 mg / L + sucrose 30 g / L + timentin 250 mg / L + kanamycin 50 mg / L, pH 5.8~6.0, and the conditions for seedling culture are: temperature 24℃~26℃, light intensity 2000 Lx~3000 Lx, and photoperiod of 16h light and 8h dark.

9. The method according to claim 1, characterized in that The test tube taro induction medium described in step S4 includes the following components: MS + sucrose 80 g / L + timentin 250 mg / L + kanamycin 50 mg / L, pH 5.8-6.0, and the conditions for test tube taro induction culture are: temperature 24°C-26°C, light intensity 2000 Lx-3000 Lx, and photoperiod of 16h light and 8h dark.

10. The method according to claim 1, characterized in that In step S5, the resistant test tube taro is moved to normal temperature conditions, hardened for 3 to 5 days, and then the seedlings are taken out, the base culture medium is cleaned, and the seedlings are planted in a matrix, wherein the matrix is ​​peat: vermiculite with a volume ratio of 2:1, bagged for moisture retention for 3 to 5 days, and grown in a greenhouse. The growth conditions are: temperature 20°C to 30°C, light intensity 2000 Lx to 4000 Lx, and photoperiod of 12h to 14h light and 10h to 12h dark, to obtain surviving plants.

Images